ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart25b03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 498 e-137
2gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 353 4e-94
3emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 167 4e-38
4ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 143 6e-31
5dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 6e-31
6dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 143 6e-31
7gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 139 1e-29
8gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 139 1e-29
9gb|AY103580.1| Zea mays PCO072544 mRNA sequence 139 1e-29
10gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 133 6e-28
11gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 129 9e-27
12gb|AY107675.1| Zea mays PCO112712 mRNA sequence 129 9e-27
13emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 125 1e-25
14gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 121 2e-24
15gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 121 2e-24
16ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 119 9e-24
17dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 9e-24
18dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 9e-24
19dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 9e-24
20dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 9e-24
21emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 117 4e-23
22ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 115 1e-22
23gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 115 1e-22
24dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
25dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
26dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
27dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
28dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 113 6e-22
29dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 113 6e-22
30dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 113 6e-22
31dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 113 6e-22
32gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 111 2e-21
33gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 111 2e-21
34gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 111 2e-21
35gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 111 2e-21
36dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 109 9e-21
37gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 107 3e-20
38emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 107 3e-20
39gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 107 3e-20
40dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
41dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
42dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
43gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 107 3e-20
44dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 107 3e-20
45gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 103 5e-19
46gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 103 5e-19
47gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 103 5e-19
48gb|AY109332.1| Zea mays CL502_5 mRNA sequence 103 5e-19
49dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 101 2e-18
50ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 100 8e-18
51ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 100 8e-18
52ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 100 8e-18
53ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 100 8e-18
54gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 100 8e-18
55dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
56dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
57dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
58dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
59dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
60dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 8e-18
61gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 100 8e-18
62gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 100 8e-18
63gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 98 3e-17
64ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 96 1e-16
65ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 96 1e-16
66emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 96 1e-16
67dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 96 1e-16
68dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
69dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
70dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
71dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
72gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 92 2e-15
73gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 90 8e-15
74gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 88 3e-14
75emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major... 86 1e-13
76emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 86 1e-13
77gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 86 1e-13
78dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 84 5e-13
79emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 80 8e-12
80dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 80 8e-12
81emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 78 3e-11
82gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 78 3e-11
83dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 76 1e-10
84ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 72 2e-09
85gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 72 2e-09
86gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 72 2e-09
87dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
88gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 70 8e-09
89gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 70 8e-09
90gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 70 8e-09
91gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co... 70 8e-09
92gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 70 8e-09
93ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 68 3e-08
94ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 68 3e-08
95emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 68 3e-08
96emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 68 3e-08
97gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 68 3e-08
98gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 68 3e-08
99emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
100dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
101dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
102dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
103gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 68 3e-08
104gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 66 1e-07
105gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 66 1e-07
106dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 64 5e-07
107dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 64 5e-07
108dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 5e-07
109dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D... 64 5e-07
110ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 62 2e-06
111ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA 62 2e-06
112gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1... 62 2e-06
113gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 62 2e-06
114ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA 62 2e-06
115gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, compl... 62 2e-06
116gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 62 2e-06
117gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:1290... 62 2e-06
118dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 62 2e-06
119gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocula... 62 2e-06
120gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 62 2e-06
121emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
122emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
123emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
124emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
125gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 62 2e-06
126dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
127dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
128gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 m... 62 2e-06
129dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ... 62 2e-06
130gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 60 7e-06
131emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 60 7e-06
132dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane in... 60 7e-06
133gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl... 60 7e-06
134gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrins... 60 7e-06
135gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot... 58 3e-05
136emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 58 3e-05
137gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 58 3e-05
138gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 58 3e-05
139gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 56 1e-04
140gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr... 56 1e-04
141emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 56 1e-04
142gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 56 1e-04
143dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 56 1e-04
144dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
145dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 56 1e-04
146gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 56 1e-04
147dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ... 56 1e-04
148ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3... 54 5e-04
149ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 54 5e-04
150gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 54 5e-04
151emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 54 5e-04
152emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 54 5e-04
153emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 54 5e-04
154emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 54 5e-04
155gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno... 54 5e-04
156dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
157emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
158emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
159emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
160emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
161emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
162emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
163emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
164dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 54 5e-04
165gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s... 54 5e-04
166dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 5e-04
167gb|AF440271.1| Nicotiana tabacum aquaporin (NtPIP1;1) mRNA, comp... 54 5e-04
168gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 54 5e-04
169emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 54 5e-04
170dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote... 54 5e-04
171ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37... 52 0.002
172gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 52 0.002
173gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 52 0.002
174gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds 52 0.002
175gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 52 0.002
176gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (... 52 0.002
177emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins... 52 0.002
178gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m... 52 0.002
179gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s... 52 0.002
180gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 52 0.002
181dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran... 52 0.002
182gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 52 0.002
183gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 52 0.002
184gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 52 0.002
185gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 52 0.002
186dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote... 52 0.002
187ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR... 50 0.007
188gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic p... 50 0.007
189gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 50 0.007
190emb|BX842573.1| Mycobacterium tuberculosis H37Rv complete genome... 50 0.007
191emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 50 0.007
192emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 50 0.007
193gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr... 50 0.007
194gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein ... 50 0.007
195gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr... 50 0.007
196gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ... 50 0.007
197gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr... 50 0.007
198emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co... 50 0.007
199emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co... 50 0.007
200emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co... 50 0.007
201emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co... 50 0.007
202gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se... 50 0.007
203dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds 50 0.007
204gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin... 50 0.007
205gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel... 50 0.007
206gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins... 50 0.007
207dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 50 0.007
208gb|AY489268.1| Physcomitrella patens aquaporin PIP 2 mRNA, compl... 48 0.028
209ref|XM_606158.2| PREDICTED: Bos taurus similar to aquaporin 6 (L... 48 0.028
210emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1 48 0.028
211gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic ... 48 0.028
212gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 48 0.028
213gb|M97477.1|PEAALDIB Pisum sativum L. aldolase gene, 3' end cds 48 0.028
214dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane ... 48 0.028
215gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 46 0.11
216gb|AC092193.4| Bos taurus clone RP42-459A17, complete sequence 46 0.11
217ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood g... 46 0.11
218ref|NM_007472.1| Mus musculus aquaporin 1 (Aqp1), mRNA 46 0.11
219gb|BT014251.1| Lycopersicon esculentum clone 133453R, mRNA sequence 46 0.11
220gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence 46 0.11
221gb|AY585335.1| Sus scrofa aquaporin-1 (AQP1) mRNA, complete cds 46 0.11
222gb|BC007125.1| Mus musculus aquaporin 1, mRNA (cDNA clone MGC:56... 46 0.11
223ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1),... 46 0.11
224emb|X67948.1|RNCHIP28 R.norvegicus mRNA for channel integral mem... 46 0.11
225emb|X70257.1|RNCHIP28K R.norvegicus mRNA for channel integral pr... 46 0.11
226emb|X71069.1|RNCHIPA R.norvegicus CHIP 28 mRNA 46 0.11
227emb|BX572597.1| Rhodopseudomonas palustris CGA009 complete genom... 46 0.11
228emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial 46 0.11
229emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ... 46 0.11
230dbj|AK128905.1| Mus musculus cDNA fis, clone TRACH2020336, highl... 46 0.11
231ref|NM_012778.1| Rattus norvegicus aquaporin 1 (Aqp1), mRNA 46 0.11
232dbj|AK158226.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 46 0.11
233gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 46 0.11
234dbj|AK172361.1| Mus musculus activated spleen cDNA, RIKEN full-l... 46 0.11
235dbj|AK158389.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 46 0.11
236dbj|AK157333.1| Mus musculus activated spleen cDNA, RIKEN full-l... 46 0.11
237dbj|AK166280.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD... 46 0.11
238dbj|AK171627.1| Mus musculus activated spleen cDNA, RIKEN full-l... 46 0.11
239dbj|AK081886.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 46 0.11
240dbj|AK086688.1| Mus musculus 15 days embryo head cDNA, RIKEN ful... 46 0.11
241ref|NM_214454.1| Sus scrofa aquaporin 1 (AQP1), mRNA 46 0.11
242gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-... 46 0.11
243gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 46 0.11
244gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 46 0.11
245gb|BC090068.1| Rattus norvegicus aquaporin 1, mRNA (cDNA clone M... 46 0.11
246gb|L02914.1|MUSGROEARB Mus musculus aquaporin-1 (AQ1) mRNA, comp... 46 0.11
247gb|L07268.1|RATCHIP28A Rattus norvegicus water channel (CHIP28) ... 46 0.11
248gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com... 46 0.11
249dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, p... 46 0.11
250dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, c... 46 0.11
251ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe... 44 0.43
252ref|XM_519026.1| PREDICTED: Pan troglodytes aquaporin 1 (LOC4633... 44 0.43
253ref|NM_198098.1| Homo sapiens aquaporin 1 (Colton blood group) (... 44 0.43
254gb|AY312581.1| Homo sapiens aquaporin 1 splice variant 3 (AQP1) ... 44 0.43
255gb|AY312580.1| Homo sapiens aquaporin 1 splice variant 2 (AQP1) ... 44 0.43
256gb|AC153004.18| Medicago truncatula clone mth2-101j9, complete s... 44 0.43
257gb|AC138580.19| Medicago truncatula clone mth2-14e15, complete s... 44 0.43
258gb|BC022486.1| Homo sapiens aquaporin 1 (Colton blood group), mR... 44 0.43
259gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrin... 44 0.43
260gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)... 44 0.43
261gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote... 44 0.43
262gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote... 44 0.43
263emb|CR859936.1| Pongo pygmaeus mRNA; cDNA DKFZp469G0320 (from cl... 44 0.43
264emb|CR617260.1| full-length cDNA clone CS0DI057YC23 of Placenta ... 44 0.43
265gb|AF480415.1| Homo sapiens aquaporin 1 (AQP1) gene, partial cds 44 0.43
266gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 44 0.43
267gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P... 44 0.43
268gb|U41518.1|HSU41518 Human channel-like integral membrane protei... 44 0.43
269gb|S73482.1| uterine water channel=28 kda erythrocyte integral m... 44 0.43
270gb|AY034596.1| Macaca radiata aquaporin 1 mRNA, partial cds 44 0.43
271emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co... 44 0.43
272gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 44 0.43
273dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 44 0.43
274dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in... 44 0.43
275gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s... 44 0.43
276gb|AC155942.6| Mus musculus 10 BAC RP24-492L7 (Roswell Park Canc... 44 0.43
277gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 44 0.43
278gb|U41517.1|HSU41517 Human channel-like integral membrane protei... 44 0.43
279gb|AD000007.1|MSGY414A Mycobacterium tuberculosis sequence from ... 44 0.43
280gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com... 44 0.43
281gb|M77829.1|HUMCHIP28A Human channel-like integral membrane prot... 44 0.43
282ref|NM_127238.2| Arabidopsis thaliana PIP2;8/PIP3B; water channe... 42 1.7
283gb|AC153156.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 42 1.7
284ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.7
285ref|NM_053924.1| Rattus norvegicus ATP-binding cassette, sub-fam... 42 1.7
286gb|AC104706.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
287gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence 42 1.7
288gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic... 42 1.7
289gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 1.7
290gb|CP000238.1| Baumannia cicadellinicola str. Hc (Homalodisca co... 42 1.7
291emb|CR702474.2|CNS0G4ZA Tetraodon nigroviridis full-length cDNA 42 1.7
292emb|CR702005.2|CNS0G4M9 Tetraodon nigroviridis full-length cDNA 42 1.7
293emb|CR701878.2|CNS0G4IQ Tetraodon nigroviridis full-length cDNA 42 1.7
294emb|CR700458.2|CNS0G3FA Tetraodon nigroviridis full-length cDNA 42 1.7
295emb|CR698963.2|CNS0G29R Tetraodon nigroviridis full-length cDNA 42 1.7
296emb|CR697642.2|CNS0G192 Tetraodon nigroviridis full-length cDNA 42 1.7
297emb|CR696608.2|CNS0G0GC Tetraodon nigroviridis full-length cDNA 42 1.7
298emb|CR694961.2|CNS0FZ6L Tetraodon nigroviridis full-length cDNA 42 1.7
299emb|CR693847.2|CNS0FYBN Tetraodon nigroviridis full-length cDNA 42 1.7
300emb|CR693583.2|CNS0FY4B Tetraodon nigroviridis full-length cDNA 42 1.7
301emb|CR693474.2|CNS0FY1A Tetraodon nigroviridis full-length cDNA 42 1.7
302emb|CR690780.2|CNS0FVYG Tetraodon nigroviridis full-length cDNA 42 1.7
303emb|CR689984.2|CNS0FVCC Tetraodon nigroviridis full-length cDNA 42 1.7
304emb|CR686426.2|CNS0FSLI Tetraodon nigroviridis full-length cDNA 42 1.7
305emb|CR685561.2|CNS0FRXH Tetraodon nigroviridis full-length cDNA 42 1.7
306emb|CR685520.2|CNS0FRWC Tetraodon nigroviridis full-length cDNA 42 1.7
307emb|CR684429.2|CNS0FR21 Tetraodon nigroviridis full-length cDNA 42 1.7
308gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 42 1.7
309emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 42 1.7
310gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 42 1.7
311emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 42 1.7
312emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for... 42 1.7
313emb|BX537273.16| Zebrafish DNA sequence from clone CH211-151F2 i... 42 1.7
314gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 42 1.7
315gb|AC116631.6| Homo sapiens BAC clone RP11-429B11 from 4, comple... 42 1.7
316ref|NM_176253.1| Drosophila melanogaster CG17664-RB, transcript ... 42 1.7
317ref|NM_137967.2| Drosophila melanogaster CG17664-RA, transcript ... 42 1.7
318gb|AF218774.1|AF218774 Lycopersicon esculentum putative water ch... 42 1.7
319dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
320dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
321gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, r... 42 1.7
322gb|BT005214.1| Arabidopsis thaliana At2g16850 mRNA, complete cds 42 1.7
323gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 42 1.7
324gb|AY069151.1| Drosophila melanogaster GH16993 full insert cDNA 42 1.7
325gb|AY089124.1| Arabidopsis thaliana clone 36296 mRNA, complete s... 42 1.7
326dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
327emb|CR361565.8| Zebrafish DNA sequence from clone CH211-242L1 in... 42 1.7
328gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69... 42 1.7
329gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA... 42 1.7
330emb|BX005014.5| Zebrafish DNA sequence from clone CH211-103E2 in... 42 1.7
331gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 42 1.7
332gb|U18403.1|ACU18403 Atriplex canescens aquaporin mRNA, complete... 42 1.7
333dbj|AB020209.1| Rattus norvegicus mRNA for multidrug resistance ... 42 1.7
334ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr... 40 6.8
335ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0... 40 6.8
336ref|XM_476112.1| Oryza sativa (japonica cultivar-group), predic... 40 6.8
337gb|AC167665.2| Culex pipiens quinquefasciatus, clone Culex pipie... 40 6.8
338gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 6.8
339gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 6.8
340gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 40 6.8
341gb|AC130732.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.8
342gb|AC144736.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.8
343gb|AC167201.6| Mus musculus 10 BAC RP23-402J11 (Roswell Park Can... 40 6.8
344gb|AC166171.2| Mus musculus BAC clone RP23-136L14 from chromosom... 40 6.8
345gb|AC117081.2| Dictyostelium discoideum chromosome 2 map 5862124... 40 6.8
346gb|AC122907.4| Mus musculus BAC clone RP23-49I4 from chromosome ... 40 6.8
347emb|X62873.1|PVTIP P.vulgaris mRNA for tonoplast intrinsic protein 40 6.8
348gb|AC160125.2| Mus musculus BAC clone RP23-317M11 from chromosom... 40 6.8
349gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 40 6.8
350gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int... 40 6.8
351emb|Y17691.1|XCT17691 Xanthomonas campestris Tn5044 transposon 40 6.8
352emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 40 6.8
353emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 40 6.8
354emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans... 40 6.8
355gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int... 40 6.8
356emb|BX511098.5| Zebrafish DNA sequence from clone CH211-202L3 in... 40 6.8
357gb|AC104511.5| Drosophila melanogaster X BAC RP98-39D14 (Roswell... 40 6.8
358gb|AE005860.1| Caulobacter crescentus CB15 section 186 of 359 of... 40 6.8
359gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int... 40 6.8
360emb|BX323601.6| Zebrafish DNA sequence from clone RP71-14P11, co... 40 6.8
361gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds 40 6.8
362gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 6.8
363emb|BX004760.10| Zebrafish DNA sequence from clone CH211-222O4 i... 40 6.8
364emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co... 40 6.8
365emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co... 40 6.8
366gb|AC011763.6|AC011763 Drosophila melanogaster, chromosome 3R, r... 40 6.8
367gb|AC160029.3| Mus musculus 10 BAC RP24-105I7 (Roswell Park Canc... 40 6.8
368gb|AC155299.2| Mus musculus BAC clone RP24-229D17 from chromosom... 40 6.8
369gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 6.8
370gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 40 6.8
371gb|AC061957.3|F22L4 Sequence of BAC F22L4 from Arabidopsis thali... 40 6.8
372dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 6.8
373dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 6.8
374emb|AL929213.5| Zebrafish DNA sequence from clone CH211-144A19, ... 40 6.8
375dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei... 40 6.8
376dbj|AK110599.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.8
377dbj|AK110596.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.8
378emb|BX255893.5| Zebrafish DNA sequence from clone CH211-272H10 i... 40 6.8
379gb|AY107589.1| Zea mays PCO085320 mRNA sequence 40 6.8
380gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic ... 40 6.8
381gb|AE003717.2| Drosophila melanogaster chromosome 3R, section 55... 40 6.8
382gb|AE003491.4| Drosophila melanogaster chromosome X, section 43 ... 40 6.8
383emb|CT030124.12| Mouse DNA sequence from clone RP23-100B15 on ch... 40 6.8
384dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ... 40 6.8
385emb|BX005187.9| Mouse DNA sequence from clone RP23-187O10 on chr... 40 6.8
386gb|AC144628.3| Mus musculus BAC clone RP23-463L22 from 14, compl... 40 6.8
387gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 40 6.8
388gb|AC127297.4| Mus musculus BAC clone RP23-395B13 from chromosom... 40 6.8
389dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 40 6.8
390dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquapo... 40 6.8

