ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart26e08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X84056.1|HVPAF93 H.vulgare paf93 gene 999 0.0
2gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, c... 751 0.0
3gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein ... 603 e-169
4gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, com... 599 e-168
5gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (... 595 e-167
6gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence 525 e-146
7emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin... 517 e-143
8gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein ... 440 e-120
9gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial seq... 319 5e-84
10gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydratio... 113 6e-22
11gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type d... 113 6e-22
12dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 113 6e-22
13dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic D... 113 6e-22
14dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic D... 113 6e-22
15dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 6e-22
16dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds 113 6e-22
17gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence 98 3e-17
18gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds 98 3e-17
19gb|AY105067.1| Zea mays PCO081051 mRNA sequence 88 3e-14
20gb|AY111114.1| Zea mays CL2452_1 mRNA sequence 82 2e-12
21gb|AF190474.2|AF190474 Boea crassifolia bdn1 (bdn1) mRNA, partia... 72 2e-09
22gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB... 64 5e-07
23gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, parti... 64 5e-07
24gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, compl... 64 5e-07
25gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein W... 62 2e-06
26gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group ... 62 2e-06
27gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, com... 62 2e-06
28gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, com... 62 2e-06
29gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, c... 62 2e-06
30gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds 62 2e-06
31gb|DQ160121.1| Taraxacum officinale TO101-3 (To101-3) mRNA, part... 60 8e-06
32emb|AJ439990.1|OSA439990 Oryza sativa partial mRNA for putative ... 60 8e-06
33emb|AJ844000.1| Plantago major mRNA for dehydrin 1 (dhn1 gene) 60 8e-06
34gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome... 58 3e-05
35gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 ... 58 3e-05
36gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 ... 58 3e-05
37gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ... 58 3e-05
38gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ... 58 3e-05
39gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ... 58 3e-05
40gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ... 58 3e-05
41gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 58 3e-05
42gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ... 58 3e-05
43gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 58 3e-05
44gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 58 3e-05
45gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 58 3e-05
46gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 58 3e-05
47gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 58 3e-05
48gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ... 58 3e-05
49gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 58 3e-05
50gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 58 3e-05
51gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 58 3e-05
52gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 58 3e-05
53gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 58 3e-05
54gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 58 3e-05
55gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 58 3e-05
56gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 58 3e-05
57gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 58 3e-05
58gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 58 3e-05
59gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 58 3e-05
60dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
61emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible ... 58 3e-05
62emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 58 3e-05
63emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene) 58 3e-05
64emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene 58 3e-05
65gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds 58 3e-05
66gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, com... 58 3e-05
67dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
68gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, c... 58 3e-05
69gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 58 3e-05
70gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group ... 56 1e-04
71dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
72emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 56 1e-04
73emb|X15994.1|ZMRAB17G Maize RAB-17 gene 56 1e-04
74emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) 56 1e-04
75emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) 56 1e-04
76gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, com... 56 1e-04
77gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, com... 56 1e-04
78gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, c... 56 1e-04
79gb|AY737725.1| Salvia miltiorrhiza dehydrin mRNA, partial cds 54 5e-04
80gb|AY695932.1| Salvia miltiorrhiza dehydration protein (bdn1) mR... 54 5e-04
81gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 ... 54 5e-04
82gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ... 54 5e-04
83gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ... 54 5e-04
84gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ... 54 5e-04
85gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ... 54 5e-04
86gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 54 5e-04
87gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 54 5e-04
88gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 54 5e-04
89gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ... 54 5e-04
90gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 54 5e-04
91gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 54 5e-04
92gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 54 5e-04
93gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 54 5e-04
94gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 54 5e-04
95gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 54 5e-04
96gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 54 5e-04
97emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7 54 5e-04
98emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8) 54 5e-04
99emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin 54 5e-04
100gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, com... 54 5e-04
101gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
102gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
103gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
104gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
105gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
106gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
107gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
108gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
109gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
110gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
111gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
112gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
113gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
114gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
115gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
116gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
117gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
118gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
119gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
120gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
121gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
122gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
123gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 54 5e-04
124gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, c... 54 5e-04
125gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, c... 54 5e-04
126gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, c... 54 5e-04
127gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein ... 54 5e-04
128gb|DQ487112.1| Panax ginseng dehydrin 7 (Dhn7) mRNA, complete cds 52 0.002
129gb|DQ487106.1| Panax ginseng dehydrin 1 (Dhn1) mRNA, complete cds 52 0.002
130dbj|AB010898.1| Daucus carota mRNA for ecpp44, complete cds 52 0.002
131ref|NM_192219.1| Oryza sativa (japonica cultivar-group), predic... 50 0.007
132gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.007
133gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-re... 50 0.007
134dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
135dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
136emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene 50 0.007
137emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene 50 0.007
138emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene... 50 0.007
139emb|X57327.1|OSRAB25 Rice rab25 mRNA 50 0.007
140dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
141dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
142dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
143gb|AY104757.1| Zea mays PCO142314 mRNA sequence 50 0.007
144gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, com... 48 0.029
145gb|AY389583.1| Hyacinthus orientalis dehydrin mRNA, partial cds 48 0.029
146gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds 48 0.029
147gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, ... 48 0.029
148gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod6... 48 0.029
149gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-rel... 48 0.029
150dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.029
151dbj|AK073885.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
152gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene,... 48 0.029
153emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chr... 48 0.029
154ref|NM_101894.3| Arabidopsis thaliana COR47 AT1G20440 (COR47) mR... 46 0.11
155gb|AY706990.1| Vitis vinifera dehydrin 1b (DHN1b) gene, complete... 46 0.11
156gb|AY706989.1| Vitis vinifera dehydrin 1a (DHN1a) gene, complete... 46 0.11
157gb|AY706988.1| Vitis riparia dehydrin 1b (DHN1b) gene, partial s... 46 0.11
158gb|AY114699.1| Arabidopsis thaliana unknown protein (At1g20440) ... 46 0.11
159gb|AY072392.1| Arabidopsis thaliana unknown protein (At1g20440) ... 46 0.11
160gb|AY634281.1| Vitis vinifera dehydrin mRNA, complete cds 46 0.11
161dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, ... 46 0.11
162gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana... 46 0.11
163dbj|AB004872.1| Arabidopsis thaliana DNA for COR47, complete cds 46 0.11
164emb|X90959.1|ATCOR47G A.thaliana cor47 gene 46 0.11
165emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9) 46 0.11
166emb|X59814.1|ATCOR47 A.thaliana cor47 mRNA 46 0.11
167gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, com... 46 0.11
168gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, c... 46 0.11
169ref|NM_180616.2| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) tr... 44 0.45
170ref|NM_101895.3| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) tr... 44 0.45
171gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, com... 44 0.45
172gb|AY142491.1| Arabidopsis thaliana unknown protein (At1g20450) ... 44 0.45
173gb|AF360351.1| Arabidopsis thaliana unknown protein (At1g20450) ... 44 0.45
174gb|AY136407.1| Arabidopsis thaliana unknown protein mRNA, comple... 44 0.45
175emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene ... 44 0.45
176gb|AY065655.1| Pisum sativum ultraviolet-B-repressible dehydrin-... 44 0.45
177gb|AY048208.1| Arabidopsis thaliana At1g20450/F5M15_20 mRNA, com... 44 0.45
178gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-rel... 44 0.45
179emb|BX815233.1|CNS0ACV9 Arabidopsis thaliana Full-length cDNA Co... 44 0.45
180gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-lik... 44 0.45
181dbj|D17714.1|ATHERD10 Arabidopsis thaliana mRNA for ERD10 protei... 44 0.45
182emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 44 0.45
183emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 44 0.45
184emb|X90958.1|ATDLTI29G A.thaliana lti29 gene 44 0.45
185emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin 44 0.45
186emb|X62476.1|TARAB15B T.aestivum rab15B mRNA 44 0.45
187emb|Z14145.1|DHNCOGG P.sativum dhn-cog gene encoding dehydrin-co... 44 0.45
188emb|X77614.1|ATLTI45 A.thaliana (Landsberg Erecta) lti45 mRNA 44 0.45
189gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, com... 44 0.45
190gb|BT002131.1| Arabidopsis thaliana unknown protein mRNA, comple... 44 0.45
191gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
192gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
193gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
194gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
195gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
196gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
197gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
198gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
199gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
200gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
201gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
202gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
203gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
204gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
205gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
206gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
207gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
208gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
209gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
210gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
211gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
212gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
213gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
214gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
215gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
216gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 44 0.45
217gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, c... 44 0.45
218dbj|AB090885.1| Aster tripolium mRNA for dehydrin, complete cds 44 0.45
219emb|AJ001448.1|FVAJ1448 Fragaria vesca partial mRNA for ripening... 44 0.45
220gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds 42 1.8
221ref|NM_192777.1| Oryza sativa (japonica cultivar-group), predic... 42 1.8
222gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, com... 42 1.8
223gb|AY706987.1| Vitis riparia dehydrin 1a (DHN1a) gene, complete ... 42 1.8
224gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab... 42 1.8
225gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 ... 42 1.8
226gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ... 42 1.8
227gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 42 1.8
228gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 42 1.8
229gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 42 1.8
230gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 42 1.8
231gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 42 1.8
232gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 42 1.8
233gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 42 1.8
234gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 42 1.8
235gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 42 1.8
236emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on ch... 42 1.8
237gb|AC036101.6| Homo sapiens chromosome 10 clone RP11-71J2, compl... 42 1.8
238gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, c... 42 1.8
239gb|DQ015701.1| Ovis aries endothelial nitric oxide synthase mRNA... 42 1.8
240dbj|AB058947.1| Streptomyces albulus plasmid pNO33 DNA, complete... 42 1.8
241dbj|AP002866.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.8
242gb|AF220407.1|AF220407 Vitis riparia dehydrin-like protein (Dhn)... 42 1.8
243dbj|AK105551.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.8
244gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, com... 42 1.8
245gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
246gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
247gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
248gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
249gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
250gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
251gb|AY895924.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
252gb|AY895923.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
253gb|AY895922.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
254gb|AY895921.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
255gb|AY895920.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
256gb|AY895919.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
257gb|AY895918.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
258gb|AY895917.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
259gb|AY895916.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
260gb|AY895915.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
261gb|AY895914.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
262gb|AY895913.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
263gb|AY895912.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
264gb|AY895911.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
265gb|AY895910.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
266gb|AY895909.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
267gb|AY895908.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
268gb|AY895907.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
269gb|AY895906.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
270gb|AY895905.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 42 1.8
271gb|AY105409.1| Zea mays PCO095801 mRNA sequence 42 1.8
272gb|AF043092.1|AF043092 Hordeum vulgare dehydrin 7 (dhn7) gene, c... 42 1.8
273gb|M99057.1|BOVNIOXSY Bovine nitric oxide synthase mRNA, complet... 42 1.8
274gb|M89952.1|BOVECNOS Bos taurus endothelial nitric oxide synthas... 42 1.8
275ref|NM_197772.1| Oryza sativa (japonica cultivar-group) putative... 40 7.0
276gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com... 40 7.0
277gb|DQ226956.1| Boechera divaricarpa isolate AD-B9 mRNA sequence 40 7.0
278gb|AC164098.4| Mus musculus BAC clone RP23-341D24 from chromosom... 40 7.0
279ref|XM_760938.1| Theileria parva strain Muguga chromosome 1 hypo... 40 7.0
280gb|AC144479.1| Pan troglodytes BAC clone RP43-126P12 from 7, com... 40 7.0
281emb|AL590809.5| Human DNA sequence from clone RP11-733H21 on chr... 40 7.0
282emb|CR339044.19| Zebrafish DNA sequence from clone CH211-122G23 ... 40 7.0
283emb|BX927212.11| Zebrafish DNA sequence from clone CH211-262A5 i... 40 7.0
284gb|AE005809.1| Caulobacter crescentus CB15 section 135 of 359 of... 40 7.0
285gb|CP000282.1| Saccharophagus degradans 2-40, complete genome 40 7.0
286gb|AE012230.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 7.0
287gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 40 7.0
288gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 geno... 40 7.0
289gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 7.0
290dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
291dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
292dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 7.0
293gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 7.0
294dbj|BS000095.1| Pan troglodytes chromosome 22 clone:RP43-177D07,... 40 7.0
295dbj|BS000094.1| Pan troglodytes chromosome 22 clone:PTB-240N13, ... 40 7.0
296dbj|AB126059.1| Codonopsis lanceolata mRNA for dehydrin 1, compl... 40 7.0
297dbj|AB049338.1| Nicotiana tabacum NtERD10D mRNA for dehydrin, pa... 40 7.0
298dbj|AB049337.1| Nicotiana tabacum NtERD10C mRNA for dehydrin, pa... 40 7.0
299emb|X94979.1|BOPC34 B.oleracea mRNA for pollen coat protein (clo... 40 7.0
300gb|AC140483.3| Mus musculus BAC clone RP24-145A22 from 1, comple... 40 7.0
301dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 7.0
302dbj|AP000469.3| Homo sapiens genomic DNA, chromosome 21q, clone:... 40 7.0
303gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.0
304emb|AL671895.9| Mouse DNA sequence from clone RP23-342E4 on chro... 40 7.0

