Clone Name | rbart26a05 |
---|---|
Clone Library Name | barley_pub |
>gb|AC108501.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1354_D07, complete sequence Length = 156163 Score = 135 bits (68), Expect = 1e-28 Identities = 131/152 (86%) Strand = Plus / Plus Query: 211 gtggtcttggaggccctcctcaccagcacagcccagcacatgatcctgtacgccaggaag 270 |||||||||| |||||||| |||||||||||||||||||||| ||||||| | |||| Sbjct: 72379 gtggtcttggctgccctcctgaccagcacagcccagcacatgaccctgtacaagacgaag 72438 Query: 271 aagcccatcatgacccccacattgacccacctcatgccctcgtccacccctctccccctc 330 || || | ||||||||| ||||||||||||||||| |||||||| | ||||||||||||| Sbjct: 72439 aaccctagcatgaccccgacattgacccacctcatcccctcgtcgatccctctccccctc 72498 Query: 331 agcacgtcgcctccggtgctcaagcacacgcc 362 ||||| || || || | |||||||||||||| Sbjct: 72499 agcacatcaccccccttcctcaagcacacgcc 72530 Score = 115 bits (58), Expect = 1e-22 Identities = 76/82 (92%) Strand = Plus / Plus Query: 390 ccacgccacgcacctgtccctggcgctgcccccgtactcgttgatgagcagcaggtccag 449 |||||||||||||||| | ||| |||||| |||||||||||||| |||||||||||||| Sbjct: 72537 ccacgccacgcacctgccgctgctgctgccgccgtactcgttgatcagcagcaggtccag 72596 Query: 450 cgggtacctgtacatggacacg 471 |||||||||||||||||||||| Sbjct: 72597 cgggtacctgtacatggacacg 72618
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 135 bits (68), Expect = 1e-28 Identities = 131/152 (86%) Strand = Plus / Plus Query: 211 gtggtcttggaggccctcctcaccagcacagcccagcacatgatcctgtacgccaggaag 270 |||||||||| |||||||| |||||||||||||||||||||| ||||||| | |||| Sbjct: 18432542 gtggtcttggctgccctcctgaccagcacagcccagcacatgaccctgtacaagacgaag 18432601 Query: 271 aagcccatcatgacccccacattgacccacctcatgccctcgtccacccctctccccctc 330 || || | ||||||||| ||||||||||||||||| |||||||| | ||||||||||||| Sbjct: 18432602 aaccctagcatgaccccgacattgacccacctcatcccctcgtcgatccctctccccctc 18432661 Query: 331 agcacgtcgcctccggtgctcaagcacacgcc 362 ||||| || || || | |||||||||||||| Sbjct: 18432662 agcacatcaccccccttcctcaagcacacgcc 18432693 Score = 115 bits (58), Expect = 1e-22 Identities = 76/82 (92%) Strand = Plus / Plus Query: 390 ccacgccacgcacctgtccctggcgctgcccccgtactcgttgatgagcagcaggtccag 449 |||||||||||||||| | ||| |||||| |||||||||||||| |||||||||||||| Sbjct: 18432700 ccacgccacgcacctgccgctgctgctgccgccgtactcgttgatcagcagcaggtccag 18432759 Query: 450 cgggtacctgtacatggacacg 471 |||||||||||||||||||||| Sbjct: 18432760 cgggtacctgtacatggacacg 18432781
>dbj|AK120526.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013127B22, full insert sequence Length = 2156 Score = 135 bits (68), Expect = 1e-28 Identities = 131/152 (86%) Strand = Plus / Minus Query: 211 gtggtcttggaggccctcctcaccagcacagcccagcacatgatcctgtacgccaggaag 270 |||||||||| |||||||| |||||||||||||||||||||| ||||||| | |||| Sbjct: 2044 gtggtcttggctgccctcctgaccagcacagcccagcacatgaccctgtacaagacgaag 1985 Query: 271 aagcccatcatgacccccacattgacccacctcatgccctcgtccacccctctccccctc 330 || || | ||||||||| ||||||||||||||||| |||||||| | ||||||||||||| Sbjct: 1984 aaccctagcatgaccccgacattgacccacctcatcccctcgtcgatccctctccccctc 1925 Query: 331 agcacgtcgcctccggtgctcaagcacacgcc 362 ||||| || || || | |||||||||||||| Sbjct: 1924 agcacatcaccccccttcctcaagcacacgcc 1893 Score = 115 bits (58), Expect = 1e-22 Identities = 76/82 (92%) Strand = Plus / Minus Query: 390 ccacgccacgcacctgtccctggcgctgcccccgtactcgttgatgagcagcaggtccag 449 |||||||||||||||| | ||| |||||| |||||||||||||| |||||||||||||| Sbjct: 1886 ccacgccacgcacctgccgctgctgctgccgccgtactcgttgatcagcagcaggtccag 1827 Query: 450 cgggtacctgtacatggacacg 471 |||||||||||||||||||||| Sbjct: 1826 cgggtacctgtacatggacacg 1805