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  498 bits (251), Expect = e-137
 Identities = 251/251 (100%)
 Strand = Plus / Minus

                                                                        
Query: 251  atgatcggtcgacgatgaacagcgataagattccatccatggccgcccagactgattggt 310
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1019 atgatcggtcgacgatgaacagcgataagattccatccatggccgcccagactgattggt 960

                                                                        
Query: 311  ccactagccgcggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgc 370
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 959  ccactagccgcggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgc 900

                                                                        
Query: 371  cagcgccgcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgctt 430
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 899  cagcgccgcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgctt 840

                                                                        
Query: 431  cttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 839  cttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 780

                       
Query: 491  ggggatcgtcg 501
            |||||||||||
Sbjct: 779  ggggatcgtcg 769



 Score =  428 bits (216), Expect = e-117
 Identities = 226/228 (99%), Gaps = 1/228 (0%)
 Strand = Plus / Minus

                                                                        
Query: 7    ttaataataatttacatacatatgcacgctggattaaatggcgtgcgtggtactggtaca 66
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1264 ttaataataatttacatacatatgcacgctggattaaatggcgtgcgtggtactggtaca 1205

                                                                        
Query: 67   atgcaaaaggtagggaaagtagtacagcaggtactatactgactgaaactcgcagacttg 126
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1204 atgcaaaaggtagggaaagtagtacagcaggtactatactgactgaaactcgcagacttg 1145

                                                                        
Query: 127  aacaggcgacgctgccggcgggcacacacaccgaggagagacggcagatttgagaactat 186
            ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1144 aacaggcgacgctgccggcaggcacacacaccgaggagagacggcagatttgagaactat 1085

                                                            
Query: 187  tacagcgtgcgcggccgagacacgatccacg-tacgcgcgcaccagca 233
            ||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 1084 tacagcgtgcgcggccgagacacgatccacgttacgcgcgcaccagca 1037



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score =  353 bits (178), Expect = 4e-94
 Identities = 237/255 (92%), Gaps = 5/255 (1%)
 Strand = Plus / Minus

                                                                        
Query: 251  atgatcggtcgacgatgaacagcgataagattcca----tccatggccgcccagactgat 306
            ||||||| |||||||||||||||||||||||||||    ||||||| || | ||||||||
Sbjct: 1007 atgatcgatcgacgatgaacagcgataagattccacccgtccatggtcggc-agactgat 949

                                                                        
Query: 307  tggtccactagccgcggctcttgaaggggatcgccctgatcaccaccacgtggtagatcg 366
            |||   ||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 948  tggctgactagtcgcggctcttgaaggggatggccctgatcaccaccacgtggtagatgg 889

                                                                        
Query: 367  ccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcct 426
            ||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 888  ccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtcgtcccacgcct 829

                                                                        
Query: 427  gcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccg 486
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 828  gcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtccccg 769

                           
Query: 487  tgatggggatcgtcg 501
            |||||||||||||||
Sbjct: 768  tgatggggatcgtcg 754



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 48/53 (90%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                 
Query: 2    ccttcttaat-aataatttacatacatatgcacgctggattaaatggcgtgcg 53
            |||||||||| |||||||||||||||||||||||||   |||||| |||||||
Sbjct: 1229 ccttcttaattaataatttacatacatatgcacgctccgttaaatcgcgtgcg 1177