>emb|X84056.1|HVPAF93 H.vulgare paf93 gene
          Length = 1154

 Score =  999 bits (504), Expect = 0.0
 Identities = 516/520 (99%)
 Strand = Plus / Minus

                                                                        
Query: 1    acacaaagtgcccgtaataataagcaaataaacttaaacaacatccaggacctgactctg 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1107 acacaaagtgcccgtaataataagcaaataaacttaaacaacatccaggacctgactctg 1048

                                                                        
Query: 61   gaccaaactgaagcccgtatacccaaactgaacacaagcatccgtcacctaacgggcttc 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1047 gaccaaactgaagcccgtatacccaaactgaacacaagcatccgtcacctaacggacttc 988

                                                                        
Query: 121  acagaccgggccttcaaagacgatcaatccctccatcttgacacggacttaaacttaaag 180
            ||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 987  acagaccggaccttcaaagacgatcaatccctccatcttgacacggacttagacgtaaag 928

                                                                        
Query: 181  caaacacgacacacgccaacaatttaatggaggtccggtgatgagtctcggggcacggcg 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 927  caaacacgacacacgccaacaatttaatggaggtccggtgatgagtctcggggcacggcg 868

                                                                        
Query: 241  gcgatcaagctctgggcttgtgctcgcctgaaggggcggcggccttgtcctcctcccctg 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 867  gcgatcaagctctgggcttgtgctcgcctgaaggggcggcggccttgtcctcctcccctg 808

                                                                        
Query: 301  tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcg 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 807  tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcg 748

                                                                        
Query: 361  cgtccgggctgctcacctcctcggcggccggcgcaggcgcgtgcactggcgctggagcag 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 747  cgtccgggctgctcacctcctcggcggccggcgcaggcgcgtgcactggcgctggagcag 688

                                                                        
Query: 421  cgtgcgtgacgggcaccgcggcagcgtcctccggcttcttgtggccgccgggcagcttct 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 687  cgtgcgtgacgggcaccgcggcagcgtcctccggcttcttgtggccgccgggcagcttct 628

                                                    
Query: 481  ccttgatcttttccaagaagcctttcttctcctcctcggg 520
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 627  ccttgatcttttccaagaagcctttcttctcctcctcggg 588



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 467 gccgggcagcttctccttga 486
           ||||||||||||||||||||
Sbjct: 449 gccgggcagcttctccttga 430



to top

>gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, complete cds
          Length = 2254

 Score =  751 bits (379), Expect = 0.0
 Identities = 379/379 (100%)
 Strand = Plus / Minus

                                                                        
Query: 142  gatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgccaaca 201
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2246 gatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgccaaca 2187

                                                                        
Query: 202  atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 261
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2186 atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 2127

                                                                        
Query: 262  gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 321
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2126 gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 2067

                                                                        
Query: 322  tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 381
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2066 tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 2007

                                                                        
Query: 382  cggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcgg 441
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2006 cggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcgg 1947

                                                                        
Query: 442  cagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagc 501
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1946 cagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagc 1887

                               
Query: 502  ctttcttctcctcctcggg 520
            |||||||||||||||||||
Sbjct: 1886 ctttcttctcctcctcggg 1868



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 467  gccgggcagcttctccttga 486
            ||||||||||||||||||||
Sbjct: 1729 gccgggcagcttctccttga 1710



to top

>gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein WCOR410c (Wcor410c) mRNA,
            complete cds
          Length = 1242

 Score =  603 bits (304), Expect = e-169
 Identities = 410/440 (93%), Gaps = 4/440 (0%)
 Strand = Plus / Minus

                                                                        
Query: 83   ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccgggccttcaaagac 141
            |||||||||| ||||||||||||||||  |||||||||||| |||||  |||||||||||
Sbjct: 1037 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 978

                                                                        
Query: 142  gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 200
            |||||| |||||| | ||||||||  |||||| | |||||||||||| ||||||||||||
Sbjct: 977  gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 919

                                                                        
Query: 201  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 260
            |||| ||| |||||||||| | |||||||||| ||||||||||||||||| |||||||||
Sbjct: 918  aattcaatcgaggtccggtcacgagtctcggg-cacggcggcgatcaagcgctgggcttg 860

                                                                        
Query: 261  tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 320
            |||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 859  tgctcgcctgcagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800

                                                                        
Query: 321  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 380
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 799  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 740

                                                                        
Query: 381  tcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcg 440
            |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||  
Sbjct: 739  tcggcggctggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcaccgga 680

                                                                        
Query: 441  gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 679  gcagcgtcctccggtttcttgtggccgccgggcagcttctccttgatcttttccaagaag 620

                                
Query: 501  cctttcttctcctcctcggg 520
            ||||||||||||||||||||
Sbjct: 619  cctttcttctcctcctcggg 600



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 52/56 (92%), Gaps = 1/56 (1%)
 Strand = Plus / Minus

                                                                    
Query: 17   ataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 72
            |||||||| ||| |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 1082 ataataagtaaacaaacttaa-caacatccaggacctgactctgaaccaaactgaa 1028



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 467 gccgggcagcttctccttga 486
           ||||||||||||||||||||
Sbjct: 461 gccgggcagcttctccttga 442



to top

>gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, complete cds
          Length = 808

 Score =  599 bits (302), Expect = e-168
 Identities = 311/314 (99%)
 Strand = Plus / Minus

                                                                       
Query: 207 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 266
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 808 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 749

                                                                       
Query: 267 cctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtcc 326
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 748 cctgaaggggcggcggccttgtcctcctcctctgtcttgtggtaaccgggcagcttgtcc 689

                                                                       
Query: 327 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcg 386
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 688 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcg 629

                                                                       
Query: 387 gccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcggcagcg 446
           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 628 gccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtggcgggcaccgcggcagcg 569

                                                                       
Query: 447 tcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcctttc 506
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 568 tcctccggcttcttgtggccgccgggcagcttctccttgattttttccaagaagcctttc 509

                         
Query: 507 ttctcctcctcggg 520
           ||||||||||||||
Sbjct: 508 ttctcctcctcggg 495



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 467 gccgggcagcttctccttga 486
           ||||||||||||||||||||
Sbjct: 356 gccgggcagcttctccttga 337



to top

>gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (WCOR410) mRNA, complete
            cds
          Length = 1136

 Score =  595 bits (300), Expect = e-167
 Identities = 408/440 (92%), Gaps = 3/440 (0%)
 Strand = Plus / Minus

                                                                        
Query: 83   ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccgggccttcaaagac 141
            |||||||||| || ||||| |||||||  |||||||||||| |||||| |||||||||||
Sbjct: 1038 ccaaactgaaacagaagcacccgtcactgaacgggcttcacggaccggaccttcaaagac 979

                                                                        
Query: 142  gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 200
            |||||| |||||| | ||||||||  ||||| || |||||||||||| ||||||||||||
Sbjct: 978  gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 919

                                                                        
Query: 201  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 260
            |||| ||| |||||||||| | | |||||||| ||||||||||||||||| |||||||||
Sbjct: 918  aattcaatcgaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttg 860

                                                                        
Query: 261  tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 320
            |||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 859  tgctcgcctgtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800

