ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart26e10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 139 1e-30
2gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 66 1e-08
3gb|AC155942.6| Mus musculus 10 BAC RP24-492L7 (Roswell Park Canc... 44 0.051
4gb|AC153156.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 42 0.20
5gb|AC104706.2| Oryza sativa (japonica cultivar-group) chromosome... 42 0.20
6emb|BX537273.16| Zebrafish DNA sequence from clone CH211-151F2 i... 42 0.20
7gb|AC116631.6| Homo sapiens BAC clone RP11-429B11 from 4, comple... 42 0.20
8dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.20
9emb|CR361565.8| Zebrafish DNA sequence from clone CH211-242L1 in... 42 0.20
10emb|BX005014.5| Zebrafish DNA sequence from clone CH211-103E2 in... 42 0.20
11gb|AC117081.2| Dictyostelium discoideum chromosome 2 map 5862124... 40 0.79
12gb|AC122907.4| Mus musculus BAC clone RP23-49I4 from chromosome ... 40 0.79
13emb|BX511098.5| Zebrafish DNA sequence from clone CH211-202L3 in... 40 0.79
14gb|AC104511.5| Drosophila melanogaster X BAC RP98-39D14 (Roswell... 40 0.79
15emb|BX004760.10| Zebrafish DNA sequence from clone CH211-222O4 i... 40 0.79
16gb|AC011763.6|AC011763 Drosophila melanogaster, chromosome 3R, r... 40 0.79
17gb|AC155299.2| Mus musculus BAC clone RP24-229D17 from chromosom... 40 0.79
18emb|AL929213.5| Zebrafish DNA sequence from clone CH211-144A19, ... 40 0.79
19emb|BX255893.5| Zebrafish DNA sequence from clone CH211-272H10 i... 40 0.79
20gb|AE003717.2| Drosophila melanogaster chromosome 3R, section 55... 40 0.79
21gb|AE003491.4| Drosophila melanogaster chromosome X, section 43 ... 40 0.79
22gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete... 38 3.1
23gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete... 38 3.1
24gb|AY180151.1| Herpetomonas muscarum small subunit ribosomal RNA... 38 3.1
25gb|AC185533.1| Drosophila melanogaster clone BACR48D21, complete... 38 3.1
26emb|AL954219.1| Pan troglodytes chromosome 22 clone PTB-302M06 m... 38 3.1
27emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chr... 38 3.1
28gb|AC160115.2| Mus musculus BAC clone RP23-473K23 from chromosom... 38 3.1
29emb|CR846090.6| Zebrafish DNA sequence from clone DKEYP-78E10 in... 38 3.1
30gb|AC089987.26| Homo sapiens 12q BAC RP11-722P11 (Roswell Park C... 38 3.1
31ref|NM_176004.1| Drosophila melanogaster CG13125-RB, transcript ... 38 3.1
32ref|NM_135481.2| Drosophila melanogaster CG13125-RA, transcript ... 38 3.1
33gb|AE009926.1|AE009926 Pyrobaculum aerophilum strain IM2 section... 38 3.1
34dbj|AK038482.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 38 3.1
35gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35... 38 3.1
36gb|AE003573.4| Drosophila melanogaster chromosome X, section 74 ... 38 3.1
37gb|AC125020.7| Mus musculus chromosome 12, clone RP24-181E5, com... 38 3.1
38gb|AC005135.1|AC005135 Drosophila melanogaster DNA sequence (P1 ... 38 3.1
39gb|AC119202.6| Mus musculus chromosome 8, clone RP24-185N3, comp... 38 3.1
40emb|AL845332.11| Mouse DNA sequence from clone RP23-326D18 on ch... 38 3.1
41emb|AL845170.5| Mouse DNA sequence from clone RP23-282A22 on chr... 38 3.1