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 134  gacgctgccggcgggcacacacaccgaggagag 166
            ||||||| |||| ||||||||||||||||||||
Sbjct: 1111 gacgctgtcggcaggcacacacaccgaggagag 1079



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 113  aactcgcagacttgaacagg 132
            ||||||||||||||||||||
Sbjct: 1142 aactcgcagacttgaacagg 1123



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  167 bits (84), Expect = 4e-38
 Identities = 150/172 (87%)
 Strand = Plus / Minus

                                                                       
Query: 325 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 384
           ||||||| |||||||| ||||| ||||||  ||||||||| || |||||||| |||||||
Sbjct: 926 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 867

                                                                       
Query: 385 tgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 444
           |||| || || ||||||||||||||||||||   ||| || |||| | ||||||||||||
Sbjct: 866 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 807

                                                               
Query: 445 tggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||| |||||||||  |||||||||||||||||||||||| |||||||||||
Sbjct: 806 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggat 755



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                        
Query: 321  cggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcg 380
            ||||||||||||||||| || ||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 1012 cggctcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgct 953

                                                                        
Query: 381  ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
            ||||||||||| || |||||||| ||||||||||||| ||| || ||      ||| |||
Sbjct: 952  ccgatgaacggaccaacccagaaaatccagtggtcgtgccatgcgtgggcgcggttatag 893

                                                                    
Query: 441  atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
            | ||||||||||||||||   |  || ||||||||||||||||| |||||||||||
Sbjct: 892  acgatggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggat 837



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
            insert sequence
          Length = 1318

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                        
Query: 321  cggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcg 380
            ||||||||||||||||| || ||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 1011 cggctcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgct 952

                                                                        
Query: 381  ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
            ||||||||||| || |||||||| ||||||||||||| ||| || ||      ||| |||
Sbjct: 951  ccgatgaacggaccaacccagaaaatccagtggtcgtgccatgcgtgggcgcggttatag 892

                                                                    
Query: 441  atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
            | ||||||||||||||||   |  || ||||||||||||||||| |||||||||||
Sbjct: 891  acgatggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggat 836



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                       
Query: 321 cggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcg 380
           ||||||||||||||||| || ||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 989 cggctcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgct 930

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           ||||||||||| || |||||||| ||||||||||||| ||| || ||      ||| |||
Sbjct: 929 ccgatgaacggaccaacccagaaaatccagtggtcgtgccatgcgtgggcgcggttatag 870

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           | ||||||||||||||||   |  || ||||||||||||||||| |||||||||||
Sbjct: 869 acgatggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggat 814



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  139 bits (70), Expect = 1e-29
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| ||||| |||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 970 gctcttgaacgggatggccctgatgatcacctggtggtagatggcagccagggcggcgcc 911

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || || |||||||||||||| ||||||  |||||| || | |  |||||||||
Sbjct: 910 gatgaaggggccgacccagaagatccaatggtcgctccacgcatgatcccggttgtagat 851

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||||||||| |||  ||| |||||||||||||||||||| |||||||||||
Sbjct: 850 gatggcggcgccaaggctcctagccgggttgatgccggtgccggtgatggggat 797



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  139 bits (70), Expect = 1e-29
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| ||||| |||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 965 gctcttgaacgggatggccctgatgatcacctggtggtagatggcagccagggcggcgcc 906

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || || |||||||||||||| ||||||  |||||| || | |  |||||||||
Sbjct: 905 gatgaaggggccgacccagaagatccaatggtcgctccacgcatgatcccggttgtagat 846

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||||||||| |||  ||| |||||||||||||||||||| |||||||||||
Sbjct: 845 gatggcggcgccaaggctcctagccgggttgatgccggtgccggtgatggggat 792



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  139 bits (70), Expect = 1e-29
 Identities = 148/174 (85%)
 Strand = Plus / Minus

                                                                        
Query: 323  gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
            ||||||||| ||||| |||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 1294 gctcttgaacgggatggccctgatgatcacctggtggtagatggcagccagggcggcgcc 1235

                                                                        
Query: 383  gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            |||||| || || |||||||||||||| ||||||  |||||| || | |  |||||||||
Sbjct: 1234 gatgaaggggccgacccagaagatccaatggtcgctccacgcatgatcccggttgtagat 1175

                                                                  
Query: 443  gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
            |||||||||||| |||  ||| |||||||||||||||||||| |||||||||||
Sbjct: 1174 gatggcggcgccaaggctcctagccgggttgatgccggtgccggtgatggggat 1121



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds
          Length = 1325

 Score =  133 bits (67), Expect = 6e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                        
Query: 326  cttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgat 385
            |||||||||||| |||||||  || |||  |||||| | |||||| |||||||| |||  
Sbjct: 1074 cttgaaggggatggccctgaggacgacctggtggtacaccgccgcaagcgccgctccggc 1015

                                                                        
Query: 386  gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgat 445
            |||||| ||||||||||||||||||||| ||| |||| | |||   |||| |||||||||
Sbjct: 1014 gaacgggcccacccagaagatccagtggccgtgccacccgtgcgggttgtcgtagatgat 955

                                                               
Query: 446  ggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
            |||||||||||||  ||| || ||||||||||||||||| |||||||||||
Sbjct: 954  ggcggcgccgaggctcctggcggggttgatgccggtgccggtgatggggat 904



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score =  129 bits (65), Expect = 9e-27
 Identities = 152/181 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcg 380
           ||||||||||||||||  |||||||| |  |||||||||||||| || || || || || 
Sbjct: 932 cggctcttgaaggggagggccctgatgatgaccacgtggtagatggcggcaagagcagca 873

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           |||||||| || || |||||||||||||||||||||| ||| || ||   | ||||||||
Sbjct: 872 ccgatgaaggggccaacccagaagatccagtggtcgttccatgcgtgggacctgttgtag 813

                                                                       
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtc 500
           | ||||||||||||||||   | ||| ||||||||||||||||| ||||||||||| |||
Sbjct: 812 acgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatggggatggtc 753

            
Query: 501 g 501
           |
Sbjct: 752 g 752



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score =  129 bits (65), Expect = 9e-27
 Identities = 152/181 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 cggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcg 380
           ||||||||||||||||  |||||||| |  |||||||||||||| || || || || || 
Sbjct: 365 cggctcttgaaggggagggccctgatgatgaccacgtggtagatggcggcaagagcagca 306

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           |||||||| || || |||||||||||||||||||||| ||| || ||   | ||||||||
Sbjct: 305 ccgatgaaggggccaacccagaagatccagtggtcgttccatgcgtgggacctgttgtag 246

                                                                       
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtc 500
           | ||||||||||||||||   | ||| ||||||||||||||||| ||||||||||| |||
Sbjct: 245 acgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatggggatggtc 186

            
Query: 501 g 501
           |
Sbjct: 185 g 185



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score =  125 bits (63), Expect = 1e-25
 Identities = 153/183 (83%)
 Strand = Plus / Minus

                                                                       
Query: 319 cgcggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccg 378
           ||||||||||||| ||||  |||||||| |  |||||||||||||| || || || || |
Sbjct: 943 cgcggctcttgaaagggagggccctgatgatgaccacgtggtagatggcggcaagagcag 884