                                                                        
Query: 321  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 380
            |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 799  ttgtccatgatcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcc 740

                                                                        
Query: 381  tcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcg 440
            |||| ||||||| | |||||||||||||| ||||||||||||||||||||||||||||| 
Sbjct: 739  tcgggggccggcaccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcaccgca 680

                                                                        
Query: 441  gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 679  gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 620

                                
Query: 501  cctttcttctcctcctcggg 520
            ||||||||||||||||||||
Sbjct: 619  cctttcttctcctcctcggg 600



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 38   acaacatccaggacctgactctggaccaaactgaa 72
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1063 acaacatccaggacctgactctgaaccaaactgaa 1029



to top

>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence
          Length = 1130

 Score =  525 bits (265), Expect = e-146
 Identities = 400/440 (90%), Gaps = 10/440 (2%)
 Strand = Plus / Minus

                                                                        
Query: 83   ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccgggccttcaaagac 141
            |||||||||| ||||| ||||||||||  ||||||||||||||||||| ||||||| |||
Sbjct: 1009 ccaaactgaaacacaaacatccgtcactgaacgggcttcacagaccggaccttcaa-gac 951

                                                                        
Query: 142  gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 200
            |||||| |||||| | ||||||||  ||||| || |||||||||||| ||||||||||||
Sbjct: 950  gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 891

                                                                        
Query: 201  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 260
            |||| ||| ||| |||||| | |||||||||| |||||||||||| |||| |||||||||
Sbjct: 890  aattcaatcgagctccggtcacgagtctcggg-cacggcggcgattaagcgctgggcttg 832

                                                                        
Query: 261  tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 320
            |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 831  tgctcgcctgcaggggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 772

                                                                        
Query: 321  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 380
            |||||||||||||||||||| | ||||||||||||||||||||| ||||||||||| |||
Sbjct: 771  ttgtccatgatcttgcccagcaagcccttcttctccttcgcgtcagggctgctcacttcc 712

                                                                        
Query: 381  tcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcg 440
            |||||||||      ||||||||||| || ||||| ||||||||||||||||||||||| 
Sbjct: 711  tcggcggcc------ggcgcgtgcaccggtgctggggcagcgtgcgtgacgggcaccgca 658

                                                                        
Query: 441  gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500
            ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 657  gcaacgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccatgaag 598

                                
Query: 501  cctttcttctcctcctcggg 520
            ||||||||||||||||||||
Sbjct: 597  cctttcttctcctcctcggg 578



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 49/53 (92%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                 
Query: 20   ataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 72
            ||||| ||| |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 1051 ataagtaaacaaacttaa-caacatccaggacctgactctgaaccaaactgaa 1000



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 467 gccgggcagcttctccttga 486
           ||||||||||||||||||||
Sbjct: 439 gccgggcagcttctccttga 420



to top

>emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin (dhn11 gene)
          Length = 1127

 Score =  517 bits (261), Expect = e-143
 Identities = 401/441 (90%), Gaps = 5/441 (1%)
 Strand = Plus / Minus

                                                                        
Query: 83   ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccgggccttcaaagac 141
            |||||||||| ||||||||||||||||  |||||||||||| |||||  |||||||||||
Sbjct: 1035 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 976

                                                                        
Query: 142  gatcaatccctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaac 200
            |||||| |||||| | ||||||||  |||||| | |||||||||||| ||||||||||||
Sbjct: 975  gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 917

                                                                        
Query: 201  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 260
            |||| ||| | |||||||| | |||||||||| |||||||||| ||||||  |||| |||
Sbjct: 916  aattcaatcggggtccggtcacgagtctcggg-cacggcggcgttcaagcgttgggattg 858

                                                                        
Query: 261  tgctcgcc-tgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcag 319
            |||||||| || || |||||||| |||||||||||||||||||||||||||||| |||||
Sbjct: 857  tgctcgccctgcagcggcggcggacttgtcctcctcccctgtcttgtggtaaccaggcag 798

                                                                        
Query: 320  cttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctc 379
            ||||||||||||||||||||||||||||||||||||||||| ||| ||| || |||||||
Sbjct: 797  cttgtccatgatcttgcccagtaggcccttcttctccttcgggtcagggatggtcacctc 738

                                                                        
Query: 380  ctcggcggccggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgc 439
            ||||||||  ||||| |||||||||||||| |||||||||||||||||||||||||||| 
Sbjct: 737  ctcggcggatggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggcaccgg 678

                                                                        
Query: 440  ggcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaa 499
             |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 677  agcagcgtcctccggtttcttgtggccgccgggcagcttctccttgatcttttccaagaa 618

                                 
Query: 500  gcctttcttctcctcctcggg 520
            |||||||||||||||||||||
Sbjct: 617  gcctttcttctcctcctcggg 597



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 52/56 (92%), Gaps = 1/56 (1%)
 Strand = Plus / Minus

                                                                    
Query: 17   ataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 72
            |||||||| ||| |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 1080 ataataagtaaacaaacttaa-caacatccaggacctgactctgaaccaaactgaa 1026



to top

>gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein WCOR410b (Wcor410b) mRNA,
            complete cds
          Length = 1181

 Score =  440 bits (222), Expect = e-120
 Identities = 326/358 (91%), Gaps = 2/358 (0%)
 Strand = Plus / Minus

                                                                        
Query: 91   aacacaagcatccgtcacctaacgggcttcacagaccgggccttcaaagacgatcaatcc 150
            |||| ||||| |||||||  |||||||||||| |||||| ||||||||||||||||| ||
Sbjct: 1038 aacagaagcacccgtcactcaacgggcttcacggaccggaccttcaaagacgatcaaccc 979

                                                                        
Query: 151  ctcc-atcttgacacggacttaaacttaaagcaaacacgacacacgccaacaatttaatg 209
            |||| | ||||||||  ||||| || |||||||||||| |||||||||||||||| ||| 
Sbjct: 978  ctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaacaattcaatc 919

                                                                        
Query: 210  gaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcgcct 269
            |||||||||| | | |||||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 918  gaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttgtgctcgcct 860

                                                                        
Query: 270  gaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtccatg 329
            | || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 859  gtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagcttgtccatg 800

                                                                        
Query: 330  atcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggcggcc 389
            ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 799  atcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcctcggcggcc 740

                                                                      
Query: 390  ggcgcaggcgcgtgcactggcgctggagcagcgtgcgtgacgggcaccgcggcagcgt 447
            ||||| ||||||||||| || |||||||||||||||||||||||| |||  |||||||
Sbjct: 739  ggcgccggcgcgtgcaccggtgctggagcagcgtgcgtgacgggcgccggagcagcgt 682



 Score =  208 bits (105), Expect = 1e-50
 Identities = 111/113 (98%)
 Strand = Plus / Minus

                                                                       
Query: 408 ggcgctggagcagcgtgcgtgacgggcaccgcggcagcgtcctccggcttcttgtggccg 467
           ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 697 ggcgccggagcagcgtgcgtgacgggcaccgcagcagcgtcctccggcttcttgtggccg 638

                                                                
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 637 ccgggcagcttctccttgatcttttccaagaagcctttcttctcctcctcggg 585



to top

>gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial sequence
          Length = 391

 Score =  319 bits (161), Expect = 5e-84
 Identities = 192/201 (95%), Gaps = 1/201 (0%)
 Strand = Plus / Minus

                                                                       
Query: 321 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 380
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 390 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 331

                                                                       
Query: 381 tcggcggccggcgcaggcgcgtgc-actggcgctggagcagcgtgcgtgacgggcaccgc 439
           |||||||| ||||| ||||||||| ||||| |||||||||||||||||||||||| ||| 
Sbjct: 330 tcggcggctggcgccggcgcgtgctactggtgctggagcagcgtgcgtgacgggcgccgg 271

                                                                       
Query: 440 ggcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaa 499
            |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 270 agcagcgtcctccggtttcttgtggccgccgggcagcttctccttgatcttttccaagaa 211

                                
Query: 500 gcctttcttctcctcctcggg 520
           |||||||||||||||||||||
Sbjct: 210 gcctttcttctcctcctcggg 190



to top

>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible
           protein 1 mRNA, complete cds
          Length = 1315

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                       
Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503
           ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| 
Sbjct: 758 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 699

                            
Query: 504 ttcttctcctcctcggg 520
           |||||||||||||||||
Sbjct: 698 ttcttctcctcctcggg 682



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 918 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 859

                                
Query: 362 gtccgggctgctcacctcctc 382
            |||||||||||||| |||||
Sbjct: 858 atccgggctgctcacttcctc 838



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 467 gccgggcagcttctccttgatctt 490
           ||||||||||||||||||||||||
Sbjct: 474 gccgggcagcttctccttgatctt 451



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 734 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 689



to top

>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1)
           mRNA, complete cds
          Length = 1117

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                       
Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503
           ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| 
Sbjct: 748 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 689

                            
Query: 504 ttcttctcctcctcggg 520
           |||||||||||||||||
Sbjct: 688 ttcttctcctcctcggg 672



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 908 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 849

                                
Query: 362 gtccgggctgctcacctcctc 382
            |||||||||||||| |||||
Sbjct: 848 atccgggctgctcacttcctc 828



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 467 gccgggcagcttctccttgatctt 490
           ||||||||||||||||||||||||
Sbjct: 464 gccgggcagcttctccttgatctt 441



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 724 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 679



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Plus

                                                                            
Query: 444      gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503
                ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| 
Sbjct: 27184529 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 27184588

                                 
Query: 504      ttcttctcctcctcggg 520
                |||||||||||||||||
Sbjct: 27184589 ttcttctcctcctcggg 27184605



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                            
Query: 302      cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361
                |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 27184369 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 27184428

                                     
Query: 362      gtccgggctgctcacctcctc 382
                 |||||||||||||| |||||
Sbjct: 27184429 atccgggctgctcacttcctc 27184449



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 467      gccgggcagcttctccttgatctt 490
                ||||||||||||||||||||||||
Sbjct: 27184813 gccgggcagcttctccttgatctt 27184836



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                              
Query: 312      ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357
                ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 27184553 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 27184598



to top

>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1725_H08
          Length = 155431