>dbj|AK107169.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-124-F12, full insert sequence Length = 2424 Score = 135 bits (68), Expect = 1e-28 Identities = 131/152 (86%) Strand = Plus / Minus Query: 211 gtggtcttggaggccctcctcaccagcacagcccagcacatgatcctgtacgccaggaag 270 |||||||||| |||||||| |||||||||||||||||||||| ||||||| | |||| Sbjct: 2214 gtggtcttggctgccctcctgaccagcacagcccagcacatgaccctgtacaagacgaag 2155 Query: 271 aagcccatcatgacccccacattgacccacctcatgccctcgtccacccctctccccctc 330 || || | ||||||||| ||||||||||||||||| |||||||| | ||||||||||||| Sbjct: 2154 aaccctagcatgaccccgacattgacccacctcatcccctcgtcgatccctctccccctc 2095 Query: 331 agcacgtcgcctccggtgctcaagcacacgcc 362 ||||| || || || | |||||||||||||| Sbjct: 2094 agcacatcaccccccttcctcaagcacacgcc 2063 Score = 115 bits (58), Expect = 1e-22 Identities = 76/82 (92%) Strand = Plus / Minus Query: 390 ccacgccacgcacctgtccctggcgctgcccccgtactcgttgatgagcagcaggtccag 449 |||||||||||||||| | ||| |||||| |||||||||||||| |||||||||||||| Sbjct: 2056 ccacgccacgcacctgccgctgctgctgccgccgtactcgttgatcagcagcaggtccag 1997 Query: 450 cgggtacctgtacatggacacg 471 |||||||||||||||||||||| Sbjct: 1996 cgggtacctgtacatggacacg 1975
>dbj|AK111176.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-177-F03, full insert sequence Length = 2733 Score = 115 bits (58), Expect = 1e-22 Identities = 76/82 (92%) Strand = Plus / Minus Query: 390 ccacgccacgcacctgtccctggcgctgcccccgtactcgttgatgagcagcaggtccag 449 |||||||||||||||| | ||| |||||| |||||||||||||| |||||||||||||| Sbjct: 1921 ccacgccacgcacctgccgctgctgctgccgccgtactcgttgatcagcagcaggtccag 1862 Query: 450 cgggtacctgtacatggacacg 471 |||||||||||||||||||||| Sbjct: 1861 cgggtacctgtacatggacacg 1840 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Minus Query: 301 ctcatgccctcgtccacccctctccccctcagcacgtcgcctccggtgctcaagcacacg 360 ||||| |||||||| | |||||||||||||||||| || || || | |||||||||||| Sbjct: 1989 ctcatcccctcgtcgatccctctccccctcagcacatcaccccccttcctcaagcacacg 1930 Query: 361 cc 362 || Sbjct: 1929 cc 1928
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Plus Query: 362 cgttgccgttcatggcgtcccctc 385 |||||||||||||||||||||||| Sbjct: 2423010 cgttgccgttcatggcgtcccctc 2423033
>gb|AC100491.9| Mus musculus chromosome 9, clone RP23-142M14, complete sequence Length = 222845 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 89 tcttaagaaatagcaaactacag 111 ||||||||||||||||||||||| Sbjct: 44277 tcttaagaaatagcaaactacag 44299
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 346 gtgctcaagcacacgccgttg 366 ||||||||||||||||||||| Sbjct: 557245 gtgctcaagcacacgccgttg 557225
>ref|NM_021789.2| Mus musculus trafficking protein particle complex 4 (Trappc4), mRNA Length = 1196 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 agcagcaggtccagcgggta 455 |||||||||||||||||||| Sbjct: 366 agcagcaggtccagcgggta 347
>gb|BT018856.1| Zea mays clone EL01N0556E05.d mRNA sequence Length = 2119 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 319 cctctccccctcagcacgtc 338 |||||||||||||||||||| Sbjct: 1963 cctctccccctcagcacgtc 1944
>gb|BC038898.1| Mus musculus trafficking protein particle complex 4, mRNA (cDNA clone MGC:49061 IMAGE:5401311), complete cds Length = 1196 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 agcagcaggtccagcgggta 455 |||||||||||||||||||| Sbjct: 366 agcagcaggtccagcgggta 347
>gb|AF426907.1| Anolis terraealtae isolate marm-Sts cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 517 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 440 ttgcattccacttcttactc 459
>gb|AC140884.2| Homo sapiens chromosome 16 clone RP11-1353K19, complete sequence Length = 203870 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 100 agcaaactacagcagaaaat 119 |||||||||||||||||||| Sbjct: 201150 agcaaactacagcagaaaat 201169
>gb|AC145889.4| Pan troglodytes BAC clone RP43-8B7 from 7, complete sequence Length = 174930 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 agcaaactacagcagaaaat 119 |||||||||||||||||||| Sbjct: 101530 agcaaactacagcagaaaat 101511
>gb|AF231654.1| Strongylura timucu clone STRI-4308 cytochrome b oxidase (Cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 800 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 536 ttgcattccacttcttactc 555