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  139 bits (70), Expect = 1e-30
 Identities = 77/78 (98%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    aattcgatcgtcgtcccttctt-aataataatttacatacatatgcacgctggattaaat 59
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1285 aattcgatcgtcgtcccttctttaataataatttacatacatatgcacgctggattaaat 1226

                              
Query: 60   ggcgtgcgtggtactggt 77
            ||||||||||||||||||
Sbjct: 1225 ggcgtgcgtggtactggt 1208



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 65.9 bits (33), Expect = 1e-08
 Identities = 58/65 (89%), Gaps = 1/65 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    tcgatcgtcgtcccttcttaat-aataatttacatacatatgcacgctggattaaatggc 62
            ||||||| ||| |||||||||| |||||||||||||||||||||||||   |||||| ||
Sbjct: 1241 tcgatcgacgttccttcttaattaataatttacatacatatgcacgctccgttaaatcgc 1182

                 
Query: 63   gtgcg 67
            |||||
Sbjct: 1181 gtgcg 1177



to top

>gb|AC155942.6| Mus musculus 10 BAC RP24-492L7 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 174309

 Score = 44.1 bits (22), Expect = 0.051
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 22    taataataatttacatacatat 43
             ||||||||||||||||||||||
Sbjct: 29491 taataataatttacatacatat 29512



to top

>gb|AC153156.1| Ornithorhynchus anatinus chromosome UNK clone OABb-289A1, complete
             sequence
          Length = 109794

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 27    ataatttacatacatatgcac 47
             |||||||||||||||||||||
Sbjct: 95031 ataatttacatacatatgcac 95011



to top

>gb|AC104706.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1116_F05,
             complete sequence
          Length = 119573

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 22    taataataatttacatacatatgca 46
             ||||||||| |||||||||||||||
Sbjct: 27479 taataataacttacatacatatgca 27503



to top

>emb|BX537273.16| Zebrafish DNA sequence from clone CH211-151F2 in linkage group 10,
             complete sequence
          Length = 167226

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    taataataatttacatacata 42
             |||||||||||||||||||||
Sbjct: 60087 taataataatttacatacata 60107



to top

>gb|AC116631.6| Homo sapiens BAC clone RP11-429B11 from 4, complete sequence
          Length = 125133

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 27    ataatttacatacatatgcac 47
             |||||||||||||||||||||
Sbjct: 18615 ataatttacatacatatgcac 18635



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 22       taataataatttacatacatatgca 46
                ||||||||| |||||||||||||||
Sbjct: 15861488 taataataacttacatacatatgca 15861464



to top

>emb|CR361565.8| Zebrafish DNA sequence from clone CH211-242L1 in linkage group 22,
             complete sequence
          Length = 164475

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 23    aataataatttacatacatat 43
             |||||||||||||||||||||
Sbjct: 30255 aataataatttacatacatat 30275



to top

>emb|BX005014.5| Zebrafish DNA sequence from clone CH211-103E2 in linkage group 10,
             complete sequence
          Length = 160621

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    taataataatttacatacata 42
             |||||||||||||||||||||
Sbjct: 47614 taataataatttacatacata 47634



to top

>gb|AC117081.2| Dictyostelium discoideum chromosome 2 map 5862124-6045772 strain AX4,
            complete sequence
          Length = 183648

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 22   taataataatttacatacat 41
            ||||||||||||||||||||
Sbjct: 3763 taataataatttacatacat 3744



to top

>gb|AC122907.4| Mus musculus BAC clone RP23-49I4 from chromosome 15, complete sequence
          Length = 233904

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 21     ttaataataatttacatacatatg 44
              ||||||||||| ||||||||||||
Sbjct: 205619 ttaataataatatacatacatatg 205596



to top

>emb|BX511098.5| Zebrafish DNA sequence from clone CH211-202L3 in linkage group 5,
             complete sequence
          Length = 72481

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    ttcttaataataatttacat 37
             ||||||||||||||||||||
Sbjct: 25089 ttcttaataataatttacat 25108



to top

>gb|AC104511.5| Drosophila melanogaster X BAC RP98-39D14 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 166000