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Plus

                                                                         
Query: 444   gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503
             ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| 
Sbjct: 80978 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 81037

                              
Query: 504   ttcttctcctcctcggg 520
             |||||||||||||||||
Sbjct: 81038 ttcttctcctcctcggg 81054



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                         
Query: 302   cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361
             |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 80818 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 80877

                                  
Query: 362   gtccgggctgctcacctcctc 382
              |||||||||||||| |||||
Sbjct: 80878 atccgggctgctcacttcctc 80898



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 467   gccgggcagcttctccttgatctt 490
             ||||||||||||||||||||||||
Sbjct: 81262 gccgggcagcttctccttgatctt 81285



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 312   ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357
             ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 81002 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 81047



to top

>dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0684A08
          Length = 137841

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Plus

                                                                         
Query: 444   gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503
             ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| 
Sbjct: 35200 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 35259

                              
Query: 504   ttcttctcctcctcggg 520
             |||||||||||||||||
Sbjct: 35260 ttcttctcctcctcggg 35276



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                         
Query: 302   cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361
             |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 35040 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 35099

                                  
Query: 362   gtccgggctgctcacctcctc 382
              |||||||||||||| |||||
Sbjct: 35100 atccgggctgctcacttcctc 35120



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 467   gccgggcagcttctccttgatctt 490
             ||||||||||||||||||||||||
Sbjct: 35484 gccgggcagcttctccttgatctt 35507



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 312   ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357
             ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 35224 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 35269



to top

>dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N13, full
           insert sequence
          Length = 1292

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                       
Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503
           ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| 
Sbjct: 770 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 711

                            
Query: 504 ttcttctcctcctcggg 520
           |||||||||||||||||
Sbjct: 710 ttcttctcctcctcggg 694



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 930 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 871

                                
Query: 362 gtccgggctgctcacctcctc 382
            |||||||||||||| |||||
Sbjct: 870 atccgggctgctcacttcctc 850



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 467 gccgggcagcttctccttgatctt 490
           ||||||||||||||||||||||||
Sbjct: 486 gccgggcagcttctccttgatctt 463



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 746 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 701



to top

>dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds
          Length = 680

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                       
Query: 444 gcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaagcct 503
           ||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||| 
Sbjct: 191 gcgtcttccggcttcttgtggccgccgggcagcttctccttgatcttgtcgaggaagccc 132

                            
Query: 504 ttcttctcctcctcggg 520
           |||||||||||||||||
Sbjct: 131 ttcttctcctcctcggg 115



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 361
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 351 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 292

                                
Query: 362 gtccgggctgctcacctcctc 382
            |||||||||||||| |||||
Sbjct: 291 atccgggctgctcacttcctc 271



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 357
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 167 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 122



to top

>gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence
          Length = 722

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                       
Query: 441 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500
           |||||||| ||||||||||||||||| ||||| ||||||||||||||||| ||||  | |
Sbjct: 219 gcagcgtcttccggcttcttgtggccaccgggtagcttctccttgatcttgtccagcagg 160

                            
Query: 501 cctttcttctcctcctc 517
           |||||||||||||||||
Sbjct: 159 cctttcttctcctcctc 143



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 301 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 352
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||
Sbjct: 353 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 302



to top

>gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds
          Length = 1277

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                       
Query: 441 gcagcgtcctccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaag 500
           |||||||| ||||||||||||||||| ||||| ||||||||||||||||| ||||  | |
Sbjct: 730 gcagcgtcttccggcttcttgtggccaccgggtagcttctccttgatcttgtccagcagg 671

                            
Query: 501 cctttcttctcctcctc 517
           |||||||||||||||||
Sbjct: 670 cctttcttctcctcctc 654



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 301 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 352
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||
Sbjct: 864 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 813



to top

>gb|AY105067.1| Zea mays PCO081051 mRNA sequence
          Length = 1398

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 301 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcg 360
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||||||||  
Sbjct: 928 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttcttctccttgc 869

                           
Query: 361 cgtccgggctgctcac 376
           | ||||||||||||||
Sbjct: 868 catccgggctgctcac 853



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 459 ttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctcctcctc 517
           |||||||| ||||| ||||||||||||||||| ||||  | ||||||||||||||||||
Sbjct: 773 ttgtggccaccggggagcttctccttgatcttgtccagcaggcctttcttctcctcctc 715



to top

>gb|AY111114.1| Zea mays CL2452_1 mRNA sequence
          Length = 1256

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 63/69 (91%), Gaps = 1/69 (1%)
 Strand = Plus / Minus

                                                                       
Query: 450 tccggcttcttgtggccgccgggcagcttctccttgatcttttccaagaa-gcctttctt 508
           ||||||||||||||||| ||||| ||||||||||||||||| ||||  || |||||||||
Sbjct: 700 tccggcttcttgtggccaccgggtagcttctccttgatcttgtccagcaaggcctttctt 641

                    
Query: 509 ctcctcctc 517
           |||||||||
Sbjct: 640 ctcctcctc 632



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 301 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 352
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||
Sbjct: 843 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 792



to top

>gb|AF190474.2|AF190474 Boea crassifolia bdn1 (bdn1) mRNA, partial cds
          Length = 756

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 464 gccgccgggcagcttctccttgatcttttccaagaagcctttcttctcctcc 515
           ||||||||| ||||||||||||||||| || ||||| |||||||||||||||
Sbjct: 570 gccgccgggtagcttctccttgatcttatctaagaaccctttcttctcctcc 519



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcct 513
           ||||||||||| ||||| |||||||| |||||||| ||||
Sbjct: 692 agcttctcctttatcttatccaagaaacctttcttttcct 653



to top

>gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB17-like gene,
            partial sequence
          Length = 4636

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 468  ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            ||||||||||||||||||||||| |||| || ||||||||||||
Sbjct: 1501 ccgggcagcttctccttgatcttgtccatgatgcctttcttctc 1458



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 458  cttgtggccgccgggcagcttctccttgatctt 490
            ||||||||| |||||||||||||||||||||||
Sbjct: 1361 cttgtggcctccgggcagcttctccttgatctt 1329



to top

>gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, partial cds
          Length = 549

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||||||||| |||| || ||||||||||||
Sbjct: 312 ccgggcagcttctccttgatcttgtccatgatgcctttcttctc 269



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||| |||||||||||||||||||||||
Sbjct: 175 cttgtggcctccgggcagcttctccttgatctt 143



to top

>gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, complete cds
          Length = 748

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||||||||| |||| || ||||||||||||
Sbjct: 490 ccgggcagcttctccttgatcttgtccatgatgcctttcttctc 447



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 458 cttgtggccgccgggcagcttctccttgatcttttc 493
           ||||||| | ||||||||||||||||||||||||||
Sbjct: 353 cttgtgggctccgggcagcttctccttgatcttttc 318



to top

>gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein WCS120 (WCS120) mRNA,
           complete cds
          Length = 1504

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 100 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 50



to top

>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2)
           mRNA, complete cds
          Length = 1518

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 131 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 81



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 460  tgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            ||||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 1083 tgtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 1032



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| ||||| |||||||| || |||| || ||||||||||||
Sbjct: 890 gtggccaccggggagcttgtccttgatgttctccatgacgcctttcttctc 840



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 315  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 1282 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1242



to top

>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds
          Length = 3447

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 676 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 626



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 461  gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 1921 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 1871



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 315  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 2313 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2273



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 460  tgtggccgccgggcagcttctccttgat 487
            ||||||| ||||| ||||||||||||||
Sbjct: 2114 tgtggccaccggggagcttctccttgat 2087



to top

>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds
          Length = 1243

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 128 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 78



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| || |||| || ||| ||||||||
Sbjct: 953 gtggccaccggggagcttctccttgatgttctccatgacgcccttcttctc 903



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 315  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 1213 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1173



to top

>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds
          Length = 2432

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 669 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 619



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 461  gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 1914 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 1864



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 315  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 2306 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2266



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 460  tgtggccgccgggcagcttctccttgat 487
            ||||||| ||||| ||||||||||||||
Sbjct: 2107 tgtggccaccggggagcttctccttgat 2080



to top

>gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds
          Length = 1629

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 154 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctc 104



to top

>gb|DQ160121.1| Taraxacum officinale TO101-3 (To101-3) mRNA, partial cds
          Length = 322

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 458 cttgtggccgccgggcagcttctccttgatcttttcca 495
           ||||||||||||||| ||||||||||||||||| ||||
Sbjct: 222 cttgtggccgccgggaagcttctccttgatcttctcca 185



to top

>emb|AJ439990.1|OSA439990 Oryza sativa partial mRNA for putative cold acclimation protein
           (cap-L gene)
          Length = 504

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 302 cttgtggtaaccgggcagcttgtccatgatcttgcccagta 342
           |||||||||||||||||| || | |||||||||||||||||
Sbjct: 123 cttgtggtaaccgggcagtttctncatgatcttgcccagta 83



to top

>emb|AJ844000.1| Plantago major mRNA for dehydrin 1 (dhn1 gene)
          Length = 1034

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 476 cttctccttgatcttttccaagaagcctttcttctcct 513
           ||||||||||||||| |||||||| |||||||||||||
Sbjct: 737 cttctccttgatcttctccaagaatcctttcttctcct 700



to top

>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0034E03 map near 50283S, complete sequence
          Length = 134074

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 467   gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
             |||||||||||||||||||||||| |||| ||| || ||||||||
Sbjct: 67046 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 67002



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                              
Query: 458   cttgtggccgccgggcagcttctccttgatctt 490
             ||||| |||||||||||||||||||||||||||
Sbjct: 66878 cttgttgccgccgggcagcttctccttgatctt 66846



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 467   gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
             |||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 60505 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 60461



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 467   gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
             |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 82901 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 82857



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 458   cttgtggccgccgggcagcttctccttgatctt 490
             ||||| ||||||||| |||||||||||||||||
Sbjct: 82721 cttgttgccgccggggagcttctccttgatctt 82689



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 467   gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
             |||||| ||||| ||||||||||| |||| |||||| ||||||||
Sbjct: 75489 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 75445



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 458   cttgtggccgccgggcagcttctccttgatctt 490
             ||||| ||||||||| |||||||||||||||||
Sbjct: 75315 cttgttgccgccggggagcttctccttgatctt 75283