                                                                       
Query: 379 cgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgt 438
           | |||||||| || || |||||||||||||||||||||| ||| || ||   | ||||||
Sbjct: 883 caccgatgaaggggccaacccagaagatccagtggtcgttccatgcgtgggacctgttgt 824

                                                                       
Query: 439 agatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcg 498
           ||| ||||||||||||||||   | ||| ||||||||||||||||| ||||||||||| |
Sbjct: 823 agacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatggggatgg 764

              
Query: 499 tcg 501
           |||
Sbjct: 763 tcg 761



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  121 bits (61), Expect = 2e-24
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccg 383
           |||||||| |||||||||||||| | ||||  ||||||||| || |||||||| ||||||
Sbjct: 426 ctcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccg 367

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| || || ||||||||||||||||||||  |||| || || | || |||||| || 
Sbjct: 366 atgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaaatt 307

                                                                
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           | ||||||||| |||  || ||| ||||||||||||||||| ||||| |||||
Sbjct: 306 acggcggcgccaaggctccgcgcggggttgatgccggtgccggtgatagggat 254



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  121 bits (61), Expect = 2e-24
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccg 383
           |||||||| |||||||||||||| | ||||  ||||||||| || |||||||| ||||||
Sbjct: 857 ctcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccg 798

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| || || ||||||||||||||||||||  |||| || || | || |||||| || 
Sbjct: 797 atgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaaatt 738

                                                                
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           | ||||||||| |||  || ||| ||||||||||||||||| ||||| |||||
Sbjct: 737 acggcggcgccaaggctccgcgcggggttgatgccggtgccggtgatagggat 685



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  119 bits (60), Expect = 9e-24
 Identities = 102/116 (87%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           ||||||||||| ||| ||||||||||||||||||||||||| |||| ||||| |||||||
Sbjct: 758 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 699

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||| ||||||||||| |  ||  || ||||||||||| ||||| |||||||||||
Sbjct: 698 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggat 643



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score =  119 bits (60), Expect = 9e-24
 Identities = 102/116 (87%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           ||||||||||| ||| ||||||||||||||||||||||||| |||| ||||| |||||||
Sbjct: 744 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 685

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||| ||||||||||| |  ||  || ||||||||||| ||||| |||||||||||
Sbjct: 684 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggat 629



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score =  119 bits (60), Expect = 9e-24
 Identities = 102/116 (87%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           ||||||||||| ||| ||||||||||||||||||||||||| |||| ||||| |||||||
Sbjct: 857 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 798

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||| ||||||||||| |  ||  || ||||||||||| ||||| |||||||||||
Sbjct: 797 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggat 742



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score =  119 bits (60), Expect = 9e-24
 Identities = 102/116 (87%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           ||||||||||| ||| ||||||||||||||||||||||||| |||| ||||| |||||||
Sbjct: 851 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 792

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||| ||||||||||| |  ||  || ||||||||||| ||||| |||||||||||
Sbjct: 791 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggat 736



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score =  119 bits (60), Expect = 9e-24
 Identities = 102/116 (87%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           ||||||||||| ||| ||||||||||||||||||||||||| |||| ||||| |||||||
Sbjct: 845 ccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttgtag 786

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||| ||||||||||| |  ||  || ||||||||||| ||||| |||||||||||
Sbjct: 785 atgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggggat 730



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  117 bits (59), Expect = 4e-23
 Identities = 140/167 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccg 383
           |||||||| |||||||||||||| | ||||  ||||||||| || |||||||| ||||||
Sbjct: 914 ctcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccg 855

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| || || ||||||||||||||||||||  |||| || || | || |||||| || 
Sbjct: 854 atgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaaatt 795

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||||||||| |||  || ||| ||||||||||||||||| |||||
Sbjct: 794 acggcggcgccaaggctccgcgcggggttgatgccggtgccggtgat 748



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  115 bits (58), Expect = 1e-22
 Identities = 145/174 (83%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| || || |||||||| ||||||  ||||||||| || || || || |||||
Sbjct: 840 gctcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgcc 781

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            ||||| || || |||||||||||||| ||||| ||||| || ||   | ||||||||||
Sbjct: 780 aatgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 721

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  |||||| ||||||||||||||||| |||||||||||
Sbjct: 720 gatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggat 667



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  115 bits (58), Expect = 1e-22
 Identities = 145/174 (83%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| ||||| |||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 820 gctcttgaacgggatggccctgatgatcacctggtggtagatggcagccagggcggcgcc 761

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || || |||||||||||||| ||||||  |||||| || | |  |||||||||
Sbjct: 760 gatgaaggggccgacccagaagatccaatggtcgctccacgcatgatcccggttgtagat 701

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||||||||| |||  |||    ||||||||||||||||| |||||||||||
Sbjct: 700 gatggcggcgccaaggctcctaaaggggttgatgccggtgccggtgatggggat 647



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  115 bits (58), Expect = 1e-22
 Identities = 145/174 (83%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| || || |||||||| ||||||  ||||||||| || || || || |||||
Sbjct: 917 gctcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgcc 858

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            ||||| || || |||||||||||||| ||||| ||||| || ||   | ||||||||||
Sbjct: 857 aatgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 798

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  |||||| ||||||||||||||||| |||||||||||
Sbjct: 797 gatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggat 744



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  115 bits (58), Expect = 1e-22
 Identities = 145/174 (83%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| || || |||||||| ||||||  ||||||||| || || || || |||||
Sbjct: 918 gctcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgcc 859

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            ||||| || || |||||||||||||| ||||| ||||| || ||   | ||||||||||
Sbjct: 858 aatgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 799

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  |||||| ||||||||||||||||| |||||||||||
Sbjct: 798 gatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggat 745



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  115 bits (58), Expect = 1e-22
 Identities = 145/174 (83%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| || || |||||||| ||||||  ||||||||| || || || || |||||
Sbjct: 920 gctcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgcc 861

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            ||||| || || |||||||||||||| ||||| ||||| || ||   | ||||||||||
Sbjct: 860 aatgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 801

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  |||||| ||||||||||||||||| |||||||||||
Sbjct: 800 gatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggat 747



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score =  115 bits (58), Expect = 1e-22
 Identities = 145/174 (83%)
 Strand = Plus / Minus

                                                                        
Query: 323  gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
            ||||||||| || || |||||||| ||||||  ||||||||| || || || || |||||
Sbjct: 1216 gctcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgcc 1157

                                                                        
Query: 383  gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
             ||||| || || |||||||||||||| ||||| ||||| || ||   | ||||||||||
Sbjct: 1156 aatgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagat 1097

                                                                  
Query: 443  gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
            |||||| ||||| |||  |||||| ||||||||||||||||| |||||||||||
Sbjct: 1096 gatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggat 1043



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  113 bits (57), Expect = 6e-22
 Identities = 81/89 (91%)
 Strand = Plus / Minus

                                                                            
Query: 321      cggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcg 380
                ||||||||||||||||| || ||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 35369407 cggctcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgct 35369348

                                             
Query: 381      ccgatgaacggtcccacccagaagatcca 409
                ||||||||||| || |||||||| |||||
Sbjct: 35369347 ccgatgaacggaccaacccagaaaatcca 35369319



