ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart25b06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_636448.1| Dictyostelium discoideum hypothetical protein (... 44 0.38
2ref|XM_662698.1| Cryptosporidium hominis TU502 hypothetical prot... 44 0.38
3emb|AL359987.13| Human DNA sequence from clone RP11-596A13 on ch... 44 0.38
4ref|XM_626537.1| Cryptosporidium parvum Iowa II hypothetical pro... 44 0.38
5emb|AL805981.11| Mouse DNA sequence from clone RP23-275G4 on chr... 44 0.38
6gb|AC004875.2| Homo sapiens PAC clone RP4-745K6 from 7, complete... 42 1.5
7emb|AL353730.13| Human DNA sequence from clone RP11-55P9 on chro... 42 1.5
8gb|AC157350.29| Medicago truncatula clone mth2-143n6, complete s... 42 1.5
9gb|AC145960.3| Gallus gallus BAC clone CH261-18H1 from chromosom... 42 1.5
10ref|XM_365611.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 5.9
11gb|AC166993.4| Mus musculus BAC clone RP23-467D18 from chromosom... 40 5.9
12gb|AC164554.2| Mus musculus BAC clone RP23-351O14 from chromosom... 40 5.9
13gb|DQ483809.1| Gymnogyps californianus clone 232F microsatellite... 40 5.9
14gb|AC099615.6| Mus musculus chromosome 1, clone RP23-412G3, comp... 40 5.9
15gb|AC007031.2| Homo sapiens BAC clone RP11-17I10 from 7, complet... 40 5.9
16gb|AC004109.1| Homo sapiens PAC clone RP4-608H12 from 7, complet... 40 5.9
17gb|AC005013.3| Homo sapiens BAC clone GS1-165L15 from 7, complet... 40 5.9
18emb|AL109630.2|DMBR7A4 Drosophila melanogaster BAC clone BACR7A4 40 5.9
19emb|AL662815.13| Mouse DNA sequence from clone RP23-361M22 on ch... 40 5.9
20gb|AC097726.4| Drosophila melanogaster X BAC RP98-5N14 (Roswell ... 40 5.9
21gb|AC106879.4| Homo sapiens BAC clone RP11-674B11 from 4, comple... 40 5.9
22emb|BX005406.8| Zebrafish DNA sequence from clone CH211-169P10 i... 40 5.9
23gb|AE003419.2| Drosophila melanogaster chromosome X, section 3 o... 40 5.9
24emb|CT009630.16| Mouse DNA sequence from clone RP23-12B13 on chr... 40 5.9

>ref|XM_636448.1| Dictyostelium discoideum hypothetical protein (DDB0206021), partial
            mRNA
          Length = 2448

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 91   ttttcattacagttattatcat 112
            ||||||||||||||||||||||
Sbjct: 2408 ttttcattacagttattatcat 2387



to top

>ref|XM_662698.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.20371)
            partial mRNA
          Length = 2118

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 169  aataatcatctcacaacatata 190
            ||||||||||||||||||||||
Sbjct: 1189 aataatcatctcacaacatata 1210



to top

>emb|AL359987.13| Human DNA sequence from clone RP11-596A13 on chromosome 6, complete
              sequence
          Length = 189370

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 89     atttttcattacagttattatcatca 114
              |||||||||||||||| |||||||||
Sbjct: 132972 atttttcattacagtttttatcatca 132947



to top

>ref|XM_626537.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd2_3500),
            partial mRNA
          Length = 2115

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 169  aataatcatctcacaacatata 190
            ||||||||||||||||||||||
Sbjct: 1192 aataatcatctcacaacatata 1213



to top

>emb|AL805981.11| Mouse DNA sequence from clone RP23-275G4 on chromosome 4, complete
              sequence
          Length = 210185

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 357    ggatggagcatgttttgatgtgttcg 382
              |||||||| |||||||||||||||||
Sbjct: 153451 ggatggagaatgttttgatgtgttcg 153476



to top

>gb|AC004875.2| Homo sapiens PAC clone RP4-745K6 from 7, complete sequence
          Length = 130607

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 89     atttttcattacagttattat 109
              |||||||||||||||||||||
Sbjct: 103717 atttttcattacagttattat 103737



to top

>emb|AL353730.13| Human DNA sequence from clone RP11-55P9 on chromosome 9, complete
             sequence
          Length = 147810

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 128   atatttggtggagggcaacaa 148
             |||||||||||||||||||||
Sbjct: 95080 atatttggtggagggcaacaa 95100



to top

>gb|AC157350.29| Medicago truncatula clone mth2-143n6, complete sequence
          Length = 131960

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   tgaatgtgattacaagttggg 307
             |||||||||||||||||||||
Sbjct: 87420 tgaatgtgattacaagttggg 87440



to top

>gb|AC145960.3| Gallus gallus BAC clone CH261-18H1 from chromosome unknown, complete
              sequence
          Length = 204548