>gb|AF231653.1| Strongylura senegalensis cytochrome b oxidase (Cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 800 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 536 ttgcattccacttcttactc 555
>gb|AY334395.1| Camponotus americanus isolate Camer00 cytochrome oxidase subunit I (COI) gene, partial cds; tRNA-Leu gene, complete sequence; cytochrome oxidase subunit II (COII) gene, partial cds; tRNA-Lys and tRNA-Asx genes, complete sequence; ATP synthase F0 subunit 8 (ATP8) and ATP synthase F0 subunit 6 (ATP6) genes, complete cds; and cytochrome oxidase subunit III (COIII) gene, partial cds; mitochondrial Length = 3681 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 108 acagcagaaaatcaaataaataag 131 |||| ||||||||||||||||||| Sbjct: 1550 acagaagaaaatcaaataaataag 1573
>gb|AY334385.1| Camponotus sayi isolate Csayi13 cytochrome oxidase subunit I (COI) gene, partial cds; tRNA-Leu gene, complete sequence; cytochrome oxidase subunit II (COII) gene, partial cds; tRNA-Lys and tRNA-Asx genes, complete sequence; ATP synthase F0 subunit 8 (ATP8) and ATP synthase F0 subunit 6 (ATP6) genes, complete cds; and cytochrome oxidase subunit III (COIII) gene, partial cds; mitochondrial Length = 3686 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 108 acagcagaaaatcaaataaataag 131 |||| ||||||||||||||||||| Sbjct: 1538 acagaagaaaatcaaataaataag 1561
>gb|AY327320.1| Noturus stigmosus specimen-voucher INHS88906 cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 1138 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 533 ttgcattccacttcttactc 552
>gb|AY327319.1| Noturus stigmosus specimen-voucher INHS45557 cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 1138 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 533 ttgcattccacttcttactc 552
>gb|AY327318.1| Noturus placidus isolate B specimen-voucher INHS96383 cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 1138 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 533 ttgcattccacttcttactc 552
>gb|AY327317.1| Noturus placidus isolate A specimen-voucher INHS96383 cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 1129 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 524 ttgcattccacttcttactc 543
>gb|AY327310.1| Noturus munitus isolate B specimen-voucher UAIC11701.01 cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 1138 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 533 ttgcattccacttcttactc 552
>gb|AY327309.1| Noturus munitus isolate A specimen-voucher UAIC11701.01 cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 1138 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 533 ttgcattccacttcttactc 552
>gb|AY327283.1| Noturus flavater specimen-voucher UAIC11868.02 cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 1138 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 533 ttgcattccacttcttactc 552
>gb|AC142381.2| Homo sapiens chromosome 16 clone RP11-1166P10, complete sequence Length = 211171 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 agcaaactacagcagaaaat 119 |||||||||||||||||||| Sbjct: 80918 agcaaactacagcagaaaat 80899
>gb|AC142086.3| Homo sapiens chromosome 16 clone RP11-989E6, complete sequence Length = 177574 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 agcaaactacagcagaaaat 119 |||||||||||||||||||| Sbjct: 101952 agcaaactacagcagaaaat 101933
>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence Length = 185902 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 agcagcaggtccagcgggta 455 |||||||||||||||||||| Sbjct: 77592 agcagcaggtccagcgggta 77573
>gb|AC115119.5| Mus musculus BAC clone RP23-87M19 from 18, complete sequence Length = 174491 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 121 aaataaataaggccgattgtgtat 144 |||||||||||||||||| ||||| Sbjct: 9108 aaataaataaggccgattttgtat 9085