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                            
Query: 323      gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
                ||||||||| |||||||||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 27065642 gctcttgaatgggatcgccctgatgatcacctggtggtagatggcagccagggcagcgcc 27065583

                                           
Query: 383      gatgaacggtcccacccagaagatcca 409
                 | ||| || || ||||||||||||||
Sbjct: 27065582 aacgaagggaccaacccagaagatcca 27065556



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                            
Query: 431      cttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
                |||||||||||||||||| ||||| |||  ||| || ||||||||||| || || |||||
Sbjct: 27065047 cttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgat 27064988

                      
Query: 491      ggggat 496
                ||||||
Sbjct: 27064987 ggggat 27064982



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                    
Query: 461      cctcgccgggttgatgccggtgcccgtgatggggat 496
                |||||||||||| ||||||||||| |||||||||||
Sbjct: 25183991 cctcgccgggttaatgccggtgccggtgatggggat 25183956



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                           
Query: 438      tagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
                |||| ||||||||||||||||   |  || ||||||||||||||||| |||||||||||
Sbjct: 35369057 tagacgatggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggat 35368999



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score =  113 bits (57), Expect = 6e-22
 Identities = 81/89 (91%)
 Strand = Plus / Minus

                                                                         
Query: 321   cggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcg 380
             ||||||||||||||||| || ||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 29955 cggctcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgct 29896

                                          
Query: 381   ccgatgaacggtcccacccagaagatcca 409
             ||||||||||| || |||||||| |||||
Sbjct: 29895 ccgatgaacggaccaacccagaaaatcca 29867



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 438   tagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
             |||| ||||||||||||||||   |  || ||||||||||||||||| |||||||||||
Sbjct: 29605 tagacgatggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggat 29547



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score =  113 bits (57), Expect = 6e-22
 Identities = 111/129 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 cttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgat 385
           |||||| ||||| ||||||||||| ||||||||||| |  || || || || || || ||
Sbjct: 948 cttgaaagggatggccctgatcacaaccacgtggtacaaagctgcaagtgctgccccaat 889

                                                                       
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgat 445
           ||||||||| |||||||| ||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 888 gaacggtccaacccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgat 829

                    
Query: 446 ggcggcgcc 454
           ||| |||||
Sbjct: 828 ggcagcgcc 820



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score =  113 bits (57), Expect = 6e-22
 Identities = 81/89 (91%)
 Strand = Plus / Minus

                                                                        
Query: 321  cggctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcg 380
            ||||||||||||||||| || ||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 4910 cggctcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgct 4851

                                         
Query: 381  ccgatgaacggtcccacccagaagatcca 409
            ||||||||||| || |||||||| |||||
Sbjct: 4850 ccgatgaacggaccaacccagaaaatcca 4822



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 438  tagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
            |||| ||||||||||||||||   |  || ||||||||||||||||| |||||||||||
Sbjct: 4559 tagacgatggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggat 4501



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  111 bits (56), Expect = 2e-21
 Identities = 92/104 (88%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||||||||||||||| | ||  | |||||||||||||| |||||||
Sbjct: 829 cccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcggcg 770

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || |||  ||| |||||||||||||||||||| |||| ||||||
Sbjct: 769 cccaggctcctggccgggttgatgccggtgccggtgacggggat 726



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  111 bits (56), Expect = 2e-21
 Identities = 92/104 (88%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||||||||||||||| | ||  | |||||||||||||| |||||||
Sbjct: 777 cccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcggcg 718

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || |||  ||| |||||||||||||||||||| |||| ||||||
Sbjct: 717 cccaggctcctggccgggttgatgccggtgccggtgacggggat 674



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  111 bits (56), Expect = 2e-21
 Identities = 92/104 (88%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||| ||||||||||| ||||  | ||||||||||||||  ||||| 
Sbjct: 860 cccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcggct 801

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || |||  |||||||||||||||||||||||| |||||||||||
Sbjct: 800 cccaggctcctcgccgggttgatgccggtgccggtgatggggat 757



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  111 bits (56), Expect = 2e-21
 Identities = 92/104 (88%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||||||||||||||| | ||  | |||||||||||||| |||||||
Sbjct: 848 cccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcggcg 789

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || |||  ||| |||||||||||||||||||| |||| ||||||
Sbjct: 788 cccaggctcctggccgggttgatgccggtgccggtgacggggat 745



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score =  109 bits (55), Expect = 9e-21
 Identities = 142/171 (83%)
 Strand = Plus / Minus

                                                                       
Query: 326 cttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgat 385
           |||||| ||||| ||||||||||| ||||||||||| |  || || || || || || ||
Sbjct: 944 cttgaaagggatggccctgatcacaaccacgtggtacaaagctgcaagtgctgccccaat 885

                                                                       
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgat 445
           ||||||||| |||||||| ||||||||||| ||||| || |||  |||||||||||||||
Sbjct: 884 gaacggtccaacccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgat 825

                                                              
Query: 446 ggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           ||| ||||||||   ||| || ||||||||||| || || |||| ||||||
Sbjct: 824 ggcagcgccgagactcctggctgggttgatgccagttccggtgacggggat 774



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  107 bits (54), Expect = 3e-20
 Identities = 105/122 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 gcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttg 437
           ||||||||||| || ||||||||||||||||||||||| ||||| ||||  |  ||||||
Sbjct: 779 gcgccgatgaatggacccacccagaagatccagtggtcatcccaggccttgtcgttgttg 720

                                                                       
Query: 438 tagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatc 497
           |||||||  || ||||| | |  ||| |||||||||||||||||||| ||||||||||||
Sbjct: 719 tagatgacagcagcgcccaagctcctggccgggttgatgccggtgccggtgatggggatc 660

             
Query: 498 gt 499
           ||
Sbjct: 659 gt 658



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| |||||||||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 885 gctcttgaatgggatcgccctgatgatcacctggtggtagatggcagccagggcagcgcc 826

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            | ||| || || |||||||||||||| ||||| | ||| || || | ||||||||||||
Sbjct: 825 aacgaagggaccaacccagaagatccaatggtcattccaggcatggtccttgttgtagat 766

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  ||| || ||||||||||| || || |||||||||||
Sbjct: 765 gatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatggggat 712



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  107 bits (54), Expect = 3e-20
 Identities = 105/122 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 gcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttg 437
           ||||||||||| || ||||||||||||||||||||||| ||||| ||||  |  ||||||
Sbjct: 834 gcgccgatgaatggacccacccagaagatccagtggtcatcccaggccttgtcgttgttg 775

                                                                       
Query: 438 tagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatc 497
           |||||||  || ||||| | |  ||| |||||||||||||||||||| ||||||||||||
Sbjct: 774 tagatgacagcagcgcccaagctcctggccgggttgatgccggtgccggtgatggggatc 715

             
Query: 498 gt 499
           ||
Sbjct: 714 gt 713



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| |||||||||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 918 gctcttgaatgggatcgccctgatgatcacctggtggtagatggcagccagggcagcgcc 859

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            | ||| || || |||||||||||||| ||||| | ||| || || | ||||||||||||
Sbjct: 858 aacgaagggaccaacccagaagatccaatggtcattccaggcatggtccttgttgtagat 799

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  ||| || ||||||||||| || || |||||||||||
Sbjct: 798 gatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatggggat 745