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 458   cttgtggccgccgggcagcttctccttgatctt 490
             ||||| ||||||||| |||||||||||||||||
Sbjct: 60343 cttgttgccgccggggagcttctccttgatctt 60311



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 312   ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
             ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 60504 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 60461



to top

>gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 976 ggcagcttctccttgatcttgtcca 952



to top

>gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 978 ggcagcttctccttgatcttgtcca 954



to top

>gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 976 ggcagcttctccttgatcttgtcca 952



to top

>gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 976 ggcagcttctccttgatcttgtcca 952



to top

>gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 992

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 808 cttgtggccgccggggagcttctccttgatctt 776



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 963 ggcagcttctccttgatcttgtcca 939



to top

>gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 994

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 810 cttgtggccgccggggagcttctccttgatctt 778



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 965 ggcagcttctccttgatcttgtcca 941



to top

>gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 976 ggcagcttctccttgatcttgtcca 952



to top

>gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1000

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 816 cttgtggccgccggggagcttctccttgatctt 784



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 971 ggcagcttctccttgatcttgtcca 947



to top

>gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 821 cttgtggccgccggggagcttctccttgatctt 789



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 976 ggcagcttctccttgatcttgtcca 952



to top

>gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 978 ggcagcttctccttgatcttgtcca 954



to top

>gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 978 ggcagcttctccttgatcttgtcca 954



to top

>gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1004

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 820 cttgtggccgccggggagcttctccttgatctt 788



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 975 ggcagcttctccttgatcttgtcca 951



to top

>gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 978 ggcagcttctccttgatcttgtcca 954



to top

>gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 817 cttgtggccgccggggagcttctccttgatctt 785



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 972 ggcagcttctccttgatcttgtcca 948



to top

>gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 823 cttgtggccgccggggagcttctccttgatctt 791



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 978 ggcagcttctccttgatcttgtcca 954



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 467      gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
                |||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 14766555 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14766599



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| |||||||||||||||||||||||||||
Sbjct: 14760182 cttgttgccgccgggcagcttctccttgatctt 14760214



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 467      gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
                |||||||||||||||||||||||| |||| ||| || ||||||||
Sbjct: 14760014 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 14760058



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| ||||||||| |||||||||||||||||
Sbjct: 14766717 cttgttgccgccggggagcttctccttgatctt 14766749



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| ||||||||| |||||||||||||||||
Sbjct: 14751745 cttgttgccgccggggagcttctccttgatctt 14751777



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                             
Query: 467      gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
                |||||| ||||| ||||||||||| |||| |||||| ||||||||
Sbjct: 14751571 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 14751615



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| ||||||||| |||||||||||||||||
Sbjct: 14744339 cttgttgccgccggggagcttctccttgatctt 14744371



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                             
Query: 467      gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
                |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 14744159 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 14744203



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| ||||||||| |||||||||||||||||
Sbjct: 14645822 cttgttgccgccggggagcttctccttgatctt 14645854



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 312      ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
                ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 14766556 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14766599



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 468      ccgggcagcttctccttgatcttttcca 495
                ||||| ||||||||||||||||| ||||
Sbjct: 14645646 ccggggagcttctccttgatcttctcca 14645673



to top

>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21
          Length = 2537

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 467  gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 2164 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 2120



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 458  cttgtggccgccgggcagcttctccttgatctt 490
            ||||| ||||||||| |||||||||||||||||
Sbjct: 1972 cttgttgccgccggggagcttctccttgatctt 1940



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 312  ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
            ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 2163 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 2120



to top

>emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd27e
          Length = 751

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 325 cttgtggccgccggggagcttctccttgatctt 293



to top

>emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene)
          Length = 852

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||| |||||||||||||||||||||||
Sbjct: 422 cttgtggcctccgggcagcttctccttgatctt 390



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||||| |||||||| ||||  | ||||||||||||
Sbjct: 589 ccgggcagcttctctttgatcttgtccataatgcctttcttctc 546



to top

>emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene
          Length = 2890

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 467  gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||||||||||||||||||||| |||| ||| || ||||||||
Sbjct: 1976 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 1932



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 458  cttgtggccgccgggcagcttctccttgatctt 490
            ||||| |||||||||||||||||||||||||||
Sbjct: 1808 cttgttgccgccgggcagcttctccttgatctt 1776



to top

>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds
          Length = 864

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 573 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 529



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 572 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 529



to top

>gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, complete cds
          Length = 1791

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||||||||| |||||||||||||||||
Sbjct: 988 cttgtggccgccggggagcttctccttgatctt 956



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 471  ggcagcttctccttgatcttttcca 495
            |||||||||||||||||||| ||||
Sbjct: 1143 ggcagcttctccttgatcttgtcca 1119



to top

>dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H03, full
           insert sequence
          Length = 872

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||||||||||||||| |||| ||| || ||||||||
Sbjct: 621 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 577



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||| |||||||||||||||||||||||||||
Sbjct: 453 cttgttgccgccgggcagcttctccttgatctt 421



to top

>gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, complete cds
          Length = 1630

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 458  cttgtggccgccgggcagcttctccttgatctt 490
            ||||||||||||||| |||||||||||||||||
Sbjct: 1048 cttgtggccgccggggagcttctccttgatctt 1016



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 471  ggcagcttctccttgatcttttcca 495
            |||||||||||||||||||| ||||
Sbjct: 1203 ggcagcttctccttgatcttgtcca 1179



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 467      gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
                |||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 14846992 gccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14847036



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| |||||||||||||||||||||||||||
Sbjct: 14840619 cttgttgccgccgggcagcttctccttgatctt 14840651



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 467      gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
                |||||||||||||||||||||||| |||| ||| || ||||||||
Sbjct: 14840451 gccgggcagcttctccttgatcttgtccatgaatcccttcttctc 14840495



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| ||||||||| |||||||||||||||||
Sbjct: 14847154 cttgttgccgccggggagcttctccttgatctt 14847186



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| ||||||||| |||||||||||||||||
Sbjct: 14832182 cttgttgccgccggggagcttctccttgatctt 14832214



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                             
Query: 467      gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
                |||||| ||||| ||||||||||| |||| |||||| ||||||||
Sbjct: 14832008 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 14832052



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| ||||||||| |||||||||||||||||
Sbjct: 14824776 cttgttgccgccggggagcttctccttgatctt 14824808



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                             
Query: 467      gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
                |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 14824596 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 14824640



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                ||||| ||||||||| |||||||||||||||||
Sbjct: 14727823 cttgttgccgccggggagcttctccttgatctt 14727855



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 312      ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
                ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 14846993 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14847036



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 468      ccgggcagcttctccttgatcttttcca 495
                ||||| ||||||||||||||||| ||||
Sbjct: 14727647 ccggggagcttctccttgatcttctcca 14727674



to top

>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3)
           mRNA, complete cds
          Length = 793

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 430



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 430



to top

>dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K14, full
           insert sequence
          Length = 709

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttct 510
           |||||||||||||||||||||||| |||| || ||| |||||||
Sbjct: 602 gccgggcagcttctccttgatcttgtccatgatgcccttcttct 559



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||| ||||||||| |||||||||||||||||
Sbjct: 440 cttgttgccgccggggagcttctccttgatctt 408



to top

>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16
          Length = 814

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 462



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 462



to top

>emb|X15994.1|ZMRAB17G Maize RAB-17 gene
          Length = 1986

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 468  ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            ||||||||||||||||||||||| ||||  | ||||||||||||
Sbjct: 1287 ccgggcagcttctccttgatcttgtccataatgcctttcttctc 1244



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 458  cttgtggccgccgggcagcttctccttgatctt 490
            ||||||||| |||||||||||||| ||||||||
Sbjct: 1120 cttgtggcctccgggcagcttctctttgatctt 1088



to top

>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18)
          Length = 1049

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 699



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 699



to top

>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17)
          Length = 812

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 492



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 461 gtggccgccgggcagcttctccttgatctt 490
           |||||| ||||| |||||||||||||||||
Sbjct: 332 gtggccaccggggagcttctccttgatctt 303



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 312 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 492



to top

>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds
          Length = 1637

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 456  ttcttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||||| ||||| || ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 1302 ttcttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctc 1247



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 461  gtggccgccgggcagcttctccttgatcttttcca 495
            |||||||||||| ||||||||||||||||| ||||
Sbjct: 1474 gtggccgccggggagcttctccttgatcttctcca 1440



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 465  ccgccgggcagcttctccttgatctt 490
            |||||||| |||||||||||||||||
Sbjct: 1149 ccgccggggagcttctccttgatctt 1124



to top

>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds
          Length = 1575

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 468  ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            ||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1307



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 461  gtggccgccgggcagcttctccttgatctt 490
            |||||| ||||| |||||||||||||||||
Sbjct: 1147 gtggccaccggggagcttctccttgatctt 1118



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 312  ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
            ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1307



to top

>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds
          Length = 1560

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 468  ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            ||||||||||||||||||||||| |||| || ||| ||||||||
Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1270



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 461  gtggccgccgggcagcttctccttgatctt 490
            |||||| ||||| |||||||||||||||||
Sbjct: 1110 gtggccaccggggagcttctccttgatctt 1081



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 312  ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
            ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1270



to top

>gb|AY737725.1| Salvia miltiorrhiza dehydrin mRNA, partial cds
          Length = 864

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 471 ggcagcttctccttgatcttttccaagaagcctttcttctcct 513
           |||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 673 ggcagcttctccttgatcttatccaagaatcccttcttttcct 631



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 464 gccgccgggcagcttctccttgatcttttccaagaagcctttcttctcctc 514
           |||||| || ||||| ||||||||||| || | ||||||||||||||||||
Sbjct: 545 gccgcctgggagcttgtccttgatcttgtctaggaagcctttcttctcctc 495



to top

>gb|AY695932.1| Salvia miltiorrhiza dehydration protein (bdn1) mRNA, complete cds
          Length = 969

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 471 ggcagcttctccttgatcttttccaagaagcctttcttctcct 513
           |||||||||||||||||||| |||||||| || ||||| ||||
Sbjct: 660 ggcagcttctccttgatcttatccaagaatcccttcttttcct 618