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 22     taataataatttacatacat 41
              ||||||||||||||||||||
Sbjct: 100924 taataataatttacatacat 100943



to top

>emb|BX004760.10| Zebrafish DNA sequence from clone CH211-222O4 in linkage group 3,
             complete sequence
          Length = 190220

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    taataataatttacatacat 41
             ||||||||||||||||||||
Sbjct: 69241 taataataatttacatacat 69260



to top

>gb|AC011763.6|AC011763 Drosophila melanogaster, chromosome 3R, region 90A-90A, BAC clone
              BACR48C05, complete sequence
          Length = 164450

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     tacatacatatgcacgctgg 52
              ||||||||||||||||||||
Sbjct: 141958 tacatacatatgcacgctgg 141939



to top

>gb|AC155299.2| Mus musculus BAC clone RP24-229D17 from chromosome 15, complete
             sequence
          Length = 198559

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 21    ttaataataatttacatacatatg 44
             ||||||||||| ||||||||||||
Sbjct: 83579 ttaataataatatacatacatatg 83602



to top

>emb|AL929213.5| Zebrafish DNA sequence from clone CH211-144A19, complete sequence
          Length = 169897

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    ttcttaataataatttacat 37
             ||||||||||||||||||||
Sbjct: 69809 ttcttaataataatttacat 69790



to top

>emb|BX255893.5| Zebrafish DNA sequence from clone CH211-272H10 in linkage group 4,
             complete sequence
          Length = 99176

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    taataataatttacatacat 41
             ||||||||||||||||||||
Sbjct: 76094 taataataatttacatacat 76075



to top

>gb|AE003717.2| Drosophila melanogaster chromosome 3R, section 55 of 118 of the complete
              sequence
          Length = 217725

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     tacatacatatgcacgctgg 52
              ||||||||||||||||||||
Sbjct: 123669 tacatacatatgcacgctgg 123650



to top

>gb|AE003491.4| Drosophila melanogaster chromosome X, section 43 of 74 of the complete
             sequence
          Length = 332030

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    taataataatttacatacat 41
             ||||||||||||||||||||
Sbjct: 23638 taataataatttacatacat 23619



to top

>gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete sequence
          Length = 173008

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 21     ttaataataatttacatacatat 43
              ||||||| |||||||||||||||
Sbjct: 138839 ttaataaaaatttacatacatat 138817



to top

>gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete sequence
          Length = 179038

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 21    ttaataataatttacatacatat 43
             ||||||| |||||||||||||||
Sbjct: 31698 ttaataaaaatttacatacatat 31676



to top

>gb|AY180151.1| Herpetomonas muscarum small subunit ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and large subunit ribosomal RNA gene, partial
           sequence
          Length = 773

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 33  tacatacatatgcacgctg 51
           |||||||||||||||||||
Sbjct: 430 tacatacatatgcacgctg 412



to top

>gb|AC185533.1| Drosophila melanogaster clone BACR48D21, complete sequence
          Length = 95808

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 24    ataataatttacatacatatgca 46
             |||||||| ||||||||||||||
Sbjct: 56117 ataataatatacatacatatgca 56095



to top

>emb|AL954219.1| Pan troglodytes chromosome 22 clone PTB-302M06 map q21.2, complete
             sequence
          Length = 128963

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    tcccttcttaataataatt 32
             |||||||||||||||||||
Sbjct: 47264 tcccttcttaataataatt 47282



to top

>emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chromosome 10, complete
             sequence
          Length = 203169

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    aataataatttacatacat 41
             |||||||||||||||||||
Sbjct: 49489 aataataatttacatacat 49507



to top

>gb|AC160115.2| Mus musculus BAC clone RP23-473K23 from chromosome 13, complete
             sequence
          Length = 182345