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| |||||||||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 973 gctcttgaatgggatcgccctgatgatcacctggtggtagatggcagccagggcagcgcc 914

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            | ||| || || |||||||||||||| ||||| | ||| || || | ||||||||||||
Sbjct: 913 aacgaagggaccaacccagaagatccaatggtcattccaggcatggtccttgttgtagat 854

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  ||| || ||||||||||| || || |||||||||||
Sbjct: 853 gatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatggggat 800



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| |||||||||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 918 gctcttgaatgggatcgccctgatgatcacctggtggtagatggcagccagggcagcgcc 859

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            | ||| || || |||||||||||||| ||||| | ||| || || | ||||||||||||
Sbjct: 858 aacgaagggaccaacccagaagatccaatggtcattccaggcatggtccttgttgtagat 799

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  ||| || ||||||||||| || || |||||||||||
Sbjct: 798 gatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatggggat 745



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| |||||||||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 913 gctcttgaatgggatcgccctgatgatcacctggtggtagatggcagccagggcagcgcc 854

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            | ||| || || |||||||||||||| ||||| | ||| || || | ||||||||||||
Sbjct: 853 aacgaagggaccaacccagaagatccaatggtcattccaggcatggtccttgttgtagat 794

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  ||| || ||||||||||| || || |||||||||||
Sbjct: 793 gatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatggggat 740



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| |||||||||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 916 gctcttgaatgggatcgccctgatgatcacctggtggtagatggcagccagggcagcgcc 857

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            | ||| || || |||||||||||||| ||||| | ||| || || | ||||||||||||
Sbjct: 856 aacgaagggaccaacccagaagatccaatggtcattccaggcatggtccttgttgtagat 797

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  ||| || ||||||||||| || || |||||||||||
Sbjct: 796 gatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatggggat 743



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  103 bits (52), Expect = 5e-19
 Identities = 91/104 (87%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||| ||||||||||| ||||  | ||||||||||||||  ||||| 
Sbjct: 868 cccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcggct 809

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || |||  |||||||||||||||||||||||| |||||| ||||
Sbjct: 808 cccaggatcctcgccgggttgatgccggtgccggtgatgcggat 765



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score =  103 bits (52), Expect = 5e-19
 Identities = 109/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 cgccgcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttctt 433
           |||||| ||||||||||| ||||||||||||||||| ||||||  ||| || |   | ||
Sbjct: 879 cgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttgctgtt 820

                                                                       
Query: 434 gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
           |||||| | || |||||||||||||  ||||||||||||||| |||||||| ||||| ||
Sbjct: 819 gttgtacacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtgatcgg 760

                   
Query: 494 gatcgtcg 501
           ||||||||
Sbjct: 759 gatcgtcg 752



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  103 bits (52), Expect = 5e-19
 Identities = 91/104 (87%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||| ||||||||||| ||||  | ||||||||||||||  ||||| 
Sbjct: 850 cccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcggct 791

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || | |  |||||||||||||||||||||||| |||||||||||
Sbjct: 790 cccaagctcctcgccgggttgatgccggtgccggtgatggggat 747



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  103 bits (52), Expect = 5e-19
 Identities = 91/104 (87%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||| ||||||||||| ||||  | ||||||||||||||  ||||| 
Sbjct: 278 cccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcggct 219

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || | |  |||||||||||||||||||||||| |||||||||||
Sbjct: 218 cccaagctcctcgccgggttgatgccggtgccggtgatggggat 175



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                        
Query: 393  cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
            ||||||||||| ||||||||||| ||||| | ||  | ||||||||||| || |||||||
Sbjct: 1551 cccacccagaaaatccagtggtcatcccatggcttgtccttgttgtagacgacggcggcg 1492

                                                        
Query: 453  ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
            || |||  ||| |||||||||||||||||||| |||| ||||||
Sbjct: 1491 cccaggctcctggccgggttgatgccggtgccggtgacggggat 1448



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score =  101 bits (51), Expect = 2e-18
 Identities = 141/171 (82%)
 Strand = Plus / Minus

                                                                        
Query: 326  cttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgat 385
            |||||| ||||| ||||||||||| ||||||||||| |  || || || || || || ||
Sbjct: 1085 cttgaaagggatggccctgatcacaaccacgtggtacaaagctgcaagtgctgccccaat 1026

                                                                        
Query: 386  gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgat 445
            ||||||||| |||||||| | ||||||||| ||||| || |||| |||||||||||||||
Sbjct: 1025 gaacggtccaacccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgat 966

                                                               
Query: 446  ggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
            ||| ||||| ||   ||| || ||||||||||| || || |||| ||||||
Sbjct: 965  ggcagcgccaagactcctggctgggttgatgccagttccggtgacggggat 915



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 920 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggtt 861

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || |||||||| ||  |||||| |||||| ||| || |||| |  ||| |||||||||||
Sbjct: 860 gtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgat 801

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 800 gccggtgccggtgatcgggatcgtcg 775



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 922 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggtt 863

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || |||||||| ||  |||||| |||||| ||| || |||| |  ||| |||||||||||
Sbjct: 862 gtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgat 803

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 802 gccggtgccggtgatcgggatcgtcg 777



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 923 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggtt 864

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || |||||||| ||  |||||| |||||| ||| || |||| |  ||| |||||||||||
Sbjct: 863 gtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgat 804

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 803 gccggtgccggtgatcgggatcgtcg 778



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||| | |||||| | |||||||||||||||||| || |||||||||||||| || ||
Sbjct: 898 gtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactgatc 839

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
              ||| ||||  || ||||||||||  | |||| ||||||||  ||| |||||||||||
Sbjct: 838 actccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgat 779

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 778 gccggtgccggtgatcgggatcgtcg 753



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 143/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| ||||| |||||||| | ||||  ||||||||| || || || || |||||
Sbjct: 414 gctcttgaacgggatggccctgatgatcacctggtggtagatggcggctagggcagcgcc 355

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            ||||| || || |||||||||||||| ||||| | ||| || |||| | ||||||||||
Sbjct: 354 aatgaaggggccgacccagaagatccaatggtcattccaggcgtgctccctgttgtagat 295

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  ||| || ||||||||||| ||||| || ||||||||
Sbjct: 294 gatggcagcgccaaggctcctagctgggttgatgccagtgccagtaatggggat 241



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 920 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggtt 861

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || |||||||| ||  |||||| |||||| ||| || |||| |  ||| |||||||||||
Sbjct: 860 gtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgat 801

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 800 gccggtgccggtgatcgggatcgtcg 775



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 514 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggtt 455

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || |||||||| ||  |||||| |||||| ||| || |||| |  ||| |||||||||||
Sbjct: 454 gtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgat 395

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 394 gccggtgccggtgatcgggatcgtcg 369



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 920 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggtt 861

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || |||||||| ||  |||||| |||||| ||| || |||| |  ||| |||||||||||
Sbjct: 860 gtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgat 801

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 800 gccggtgccggtgatcgggatcgtcg 775



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 922 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggtt 863

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || |||||||| ||  |||||| |||||| ||| || |||| |  ||| |||||||||||
Sbjct: 862 gtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgat 803

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 802 gccggtgccggtgatcgggatcgtcg 777