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 464 gccgccgggcagcttctccttgatcttttccaagaagcctttcttctcctc 514
           |||||| || ||||| ||||||||||| || | ||||||||||||||||||
Sbjct: 532 gccgcctgggagcttgtccttgatcttgtctaggaagcctttcttctcctc 482



to top

>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 549



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7
          Length = 2138

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 465  ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 1510 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1464



to top

>emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8)
          Length = 683

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 483 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 437



to top

>emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin
          Length = 671

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 472 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 426



to top

>gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, complete cds
          Length = 512

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 437 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 391



to top

>gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1446

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1291

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1249

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1202

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1330

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439



to top

>gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1428

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1417

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439



to top

>gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1428

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 439



to top

>gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1230

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1243

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449



to top

>gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1249

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1243

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 449



to top

>gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1249

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 445



to top

>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds
          Length = 2814

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 461  gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||| ||||| |||||||||||||| ||||||| || ||| ||||||||
Sbjct: 1919 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctc 1869



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||| || |||||||||||||| |||| || ||| ||||||||
Sbjct: 674 gtggccgccggggagtttctccttgatcttctccatgatgcccttcttctc 624



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 315  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 2311 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2271



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 460  tgtggccgccgggcagcttctccttgat 487
            ||||||| ||||| ||||||||||||||
Sbjct: 2112 tgtggccaccggggagcttctccttgat 2085



to top

>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds
          Length = 3086

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 461  gtggccgccgggcagcttctccttgatcttttcca 495
            |||||||||||| ||||||||||||||||| ||||
Sbjct: 2389 gtggccgccggggagcttctccttgatcttctcca 2355



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 458  cttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||| ||||| || ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 2215 cttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctc 2162



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 465  ccgccgggcagcttctccttgatctt 490
            |||||||| |||||||||||||||||
Sbjct: 2064 ccgccggggagcttctccttgatctt 2039



to top

>gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, complete cds
          Length = 2717

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 465  ccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 1767 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctc 1721



to top

>gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein WCOR80 (Wcor80) mRNA,
           complete cds
          Length = 465

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| |||||||||||||| || |||| || ||||||||||||
Sbjct: 125 gtggccaccggggagcttctccttgatgttctccatgatgcctttcttctc 75



to top

>gb|DQ487112.1| Panax ginseng dehydrin 7 (Dhn7) mRNA, complete cds
          Length = 1057

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctcct 513
           ||||||||||||||||| ||||||||||  |  |||||||||||||
Sbjct: 677 ccgggcagcttctccttaatcttttccatcattcctttcttctcct 632



to top

>gb|DQ487106.1| Panax ginseng dehydrin 1 (Dhn1) mRNA, complete cds
          Length = 1028

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctcct 513
           ||||||||||||||||| ||||||||||  |  |||||||||||||
Sbjct: 690 ccgggcagcttctccttaatcttttccatcattcctttcttctcct 645



to top

>dbj|AB010898.1| Daucus carota mRNA for ecpp44, complete cds
          Length = 925

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 465 ccgccgggcagcttctccttgatcttttccaagaagcctttcttct 510
           ||||| |||||||||||||||||||| ||||  ||||| |||||||
Sbjct: 544 ccgcctggcagcttctccttgatcttctccataaagcccttcttct 499



to top

>ref|NM_192219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 687

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 672 gccggggagcttctccttgatcttctccacgatgcccttcttctc 628



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           |||||||| |||||| ||||||||||| |||||
Sbjct: 543 cttgtggctgccgggaagcttctcctttatctt 511



to top

>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0037B06 map near 50283S, complete sequence
          Length = 149398

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 458   cttgtggccgccgggcagcttctccttgatctt 490
             ||||| ||||||||| |||||||||||||||||
Sbjct: 88894 cttgttgccgccggggagcttctccttgatctt 88862



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 468   ccgggcagcttctccttgatcttttcca 495
             ||||| ||||||||||||||||| ||||
Sbjct: 89070 ccggggagcttctccttgatcttctcca 89043



to top

>gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-resistant protein
           mRNA, complete cds
          Length = 1021

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 761 gccggggagcttctccttgatcttctccacgatgcccttcttctc 717



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           |||||||| |||||| ||||||||||| |||||
Sbjct: 632 cttgtggctgccgggaagcttctcctttatctt 600



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                             
Query: 467      gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
                |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 29117639 gccggggagcttctccttgatcttctccacgatgcccttcttctc 29117595



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 458      cttgtggccgccgggcagcttctccttgatctt 490
                |||||||| |||||| ||||||||||| |||||
Sbjct: 29117510 cttgtggctgccgggaagcttctcctttatctt 29117478



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 376      cctcctcggcggccggcgcaggcgc 400
                |||||||||||||||||| ||||||
Sbjct: 24360655 cctcctcggcggccggcgaaggcgc 24360631



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 325      ccatgatcttgcccagtagg 344
                ||||||||||||||||||||
Sbjct: 42400771 ccatgatcttgcccagtagg 42400752



to top

>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0421H07
          Length = 158126

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 467   gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
             |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 78005 gccggggagcttctccttgatcttctccacgatgcccttcttctc 77961



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 458   cttgtggccgccgggcagcttctccttgatctt 490
             |||||||| |||||| ||||||||||| |||||
Sbjct: 77876 cttgtggctgccgggaagcttctcctttatctt 77844



to top

>emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene
          Length = 2459

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 467  gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 1518 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 1474



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 458  cttgtggccgccgggcagcttctccttgatctt 490
            ||||| ||||||||| |||||||||||||||||
Sbjct: 1338 cttgttgccgccggggagcttctccttgatctt 1306



to top

>emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene
          Length = 2493

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 467  gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
            |||||| ||||| ||||||||||| |||| |||||| ||||||||
Sbjct: 2047 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 2003



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 458  cttgtggccgccgggcagcttctccttgatctt 490
            ||||| ||||||||| |||||||||||||||||
Sbjct: 1873 cttgttgccgccggggagcttctccttgatctt 1841



to top

>emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene, rab
          Length = 781

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||| ||||| |||||||||||||||||
Sbjct: 294 cttgtggccaccggggagcttctccttgatctt 262



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 461 ggcagcttctccttgatcttgtcca 437



to top

>emb|X57327.1|OSRAB25 Rice rab25 mRNA
          Length = 920

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 732 gccggggagcttctccttgatcttctccacgatgcccttcttctc 688



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           |||||||| |||||| ||||||||||| |||||
Sbjct: 603 cttgtggctgccgggaagcttctcctttatctt 571



to top

>dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-A09, full
           insert sequence
          Length = 852

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 552 gccggggagcttctccttgatcttgtccacgatgcccttcttctc 508



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||| |||||| || |||||||||||||||||
Sbjct: 372 cttgttgccgcctgggagcttctccttgatctt 340



to top

>dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096D05, full
           insert sequence
          Length = 795

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||| ||||||||||| |||| |||||| ||||||||
Sbjct: 564 gccgggaagcttttccttgatcttgtccatgaagcccttcttctc 520



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||| ||||||||| |||||||||||||||||
Sbjct: 390 cttgttgccgccggggagcttctccttgatctt 358



to top

>dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-F09, full
           insert sequence
          Length = 761

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||| ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 553 gccggggagcttctccttgatcttctccacgatgcccttcttctc 509



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           |||||||| |||||| ||||||||||| |||||
Sbjct: 424 cttgtggctgccgggaagcttctcctttatctt 392



to top

>gb|AY104757.1| Zea mays PCO142314 mRNA sequence
          Length = 899

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 458 cttgtggccgccgggcagcttctccttgatctt 490
           ||||||||| |||||||||||||| ||||||||
Sbjct: 419 cttgtggcctccgggcagcttctctttgatctt 387



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||||||||| |||||||| ||||  | ||||||||||||
Sbjct: 586 ccgggcagcttctctttgatcttgtccataatgcctttcttctc 543



to top

>gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, complete cds
          Length = 616

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 458 cttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttc 509
           ||||| ||| ||||| ||||||||||||||||| |||  || ||||||||||
Sbjct: 348 cttgttgcctccggggagcttctccttgatcttctccttgatgcctttcttc 297



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 468 ccgggcagcttctccttgatcttttcca 495
           ||||| ||||||||||||||||| ||||
Sbjct: 491 ccgggaagcttctccttgatcttgtcca 464



to top

>gb|AY389583.1| Hyacinthus orientalis dehydrin mRNA, partial cds
          Length = 729

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 456 ttcttgtggccgccgggcagcttctccttgat 487
           ||||||||||| || |||||||||||||||||
Sbjct: 427 ttcttgtggccacccggcagcttctccttgat 396



to top

>gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds
          Length = 853

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||||||||| ||||  |  |||||||||||
Sbjct: 536 ccgggcagcttctccttgatcttctccatcattcctttcttctc 493



to top

>gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, complete cds
          Length = 697

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 459 ttgtggccgccgggcagcttctccttga 486
           |||||||||||||| |||||||||||||
Sbjct: 362 ttgtggccgccgggtagcttctccttga 335



to top

>gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod60) mRNA, complete
            cds
          Length = 1921

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 474  agcttctccttgatcttttccaagaagcctttcttctcct 513
            ||||||||||||||||| |||| ||  |||||||||||||
Sbjct: 1739 agcttctccttgatcttctccatgactcctttcttctcct 1700



to top

>gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-related protein mRNA,
           complete cds
          Length = 634

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 467 gccgggcagcttctccttgatcttttccaagaagcctttcttctcctc 514
           |||||| ||||||||||||||||| ||||  |  ||||||||||||||
Sbjct: 406 gccggggagcttctccttgatcttctccatcacccctttcttctcctc 359



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 373      tcacctcctcggcggccggcgcaggcgc 400
                |||||||||||||||||||||| |||||
Sbjct: 18517274 tcacctcctcggcggccggcgccggcgc 18517247



to top

>dbj|AK073885.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033073G16, full
           insert sequence
          Length = 976

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 373 tcacctcctcggcggccggcgcaggcgc 400
           |||||||||||||||||||||| |||||
Sbjct: 526 tcacctcctcggcggccggcgccggcgc 499



to top

>gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene, complete cds
          Length = 2890