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 360    tggagcatgttttgatgtgtt 380
              |||||||||||||||||||||
Sbjct: 102329 tggagcatgttttgatgtgtt 102309



to top

>ref|XM_365611.1| Magnaporthe grisea 70-15 hypothetical protein (MG02313.4) partial
            mRNA
          Length = 11166

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 338  cacaaggaaatctggaaacggatg 361
            |||||||||||||||||| |||||
Sbjct: 8800 cacaaggaaatctggaaaaggatg 8823



to top

>gb|AC166993.4| Mus musculus BAC clone RP23-467D18 from chromosome 17, complete sequence
          Length = 199776

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 169    aataatcatctcacaacata 188
              ||||||||||||||||||||
Sbjct: 167861 aataatcatctcacaacata 167880



to top

>gb|AC164554.2| Mus musculus BAC clone RP23-351O14 from chromosome 17, complete sequence
          Length = 192632

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 169    aataatcatctcacaacata 188
              ||||||||||||||||||||
Sbjct: 139554 aataatcatctcacaacata 139535



to top

>gb|DQ483809.1| Gymnogyps californianus clone 232F microsatellite sequence
          Length = 815

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  tttttcattacagttattat 109
           ||||||||||||||||||||
Sbjct: 435 tttttcattacagttattat 416



to top

>gb|AC099615.6| Mus musculus chromosome 1, clone RP23-412G3, complete sequence
          Length = 204191

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 193   cacaatcaactagacacagt 212
             ||||||||||||||||||||
Sbjct: 68932 cacaatcaactagacacagt 68913



to top

>gb|AC007031.2| Homo sapiens BAC clone RP11-17I10 from 7, complete sequence
          Length = 47042

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 89    atttttcattacagttatta 108
             ||||||||||||||||||||
Sbjct: 15754 atttttcattacagttatta 15773



to top

>gb|AC004109.1| Homo sapiens PAC clone RP4-608H12 from 7, complete sequence
          Length = 69201

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    attcagaatatcatccagga 81
             ||||||||||||||||||||
Sbjct: 10422 attcagaatatcatccagga 10403



to top

>gb|AC005013.3| Homo sapiens BAC clone GS1-165L15 from 7, complete sequence
          Length = 195917

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   taatcatctcacaacatata 190
             ||||||||||||||||||||
Sbjct: 94247 taatcatctcacaacatata 94228



to top

>emb|AL109630.2|DMBR7A4 Drosophila melanogaster BAC clone BACR7A4
          Length = 212370

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 341   aaggaaatctggaaacggat 360
             ||||||||||||||||||||
Sbjct: 35189 aaggaaatctggaaacggat 35208



to top

>emb|AL662815.13| Mouse DNA sequence from clone RP23-361M22 on chromosome 1 Contains part
             of the gene for ortholog of human amyotrophic lateral
             sclerosis 2 (juvenile) chromosome region candidate 19
             (ALS2CR19) and a novel gene, complete sequence
          Length = 155204

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 193   cacaatcaactagacacagt 212
             ||||||||||||||||||||
Sbjct: 24614 cacaatcaactagacacagt 24633



to top

>gb|AC097726.4| Drosophila melanogaster X BAC RP98-5N14 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 146717

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 341   aaggaaatctggaaacggat 360
             ||||||||||||||||||||
Sbjct: 35559 aaggaaatctggaaacggat 35578



to top

>gb|AC106879.4| Homo sapiens BAC clone RP11-674B11 from 4, complete sequence
          Length = 121163

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    tatcatccaggaaacaacca 89
             ||||||||||||||||||||
Sbjct: 17552 tatcatccaggaaacaacca 17571



to top

>emb|BX005406.8| Zebrafish DNA sequence from clone CH211-169P10 in linkage group 8,
            complete sequence
          Length = 132872

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 86   accatttttcattacagtta 105
            ||||||||||||||||||||
Sbjct: 8185 accatttttcattacagtta 8204



to top

>gb|AE003419.2| Drosophila melanogaster chromosome X, section 3 of 74 of the complete
             sequence
          Length = 306598

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 341   aaggaaatctggaaacggat 360
             ||||||||||||||||||||
Sbjct: 11886 aaggaaatctggaaacggat 11905



to top

>emb|CT009630.16| Mouse DNA sequence from clone RP23-12B13 on chromosome 17, complete
             sequence
          Length = 240447

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 169   aataatcatctcacaacata 188
             ||||||||||||||||||||
Sbjct: 43311 aataatcatctcacaacata 43330


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,762,155
Number of Sequences: 3902068
Number of extensions: 3762155
Number of successful extensions: 79673
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79630
Number of HSP's gapped (non-prelim): 43
length of query: 440
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 418
effective length of database: 17,147,199,772
effective search space: 7167529504696
effective search space used: 7167529504696
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top