>emb|AL035634.7|HS403L10 Human DNA sequence from clone RP3-403L10 on chromosome 6q25.1-26
            Contains part of the SNX9 gene for sorting nexin 9 (SH3
            and PX domain-containing protein (SH3PX1, SDP1),
            FLJ22984), an HSPE1 (heat shock 10kD protein 1
            (chaperonin 10)) pseudogene and a novel gene, complete
            sequence
          Length = 60215

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 194  aaaatttctaatcaaaagcaa 214
            |||||||||||||||||||||
Sbjct: 4456 aaaatttctaatcaaaagcaa 4436

>gb|AC007391.3| Homo sapiens BAC clone RP11-429J10 from 2, complete sequence
          Length = 183991

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 111   agccatagttcaaatttgcca 131
             |||||||||||||||||||||
Sbjct: 48261 agccatagttcaaatttgcca 48281

>gb|AE008387.1| Streptococcus pneumoniae R6 section 3 of 184 of the complete genome
          Length = 10010

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 26   attactatccacgatcgcaatgac 49
            ||||||||||||||| ||||||||
Sbjct: 4887 attactatccacgatagcaatgac 4910

>gb|AC147673.3| Pan troglodytes BAC clone CH251-13F15 from Y, complete sequence
          Length = 164583

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     gttgtcacatgtttttcatc 22
             ||||||||||||||||||||
Sbjct: 30409 gttgtcacatgtttttcatc 30428

>gb|AC186168.1| Ornithorhynchus anatinus chromosome UNK clone OABb-35C10, complete
             sequence
          Length = 133373

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   aatttgccaactgttcaaaa 142
             ||||||||||||||||||||
Sbjct: 45087 aatttgccaactgttcaaaa 45068

>gb|AC120347.7| Mus musculus chromosome 13, clone RP23-262I3, complete sequence
          Length = 227644

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     accagatggaaggctcacaa 67
              ||||||||||||||||||||
Sbjct: 153411 accagatggaaggctcacaa 153392

>gb|AC118249.11| Mus musculus chromosome 19, clone RP23-397G23, complete sequence
          Length = 224129

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 154    acatgccccaaacataacta 173
              ||||||||||||||||||||
Sbjct: 183253 acatgccccaaacataacta 183234

>gb|AC117809.6| Mus musculus chromosome 19, clone RP24-571N5, complete sequence
          Length = 216153

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   acatgccccaaacataacta 173
             ||||||||||||||||||||
Sbjct: 68025 acatgccccaaacataacta 68006

>gb|AC139192.1| Pan troglodytes BAC clone RP43-44N16 from Y, complete sequence
          Length = 149965

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      gttgtcacatgtttttcatc 22
              ||||||||||||||||||||
Sbjct: 134182 gttgtcacatgtttttcatc 134163

>gb|AC139194.1| Pan troglodytes BAC clone RP43-164C2 from Y, complete sequence
          Length = 182587

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      gttgtcacatgtttttcatc 22
              ||||||||||||||||||||
Sbjct: 103984 gttgtcacatgtttttcatc 103965

>emb|AL662892.11| Mouse DNA sequence from clone RP23-408L15 on chromosome 11 Contains
             part of a novel gene, a novel gene, a SMT3 (supressor of
             mif two, 3) homolog 1 (S. cerevisiae) (Smt3h1) pseudogene
             and a ribosomal protein S12 (Rps12) pseudogene, complete
             sequence
          Length = 106145

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    caaagacatggacagagaaa 93
             ||||||||||||||||||||
Sbjct: 88644 caaagacatggacagagaaa 88625

>dbj|BS000627.2| Pan troglodytes chromosome Y clone: PTB-087E03, complete sequence
          Length = 203922

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      gttgtcacatgtttttcatc 22
              ||||||||||||||||||||
Sbjct: 167137 gttgtcacatgtttttcatc 167118

>dbj|BS000536.1| Pan troglodytes chromosome Y clone:PTB-100K06, complete sequences
          Length = 204391

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      gttgtcacatgtttttcatc 22
              ||||||||||||||||||||
Sbjct: 183525 gttgtcacatgtttttcatc 183544

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 3        gttgtcacatgtttttcatc 22
                ||||||||||||||||||||
Sbjct: 21072524 gttgtcacatgtttttcatc 21072543

>dbj|AK085781.1| Mus musculus 16 days neonate heart cDNA, RIKEN full-length enriched
           library, clone:D830007O09 product:unclassifiable, full
           insert sequence
          Length = 1649

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 48  accagatggaaggctcacaa 67
           ||||||||||||||||||||
Sbjct: 660 accagatggaaggctcacaa 641

>gb|AC010982.5| Homo sapiens BAC clone RP11-475I16 from 2, complete sequence
          Length = 217107

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    tacaaagacatggacagaga 91
             ||||||||||||||||||||
Sbjct: 56060 tacaaagacatggacagaga 56041

>gb|AC006336.4|AC006336 Homo sapiens BAC clone RP11-508K5 from Y, complete sequence
          Length = 95956

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     gttgtcacatgtttttcatc 22
             ||||||||||||||||||||
Sbjct: 34761 gttgtcacatgtttttcatc 34780


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,321,955
Number of Sequences: 3902068
Number of extensions: 3321955
Number of successful extensions: 60976
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60921
Number of HSP's gapped (non-prelim): 55
length of query: 363
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 341
effective length of database: 17,147,199,772
effective search space: 5847195122252
effective search space used: 5847195122252
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)