>gb|AC163161.4| Mus musculus BAC clone RP23-103A23 from chromosome 6, complete sequence Length = 224416 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 gttgacatttgtttttcatg 25 |||||||||||||||||||| Sbjct: 139520 gttgacatttgtttttcatg 139539
>gb|BC025433.1| Mus musculus cDNA clone IMAGE:5006134, **** WARNING: chimeric clone **** Length = 1060 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 436 agcagcaggtccagcgggta 455 |||||||||||||||||||| Sbjct: 48 agcagcaggtccagcgggta 67
>emb|Z84468.1|HS299D3 Human DNA sequence from clone CTA-299D3 on chromosome 22q13.3, complete sequence Length = 90736 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 tttgtttttcatgaatccaa 32 |||||||||||||||||||| Sbjct: 23838 tttgtttttcatgaatccaa 23819
>gb|AC115090.8| Homo sapiens chromosome 17, clone CTC-861O14, complete sequence Length = 173716 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 100 agcaaactacagcagaaaat 119 |||||||||||||||||||| Sbjct: 71901 agcaaactacagcagaaaat 71920
>gb|AC159300.3| Mus musculus BAC clone RP23-242D23 from chromosome 6, complete sequence Length = 200738 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 gttgacatttgtttttcatg 25 |||||||||||||||||||| Sbjct: 178235 gttgacatttgtttttcatg 178216
>emb|AL606998.3|OSJN00125 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000223_09, complete sequence Length = 120583 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 tttgtttttcatgaatccaa 32 |||||||||||||||||||| Sbjct: 20191 tttgtttttcatgaatccaa 20172
>emb|AL606623.3|OSJN00053 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0081L15, complete sequence Length = 150864 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 tttgtttttcatgaatccaa 32 |||||||||||||||||||| Sbjct: 87004 tttgtttttcatgaatccaa 86985
>gb|AF186101.1| Strongylura senegalensis isolate 39b cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 662 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 421 ttgcattccacttcttactc 440
>gb|AF186100.1| Strongylura senegalensis isolate 39a cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 662 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 421 ttgcattccacttcttactc 440
>gb|AF186098.1| Strongylura timucu isolate 4a cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 659 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 431 ttgcattccacttcttactc 450
>gb|AF243913.1| Strongylura senegalensis isolate N39b cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 541 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 413 ttgcattccacttcttactc 432
>gb|AF243912.1| Strongylura senegalensis isolate N39a cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 541 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 413 ttgcattccacttcttactc 432
>gb|AF243862.1| Strongylura timucu isolate N4a cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 541 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 413 ttgcattccacttcttactc 432
>dbj|AK032168.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length enriched library, clone:6430407A15 product:synbindin, full insert sequence Length = 932 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 agcagcaggtccagcgggta 455 |||||||||||||||||||| Sbjct: 132 agcagcaggtccagcgggta 113
>dbj|AK005276.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500017G03 product:synbindin, full insert sequence Length = 1186 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 agcagcaggtccagcgggta 455 |||||||||||||||||||| Sbjct: 151 agcagcaggtccagcgggta 132
>dbj|AK053710.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130220E24 product:synbindin, full insert sequence Length = 1340 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 agcagcaggtccagcgggta 455 |||||||||||||||||||| Sbjct: 181 agcagcaggtccagcgggta 162