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ttaataataatttacatac 39
             |||||||||||||||||||
Sbjct: 35132 ttaataataatttacatac 35114



to top

>emb|CR846090.6| Zebrafish DNA sequence from clone DKEYP-78E10 in linkage group 14,
             complete sequence
          Length = 78515

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 22    taataataatttacataca 40
             |||||||||||||||||||
Sbjct: 75886 taataataatttacataca 75868



to top

>gb|AC089987.26| Homo sapiens 12q BAC RP11-722P11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 164945

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    ataataatttacatacata 42
             |||||||||||||||||||
Sbjct: 95473 ataataatttacatacata 95491



to top

>ref|NM_176004.1| Drosophila melanogaster CG13125-RB, transcript variant B (CG13125),
            mRNA
          Length = 1335

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 21   ttaataataatttacatacatat 43
            ||||||| |||||||||||||||
Sbjct: 1283 ttaataaaaatttacatacatat 1305



to top

>ref|NM_135481.2| Drosophila melanogaster CG13125-RA, transcript variant A (CG13125),
            mRNA
          Length = 1758

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 21   ttaataataatttacatacatat 43
            ||||||| |||||||||||||||
Sbjct: 1706 ttaataaaaatttacatacatat 1728



to top

>gb|AE009926.1|AE009926 Pyrobaculum aerophilum strain IM2 section 181 of 201 of the complete
            genome
          Length = 10255

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 16   ccttcttaataataatttacata 38
            ||||||||||||| |||||||||
Sbjct: 5538 ccttcttaataatgatttacata 5560



to top

>dbj|AK038482.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230019I21
           product:unclassifiable, full insert sequence
          Length = 2378

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  aatttacatacatatgcac 47
           |||||||||||||||||||
Sbjct: 793 aatttacatacatatgcac 775



to top

>gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35 of 83 of the complete
              sequence
          Length = 264919

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 21     ttaataataatttacatacatat 43
              ||||||| |||||||||||||||
Sbjct: 213928 ttaataaaaatttacatacatat 213906



to top

>gb|AE003573.4| Drosophila melanogaster chromosome X, section 74 of 74 of the complete
              sequence
          Length = 313035

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 24     ataataatttacatacatatgca 46
              |||||||| ||||||||||||||
Sbjct: 193281 ataataatatacatacatatgca 193259



to top

>gb|AC125020.7| Mus musculus chromosome 12, clone RP24-181E5, complete sequence
          Length = 200586

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    aatttacatacatatgcac 47
             |||||||||||||||||||
Sbjct: 80606 aatttacatacatatgcac 80588



to top

>gb|AC005135.1|AC005135 Drosophila melanogaster DNA sequence (P1 DS07070 (D331)), complete
             sequence
          Length = 67297

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 21    ttaataataatttacatacatat 43
             ||||||| |||||||||||||||
Sbjct: 64484 ttaataaaaatttacatacatat 64462



to top

>gb|AC119202.6| Mus musculus chromosome 8, clone RP24-185N3, complete sequence
          Length = 159765

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ttaataataatttacatac 39
             |||||||||||||||||||
Sbjct: 74759 ttaataataatttacatac 74741



to top

>emb|AL845332.11| Mouse DNA sequence from clone RP23-326D18 on chromosome 2, complete
              sequence
          Length = 200453

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     taataataatttacataca 40
              |||||||||||||||||||
Sbjct: 136421 taataataatttacataca 136403



to top

>emb|AL845170.5| Mouse DNA sequence from clone RP23-282A22 on chromosome 2, complete
              sequence
          Length = 183985

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 26     aataatttacatacatatg 44
              |||||||||||||||||||
Sbjct: 150354 aataatttacatacatatg 150336


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,083,338
Number of Sequences: 3902068
Number of extensions: 1083338
Number of successful extensions: 84025
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83895
Number of HSP's gapped (non-prelim): 129
length of query: 77
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 56
effective length of database: 17,151,101,840
effective search space: 960461703040
effective search space used: 960461703040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top