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 468  ccgggcagcttctccttgatcttttcca 495
            ||||||||||||||||||||||| ||||
Sbjct: 1885 ccgggcagcttctccttgatcttgtcca 1858



to top

>emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chromosome 2, complete
              sequence
          Length = 205838

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 52     ctgactctggaccaaactgaagcc 75
              ||||||||||||||||||||||||
Sbjct: 138293 ctgactctggaccaaactgaagcc 138316



to top

>ref|NM_101894.3| Arabidopsis thaliana COR47 AT1G20440 (COR47) mRNA, complete cds
          Length = 1219

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520
           ||||||||||||||||| || |  || ||||||||||| ||||||||
Sbjct: 689 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 643



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515
           |||||||| |||||||||||||| |  || ||||||||||||
Sbjct: 842 agcttctctttgatcttttccaaaatccccttcttctcctcc 801



to top

>gb|AY706990.1| Vitis vinifera dehydrin 1b (DHN1b) gene, complete cds,
           alternatively spliced
          Length = 1296

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495
           |||||| || |||||||||||||||||||| ||||
Sbjct: 610 gtggcccccaggcagcttctccttgatcttctcca 576



to top

>gb|AY706989.1| Vitis vinifera dehydrin 1a (DHN1a) gene, complete cds,
           alternatively spliced
          Length = 845

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495
           |||||| || |||||||||||||||||||| ||||
Sbjct: 624 gtggcccccaggcagcttctccttgatcttctcca 590



to top

>gb|AY706988.1| Vitis riparia dehydrin 1b (DHN1b) gene, partial sequence
          Length = 1296

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495
           |||||| || |||||||||||||||||||| ||||
Sbjct: 610 gtggcccccaggcagcttctccttgatcttctcca 576



to top

>gb|AY114699.1| Arabidopsis thaliana unknown protein (At1g20440) mRNA, complete cds
          Length = 911

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520
           ||||||||||||||||| || |  || ||||||||||| ||||||||
Sbjct: 581 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 535



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515
           |||||||| |||||||||||||| |  || ||||||||||||
Sbjct: 734 agcttctctttgatcttttccaaaatccccttcttctcctcc 693



to top

>gb|AY072392.1| Arabidopsis thaliana unknown protein (At1g20440) mRNA, complete cds
          Length = 1040

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520
           ||||||||||||||||| || |  || ||||||||||| ||||||||
Sbjct: 687 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 641



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515
           |||||||| |||||||||||||| |  || ||||||||||||
Sbjct: 840 agcttctctttgatcttttccaaaatccccttcttctcctcc 799



to top

>gb|AY634281.1| Vitis vinifera dehydrin mRNA, complete cds
          Length = 876

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 461 gtggccgccgggcagcttctccttgatcttttcca 495
           |||||| || |||||||||||||||||||| ||||
Sbjct: 456 gtggcccccaggcagcttctccttgatcttctcca 422



to top

>dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, complete cds
          Length = 771

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttcttctcctc 514
           ||||||||||| ||||||||||| ||||  |  ||||||||||||||
Sbjct: 505 ccgggcagcttgtccttgatcttatccataattcctttcttctcctc 459



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 311 accgggcagcttgtccatgatctt 334
           |||||||||||||||| |||||||
Sbjct: 506 accgggcagcttgtccttgatctt 483



to top

>gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana BAC F5M15 from chromosome I,
             complete sequence
          Length = 99231

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 474   agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520
             ||||||||||||||||| || |  || ||||||||||| ||||||||
Sbjct: 79718 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 79672



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 474   agcttctccttgatcttttccaagaagcctttcttctcctcc 515
             |||||||| |||||||||||||| |  || ||||||||||||
Sbjct: 79871 agcttctctttgatcttttccaaaatccccttcttctcctcc 79830



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 474   agcttctccttgatcttttccaagaagcctttcttctc 511
             ||||||||||||||||| ||||  || |||||||||||
Sbjct: 76232 agcttctccttgatcttatccataaaccctttcttctc 76195



to top

>dbj|AB004872.1| Arabidopsis thaliana DNA for COR47, complete cds
          Length = 2484

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 474  agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520
            ||||||||||||||||| || |  || ||||||||||| ||||||||
Sbjct: 2096 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 2050



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 474  agcttctccttgatcttttccaagaagcctttcttctcctcc 515
            |||||||| |||||||||||||| |  || ||||||||||||
Sbjct: 2249 agcttctctttgatcttttccaaaatccccttcttctcctcc 2208



to top

>emb|X90959.1|ATCOR47G A.thaliana cor47 gene
          Length = 1260

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520
           ||||||||||||||||| || |  || ||||||||||| ||||||||
Sbjct: 915 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 869



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 474  agcttctccttgatcttttccaagaagcctttcttctcctcc 515
            |||||||| |||||||||||||| |  || ||||||||||||
Sbjct: 1068 agcttctctttgatcttttccaaaatccccttcttctcctcc 1027



to top

>emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9)
          Length = 683

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 465 ccgccgggcagcttctccttgatcttttcca 495
           |||||||| ||||||||||||||||| ||||
Sbjct: 477 ccgccgggaagcttctccttgatcttgtcca 447



to top

>emb|X59814.1|ATCOR47 A.thaliana cor47 mRNA
          Length = 1073

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcctcggg 520
           ||||||||||||||||| || |  || ||||||||||| ||||||||
Sbjct: 670 agcttctccttgatcttctcaactaatcctttcttctcttcctcggg 624



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515
           |||||||| |||||||||||||| |  || ||||||||||||
Sbjct: 823 agcttctctttgatcttttccaaaatccccttcttctcctcc 782



to top

>gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, complete cds
          Length = 1294

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 465  ccgccgggcagcttctccttgatcttttcca 495
            |||||||| ||||||||||||||||| ||||
Sbjct: 1170 ccgccgggaagcttctccttgatcttgtcca 1140



to top

>gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, complete cds
          Length = 1849

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 465  ccgccgggcagcttctccttgatcttttcca 495
            |||||||| ||||||||||||||||| ||||
Sbjct: 1178 ccgccgggaagcttctccttgatcttgtcca 1148



to top

>ref|NM_180616.2| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) transcript variant
            AT1G20450.1 mRNA, complete cds
          Length = 1514

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 474  agcttctccttgatcttttccaagaagcctttcttctc 511
            ||||||||||||||||| ||||  || |||||||||||
Sbjct: 1092 agcttctccttgatcttatccataaaccctttcttctc 1055



to top

>ref|NM_101895.3| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) transcript variant
            AT1G20450.2 mRNA, complete cds
          Length = 1511

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 474  agcttctccttgatcttttccaagaagcctttcttctc 511
            ||||||||||||||||| ||||  || |||||||||||
Sbjct: 1089 agcttctccttgatcttatccataaaccctttcttctc 1052



to top

>gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, complete cds
          Length = 1124

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 764 agcttctccttgatcttgtccatgatgcccttcttctc 727



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 461 gtggccgccgggcagcttctccttgatctt 490
           |||||| ||||| |||||||||||||||||
Sbjct: 366 gtggccaccggggagcttctccttgatctt 337



to top

>gb|AY142491.1| Arabidopsis thaliana unknown protein (At1g20450) mRNA, complete cds
          Length = 814

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| ||||  || |||||||||||
Sbjct: 593 agcttctccttgatcttatccataaaccctttcttctc 556



to top

>gb|AF360351.1| Arabidopsis thaliana unknown protein (At1g20450) mRNA, complete cds
          Length = 1080

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| ||||  || |||||||||||
Sbjct: 700 agcttctccttgatcttatccataaaccctttcttctc 663



to top

>gb|AY136407.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 1056

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| ||||  || |||||||||||
Sbjct: 699 agcttctccttgatcttatccataaaccctttcttctc 662



to top

>emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene for dessication-related
            protein
          Length = 1742

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 462  tggccgccgggcagcttctccttgatcttttcca 495
            ||||||||||| |||||||| |||||||| ||||
Sbjct: 1529 tggccgccgggaagcttctctttgatcttgtcca 1496



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 462  tggccgccgggcagcttctccttgatctt 490
            ||||||||||| ||||||||||| |||||
Sbjct: 1415 tggccgccgggaagcttctccttcatctt 1387



to top

>gb|AY065655.1| Pisum sativum ultraviolet-B-repressible dehydrin-related protein
           mRNA, partial cds
          Length = 387

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| |||||||||||||| |  |||||||||||
Sbjct: 173 agcttctctttgatcttttccaaaatacctttcttctc 136



to top

>gb|AY048208.1| Arabidopsis thaliana At1g20450/F5M15_20 mRNA, complete cds
          Length = 693

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| ||||  || |||||||||||
Sbjct: 375 agcttctccttgatcttatccataaaccctttcttctc 338



to top

>gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-related protein mRNA,
           complete cds
          Length = 741

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 462 tggccgccgggcagcttctccttgatcttttcca 495
           ||||||||||| |||||||| |||||||| ||||
Sbjct: 528 tggccgccgggaagcttctctttgatcttgtcca 495



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 462 tggccgccgggcagcttctccttgatctt 490
           ||||||||||| ||||||||||| |||||
Sbjct: 414 tggccgccgggaagcttctccttcatctt 386



to top

>emb|BX815233.1|CNS0ACV9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS44ZF01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 321

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 474 agcttctccttgatcttttccaagaagcctttcttctcctcc 515
           |||||||| |||||||||||||| |  || ||||||||||||
Sbjct: 84  agcttctctttgatcttttccaaaatccccttcttctcctcc 43



to top

>gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-like protein mRNA, complete
           cds
          Length = 775

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 474 agcttctccttgatcttttcca 495
           ||||||||||||||||||||||
Sbjct: 462 agcttctccttgatcttttcca 441



to top

>dbj|D17714.1|ATHERD10 Arabidopsis thaliana mRNA for ERD10 protein, complete cds
          Length = 1024

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| ||||  || |||||||||||
Sbjct: 667 agcttctccttgatcttatccataaaccctttcttctc 630



to top

>emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd38
          Length = 555

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 462 tggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           ||||| ||||| |||||||||||||| || |||| || ||| ||||||||
Sbjct: 140 tggccaccggggagcttctccttgatgttctccatgatgcccttcttctc 91



to top

>emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd25a
          Length = 565