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 tttgtttttcatgaatccaa 32 |||||||||||||||||||| Sbjct: 24197779 tttgtttttcatgaatccaa 24197760
>gb|AC092144.4| Homo sapiens chromosome 16 clone RP11-572L10, complete sequence Length = 186711 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 100 agcaaactacagcagaaaat 119 |||||||||||||||||||| Sbjct: 68204 agcaaactacagcagaaaat 68223
>gb|AC138801.2| Homo sapiens chromosome 16 clone CTD-3129O20, complete sequence Length = 150183 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 agcaaactacagcagaaaat 119 |||||||||||||||||||| Sbjct: 76602 agcaaactacagcagaaaat 76583
>gb|AF233340.1|AF233340 Mus musculus synbindin mRNA, complete cds Length = 1123 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 agcagcaggtccagcgggta 455 |||||||||||||||||||| Sbjct: 323 agcagcaggtccagcgggta 304
>gb|AC129916.6| Homo sapiens chromosome 17, clone RP11-2L19, complete sequence Length = 167265 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 100 agcaaactacagcagaaaat 119 |||||||||||||||||||| Sbjct: 117703 agcaaactacagcagaaaat 117722
>gb|AC006433.18|AC006433 Homo sapiens, clone RP11-6A1, complete sequence Length = 179563 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 233 ccagcacagcccagcacatg 252 |||||||||||||||||||| Sbjct: 169887 ccagcacagcccagcacatg 169906
>gb|AC157891.3| Medicago truncatula chromosome 7 BAC clone mte1-1i2, complete sequence Length = 154095 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 38 gcattttgcacacatgagtgcaaa 61 ||||||||||||||| |||||||| Sbjct: 393 gcattttgcacacataagtgcaaa 370
>gb|AC147219.5| Mus musculus BAC clone RP23-37K18 from 18, complete sequence Length = 183177 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 121 aaataaataaggccgattgtgtat 144 |||||||||||||||||| ||||| Sbjct: 34842 aaataaataaggccgattttgtat 34865
>emb|BX465184.7| Zebrafish DNA sequence from clone DKEY-20N10 in linkage group 20, complete sequence Length = 139351 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 107 tacagcagaaaatcaaataaataa 130 ||||||||||||| |||||||||| Sbjct: 139224 tacagcagaaaattaaataaataa 139201
>emb|BX279523.5| Zebrafish DNA sequence from clone CH211-63O20 in linkage group 20, complete sequence Length = 165073 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 107 tacagcagaaaatcaaataaataa 130 ||||||||||||| |||||||||| Sbjct: 1873 tacagcagaaaattaaataaataa 1850
>gb|AY104810.1| Zea mays PCO125164 mRNA sequence Length = 1091 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 319 cctctccccctcagcacgtc 338 |||||||||||||||||||| Sbjct: 736 cctctccccctcagcacgtc 717
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 354 gcacacgccgttgccgttca 373 |||||||||||||||||||| Sbjct: 1919923 gcacacgccgttgccgttca 1919904
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome Length = 7215267 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 113 agaaaatcaaataaataagg 132 |||||||||||||||||||| Sbjct: 3646007 agaaaatcaaataaataagg 3646026
>gb|DQ119472.1| Bagre marinus cytochrome b and tRNA-Thr genes, partial sequence; mitochondrial Length = 1128 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgcattccacttcttactc 82 |||||||||||||||||||| Sbjct: 501 ttgcattccacttcttactc 520 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,880,099 Number of Sequences: 3902068 Number of extensions: 5880099 Number of successful extensions: 149732 Number of sequences better than 10.0: 59 Number of HSP's better than 10.0 without gapping: 59 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 149465 Number of HSP's gapped (non-prelim): 267 length of query: 471 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 449 effective length of database: 17,147,199,772 effective search space: 7699092697628 effective search space used: 7699092697628 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)