ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart25e09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC158614.5| Mus musculus 10 BAC RP23-76C5 (Roswell Park Cance... 42 1.3
2emb|AL096755.1|HS477J10A Human DNA sequence from clone RP3-477J1... 42 1.3
3dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 42 1.3
4gb|AE017350.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 5.0
5gb|AC010007.4| Drosophila melanogaster 3L BAC RP98-17K17 (Roswel... 40 5.0
6ref|NM_057340.2| Drosophila melanogaster Protein tyrosine phosph... 40 5.0
7ref|NM_057339.3| Drosophila melanogaster Protein tyrosine phosph... 40 5.0
8emb|AL114088.1|CNS01BDC Botrytis cinerea strain T4 cDNA library 40 5.0
9gb|AE003471.3| Drosophila melanogaster chromosome 3L, section 5 ... 40 5.0
10gb|AC005847.1|AC005847 Drosophila melanogaster DNA sequence (P1s... 40 5.0
11gb|L11249.1|DROPTP01 D.melanogaster protein tyrosine phosphatase... 40 5.0
12gb|L11253.1|DROPTPB D.melanogaster protein tyrosine phosphatase ... 40 5.0
13gb|L11252.1|DROPTPA D.melanogaster protein tyrosine phosphatase ... 40 5.0

>gb|AC158614.5| Mus musculus 10 BAC RP23-76C5 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 223468

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    gagctttcttcttccatcata 32
             |||||||||||||||||||||
Sbjct: 60941 gagctttcttcttccatcata 60921



to top

>emb|AL096755.1|HS477J10A Human DNA sequence from clone RP3-477J10 on chromosome 22q13.31-13.33,
             complete sequence
          Length = 96678

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 336   actctgggctgctgcgggctc 356
             |||||||||||||||||||||
Sbjct: 13741 actctgggctgctgcgggctc 13721



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 232     ccggcgctggcgctctatcgg 252
               |||||||||||||||||||||
Sbjct: 2788646 ccggcgctggcgctctatcgg 2788626



to top

>gb|AE017350.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 10, complete
              sequence
          Length = 1085720

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     gctttcttcttccatcataa 33
              ||||||||||||||||||||
Sbjct: 219048 gctttcttcttccatcataa 219029



to top

>gb|AC010007.4| Drosophila melanogaster 3L BAC RP98-17K17 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 175481

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagtgcgataccgagtga 273
              ||||||||||||||||||||
Sbjct: 131258 tgcagtgcgataccgagtga 131277



to top

>ref|NM_057340.2| Drosophila melanogaster Protein tyrosine phosphatase 61F CG9181-RB,
           transcript variant B (Ptp61F), mRNA
          Length = 1904

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 tgcagtgcgataccgagtga 273
           ||||||||||||||||||||
Sbjct: 39  tgcagtgcgataccgagtga 20



to top

>ref|NM_057339.3| Drosophila melanogaster Protein tyrosine phosphatase 61F CG9181-RA,
           transcript variant A (Ptp61F), mRNA
          Length = 2556

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 tgcagtgcgataccgagtga 273
           ||||||||||||||||||||
Sbjct: 39  tgcagtgcgataccgagtga 20



to top

>emb|AL114088.1|CNS01BDC Botrytis cinerea strain T4 cDNA library
          Length = 446

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 16  tttcttcttccatcataaca 35
           ||||||||||||||||||||
Sbjct: 332 tttcttcttccatcataaca 313



to top

>gb|AE003471.3| Drosophila melanogaster chromosome 3L, section 5 of 83 of the complete
              sequence
          Length = 302131

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagtgcgataccgagtga 273
              ||||||||||||||||||||
Sbjct: 118000 tgcagtgcgataccgagtga 118019



to top

>gb|AC005847.1|AC005847 Drosophila melanogaster DNA sequence (P1s DS03179 (D226), DS06357
             (D230), DS03404 (D231), DS06962 (D232), and DS07291
             (D240)), complete sequence
          Length = 268369

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagtgcgataccgagtga 273
             ||||||||||||||||||||
Sbjct: 94408 tgcagtgcgataccgagtga 94389



to top

>gb|L11249.1|DROPTP01 D.melanogaster protein tyrosine phosphatase gene, exon 1
          Length = 314

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 tgcagtgcgataccgagtga 273
           ||||||||||||||||||||
Sbjct: 40  tgcagtgcgataccgagtga 21



to top

>gb|L11253.1|DROPTPB D.melanogaster protein tyrosine phosphatase mRNA, complete cds
          Length = 2165

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 tgcagtgcgataccgagtga 273
           ||||||||||||||||||||
Sbjct: 40  tgcagtgcgataccgagtga 21



to top

>gb|L11252.1|DROPTPA D.melanogaster protein tyrosine phosphatase mRNA, complete cds
          Length = 1906

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 tgcagtgcgataccgagtga 273
           ||||||||||||||||||||
Sbjct: 40  tgcagtgcgataccgagtga 21


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,409,224
Number of Sequences: 3902068
Number of extensions: 2409224
Number of successful extensions: 39576
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39540
Number of HSP's gapped (non-prelim): 36
length of query: 377
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 355
effective length of database: 17,147,199,772
effective search space: 6087255919060
effective search space used: 6087255919060
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top