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 462 tggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 511
           ||||| ||||| |||||||||||||| || |||| || ||| ||||||||
Sbjct: 146 tggccaccggggagcttctccttgatgttctccatgatgcccttcttctc 97



to top

>emb|X90958.1|ATDLTI29G A.thaliana lti29 gene
          Length = 1260

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| ||||  || |||||||||||
Sbjct: 920 agcttctccttgatcttatccataaaccctttcttctc 883



to top

>emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin
          Length = 1016

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 689 agcttctccttgatcttgtccatgatgcccttcttctc 652



to top

>emb|X62476.1|TARAB15B T.aestivum rab15B mRNA
          Length = 1068

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 749 agcttctccttgatcttgtccatgatgcccttcttctc 712



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 461 gtggccgccgggcagcttctccttgatctt 490
           |||||| ||||| |||||||||||||||||
Sbjct: 351 gtggccaccggggagcttctccttgatctt 322



to top

>emb|Z14145.1|DHNCOGG P.sativum dhn-cog gene encoding dehydrin-cognate
          Length = 1035

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           |||||||| |||||||||||||| |  |||||||||||
Sbjct: 736 agcttctctttgatcttttccaaaatacctttcttctc 699



to top

>emb|X77614.1|ATLTI45 A.thaliana (Landsberg Erecta) lti45 mRNA
          Length = 828

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| ||||  || |||||||||||
Sbjct: 429 agcttctccttgatcttatccataaaccctttcttctc 392



to top

>gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, complete cds
          Length = 2440

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 474  agcttctccttgatcttttccaagaagcctttcttctc 511
            ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 1539 agcttctccttgatcttgtccatgatgcccttcttctc 1502



to top

>gb|BT002131.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 827

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| ||||  || |||||||||||
Sbjct: 593 agcttctccttgatcttatccataaaccctttcttctc 556



to top

>gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1357

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 461 gtggccgccgggcagcttctccttgatctt 490
           |||||| ||||| |||||||||||||||||
Sbjct: 583 gtggccaccggggagcttctccttgatctt 554



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508
           |||||||||||||||||||| || |||| || ||| |||||
Sbjct: 828 ccgggcagcttctccttgattttgtccatgatgcccttctt 788



to top

>gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729



to top

>gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729



to top

>gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin
           4-like (Dhn4) gene, partial sequence
          Length = 422

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 341 agcttctccttgatcttgtccatgatgcccttcttctc 304



to top

>gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 920

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 764 agcttctccttgatcttgtccatgatgcccttcttctc 727



to top

>gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 924

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729



to top

>gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729



to top

>gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 921

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 765 agcttctccttgatcttgtccatgatgcccttcttctc 728



to top

>gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 919

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 763 agcttctccttgatcttgtccatgatgcccttcttctc 726



to top

>gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 910

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 754 agcttctccttgatcttgtccatgatgcccttcttctc 717



to top

>gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 921

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 765 agcttctccttgatcttgtccatgatgcccttcttctc 728



to top

>gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729



to top

>gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729



to top

>gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714



to top

>gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729



to top

>gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714



to top

>gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 921

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 765 agcttctccttgatcttgtccatgatgcccttcttctc 728



to top

>gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 980

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 824 agcttctccttgatcttgtccatgatgcccttcttctc 787



to top

>gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714



to top

>gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 904

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 748 agcttctccttgatcttgtccatgatgcccttcttctc 711



to top

>gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729



to top

>gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 916

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 760 agcttctccttgatcttgtccatgatgcccttcttctc 723



to top

>gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 906

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 750 agcttctccttgatcttgtccatgatgcccttcttctc 713



to top

>gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 908

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714



to top

>gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 751 agcttctccttgatcttgtccatgatgcccttcttctc 714



to top

>gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 474 agcttctccttgatcttttccaagaagcctttcttctc 511
           ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 766 agcttctccttgatcttgtccatgatgcccttcttctc 729



to top

>gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, complete cds
          Length = 2790

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 474  agcttctccttgatcttttccaagaagcctttcttctc 511
            ||||||||||||||||| |||| || ||| ||||||||
Sbjct: 2187 agcttctccttgatcttgtccatgatgcccttcttctc 2150



to top

>dbj|AB090885.1| Aster tripolium mRNA for dehydrin, complete cds
          Length = 979

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 465 ccgccgggcagcttctccttgatctt 490
           |||||||| |||||||||||||||||
Sbjct: 507 ccgccgggtagcttctccttgatctt 482



to top

>emb|AJ001448.1|FVAJ1448 Fragaria vesca partial mRNA for ripening-induced protein, clone
           2.5.R1
          Length = 815

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 476 cttctccttgatcttttccaagaagcctttcttctcct 513
           ||||||||||||||| ||||| || || ||||||||||
Sbjct: 642 cttctccttgatcttctccaacaaacccttcttctcct 605



to top

>gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds
          Length = 829

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 544 ggcagcttctccttgatcttgtcca 520



to top

>ref|NM_192777.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1419

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 376 cctcctcggcggccggcgcaggcgc 400
           |||||||||||||||||| ||||||
Sbjct: 349 cctcctcggcggccggcgaaggcgc 325



to top

>gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, complete sequence
          Length = 156547

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 81     acccaaactgaacacaagcat 101
              |||||||||||||||||||||
Sbjct: 134241 acccaaactgaacacaagcat 134261



to top

>gb|AY706987.1| Vitis riparia dehydrin 1a (DHN1a) gene, complete cds, alternatively
           spliced
          Length = 1324

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 614 ggcagcttctccttgatcttctcca 590



to top

>gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab21) mRNA, complete
           cds
          Length = 897

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 538 ggcagcttctccttgatcttgtcca 514



to top

>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgat 765



to top

>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccggggagcttctccttgat 765



to top

>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgat 765



to top

>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 183 tgtggccaccgggaagcttctccttgat 156



to top

>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 183 tgtggccaccgggaagcttctccttgat 156



to top

>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1061

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 315  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 1003 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 963



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgat 765



to top

>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 183 tgtggccaccgggaagcttctccttgat 156



to top

>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 183 tgtggccaccgggaagcttctccttgat 156



to top

>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgat 765



to top

>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 315 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 355
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 460 tgtggccgccgggcagcttctccttgat 487
           ||||||| ||||| ||||||||||||||
Sbjct: 792 tgtggccaccgggaagcttctccttgat 765



to top

>emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on chromosome 6 Contains an
             IMPDH1 (IMP (inosine monophosphate) dehydrogenase 1)
             pseudogene, an RNA helicase pseudogene and part of a novel
             gene similar to KIAA0161, complete sequence
          Length = 165653

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 333   ttgcccagtaggcccttcttc 353
             |||||||||||||||||||||
Sbjct: 48697 ttgcccagtaggcccttcttc 48717



to top

>gb|AC036101.6| Homo sapiens chromosome 10 clone RP11-71J2, complete sequence
          Length = 175492

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 475    gcttctccttgatcttttcca 495
              |||||||||||||||||||||
Sbjct: 115635 gcttctccttgatcttttcca 115615



to top

>gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, complete cds
          Length = 483

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508
           ||||||||||| ||||||||||| |||| || ||| |||||
Sbjct: 473 ccgggcagcttttccttgatcttgtccatgatgcccttctt 433



to top

>gb|DQ015701.1| Ovis aries endothelial nitric oxide synthase mRNA, complete cds
          Length = 4097

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 274  gggcggcggccttgtcctcctcccc 298
            |||||||||||||| ||||||||||
Sbjct: 2195 gggcggcggccttggcctcctcccc 2171



to top

>dbj|AB058947.1| Streptomyces albulus plasmid pNO33 DNA, complete sequence
          Length = 36955

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 447   tcctccggcttcttgtggccgccgg 471
             |||||||||||||||| ||||||||
Sbjct: 11860 tcctccggcttcttgtcgccgccgg 11836



to top

>dbj|AP002866.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0410E01
          Length = 166753

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 376    cctcctcggcggccggcgcaggcgc 400
              |||||||||||||||||| ||||||
Sbjct: 106559 cctcctcggcggccggcgaaggcgc 106535



to top

>gb|AF220407.1|AF220407 Vitis riparia dehydrin-like protein (Dhn) mRNA, complete cds
          Length = 761

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 471 ggcagcttctccttgatcttttcca 495
           |||||||||||||||||||| ||||
Sbjct: 468 ggcagcttctccttgatcttctcca 444



to top

>dbj|AK105551.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-128-A11, full
           insert sequence
          Length = 1509

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 376 cctcctcggcggccggcgcaggcgc 400
           |||||||||||||||||| ||||||
Sbjct: 399 cctcctcggcggccggcgaaggcgc 375



to top

>gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, complete cds
          Length = 654

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508
           |||||||||||||||||||| || |||| || ||| |||||
Sbjct: 577 ccgggcagcttctccttgattttgtccatgatgcccttctt 537



to top

>gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1371

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508
           |||||||||||||||||||| || |||| || ||| |||||
Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804



to top

>gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508
           |||||||||||||||||||| || |||| || ||| |||||
Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801



to top

>gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508
           |||||||||||||||||||| || |||| || ||| |||||
Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801



to top

>gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1332

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508
           |||||||||||||||||||| || |||| || ||| |||||
Sbjct: 803 ccgggcagcttctccttgattttgtccatgatgcccttctt 763



to top

>gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508
           |||||||||||||||||||| || |||| || ||| |||||
Sbjct: 841 ccgggcagcttctccttgattttgtccatgatgcccttctt 801



to top

>gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1373

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 468 ccgggcagcttctccttgatcttttccaagaagcctttctt 508
           |||||||||||||||||||| || |||| || ||| |||||
Sbjct: 844 ccgggcagcttctccttgattttgtccatgatgcccttctt 804


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,666,157
Number of Sequences: 3902068
Number of extensions: 4666157
Number of successful extensions: 119765
Number of sequences better than 10.0: 304
Number of HSP's better than 10.0 without gapping: 306
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 118053
Number of HSP's gapped (non-prelim): 1690
length of query: 520
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 497
effective length of database: 17,143,297,704
effective search space: 8520218958888
effective search space used: 8520218958888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top