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||| | |||||| | |||||||||||||||||| || |||||||||||||| || ||
Sbjct: 898 gtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactgatc 839

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
              ||| ||||  || ||||||||||  | |||| ||||||||  ||| |||||||||||
Sbjct: 838 actccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgat 779

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 778 gccggtgccggtgatcgggatcgtcg 753



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 923 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggtt 864

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || |||||||| ||  |||||| |||||| ||| || |||| |  ||| |||||||||||
Sbjct: 863 gtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgat 804

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 803 gccggtgccggtgatcgggatcgtcg 778



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 910 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggtt 851

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || |||||||| ||  |||||| |||||| ||| || |||| |  ||| |||||||||||
Sbjct: 850 gtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgat 791

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 790 gccggtgccggtgatcgggatcgtcg 765



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 143/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| ||||| || ||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 921 gctcttgaacgggatggctctgatgatcacctggtggtagatggcagccagggcagcgcc 862

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            ||||| || || |||||||||||||| ||||||| ||| || || | | ||||||||||
Sbjct: 861 aatgaaggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagat 802

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  ||| || ||||||||||| ||||| || ||||||||
Sbjct: 801 gatggcagcgccaaggctcctagctgggttgatgccagtgccagtaatggggat 748



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 97/113 (85%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||||||||||||||||||||| || || | |||||||||||||
Sbjct: 822 atgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatg 763

                                                                
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           ||||| || || |||  ||  || |||||||||||||| || || ||||||||
Sbjct: 762 atggccgcacccaggctccgagctgggttgatgccggttccggttatggggat 710



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 cgccgcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttctt 433
           |||||| ||||||||||| || |||||||||||||| || ||   ||| ||||   | ||
Sbjct: 777 cgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttgctgtt 718

                                                                       
Query: 434 gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
           |||||||| || |||||||||||||  |||||||||||||||||||||||| |||| |||
Sbjct: 717 gttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacggg 658

                   
Query: 494 gatcgtcg 501
           ||| ||||
Sbjct: 657 gatggtcg 650



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 cgccgcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttctt 433
           |||||| ||||||||||| || |||||||||||||| || ||   ||| ||||   | ||
Sbjct: 335 cgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttgctgtt 276

                                                                       
Query: 434 gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
           |||||||| || |||||||||||||  |||||||||||||||||||||||| |||| |||
Sbjct: 275 gttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacggg 216

                   
Query: 494 gatcgtcg 501
           ||| ||||
Sbjct: 215 gatggtcg 208



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 60/64 (93%)
 Strand = Plus / Minus

                                                                       
Query: 433 tgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatgg 492
           |||||||||||||||| |||||||||  |||||||||||||||||||||||| |||||||
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 598

               
Query: 493 ggat 496
           ||||
Sbjct: 597 ggat 594



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 356  gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatcca 409
            ||||||||| || |||||||| ||||||||||| || || ||||||||||||||
Sbjct: 1288 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 1235



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 99/116 (85%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           |||||||| || ||||||||||| ||||||||||| ||||| |||| ||  |||||||||
Sbjct: 858 ccgatgaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtag 799

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || | ||| || |||| |  |||||||||||||||||||||||| ||||| |||||
Sbjct: 798 atcacggcagctccgaagctcctcgccgggttgatgccggtgccggtgatcgggat 743



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 cgccgcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttctt 433
           |||||| ||||||||||| || |||||||||||||| || ||   ||| ||||   | ||
Sbjct: 334 cgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttgctgtt 275

                                                                       
Query: 434 gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
           |||||||| || |||||||||||||  |||||||||||||||||||||||| |||| |||
Sbjct: 274 gttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacggg 215

                   
Query: 494 gatcgtcg 501
           ||| ||||
Sbjct: 214 gatggtcg 207



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                            
Query: 432      ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatg 491
                |||||||| |||| |||||||||||||  |||||||||||||||||||||||| ||||| 
Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 15316297

                          
Query: 492      gggatcgtcg 501
                ||||||||||
Sbjct: 15316296 gggatcgtcg 15316287



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                            
Query: 432      ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatg 491
                |||||||||| || |||||||||||||  |||||||||||||||||||||||| |||| |
Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 15324177

                          
Query: 492      gggatcgtcg 501
                ||||| ||||
Sbjct: 15324176 gggatggtcg 15324167



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                            
Query: 432      ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatg 491
                ||||||||||  | |||| ||||||||  ||| |||||||||||||||||||| ||||| 
Sbjct: 15306305 ttgttgtagaccacggcgacgccgaggctcctggccgggttgatgccggtgccggtgatc 15306246

                          
Query: 492      gggatcgtcg 501
                ||||||||||
Sbjct: 15306245 gggatcgtcg 15306236



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                            
Query: 419      ccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgatgcc 478
                |||||||| ||  |||||| |||||| ||| || |||| |  ||| ||||||||||||||
Sbjct: 15355607 ccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgcc 15355548

                                       
Query: 479      ggtgcccgtgatggggatcgtcg 501
                |||||| ||||| ||||||||||
Sbjct: 15355547 ggtgccggtgatcgggatcgtcg 15355525



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                      
Query: 356      gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatcca 409
                |||||| | |||||| | |||||||||||||||||| || ||||||||||||||
Sbjct: 15306495 gtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatcca 15306442



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                      
Query: 356      gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatcca 409
                |||||| | |||||| | |||||| ||||||||||| || ||||||||||||||
Sbjct: 15316531 gtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatcca 15316478



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                    
Query: 374      cgccgcgccgatgaacggtcccacccagaagatcca 409
                |||||| ||||||||||| || ||||||||||||||
Sbjct: 15324426 cgccgccccgatgaacggcccaacccagaagatcca 15324391



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                      
Query: 356      gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatcca 409
                |||||||| |||||| |  || ||||||| |||||| || ||||||||||||||
Sbjct: 15355794 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 15355741



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                         
Query: 432   ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatg 491
             |||||||| |||| |||||||||||||  |||||||||||||||||||||||| ||||| 
Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 23296

                       
Query: 492   gggatcgtcg 501
             ||||||||||
Sbjct: 23295 gggatcgtcg 23286



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                         
Query: 432   ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatg 491
             |||||||||| || |||||||||||||  |||||||||||||||||||||||| |||| |
Sbjct: 31235 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 31176

                       
Query: 492   gggatcgtcg 501
             ||||| ||||
Sbjct: 31175 gggatggtcg 31166



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                         
Query: 432   ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatg 491
             ||||||||||  | |||| ||||||||  ||| |||||||||||||||||||| ||||| 
Sbjct: 13304 ttgttgtagaccacggcgacgccgaggctcctggccgggttgatgccggtgccggtgatc 13245

                       
Query: 492   gggatcgtcg 501
             ||||||||||
Sbjct: 13244 gggatcgtcg 13235



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                         
Query: 419   ccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgatgcc 478
             |||||||| ||  |||||| |||||| ||| || |||| |  ||| ||||||||||||||
Sbjct: 62606 ccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgcc 62547

                                    
Query: 479   ggtgcccgtgatggggatcgtcg 501
             |||||| ||||| ||||||||||
Sbjct: 62546 ggtgccggtgatcgggatcgtcg 62524



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                   
Query: 356   gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatcca 409
             |||||| | |||||| | |||||||||||||||||| || ||||||||||||||
Sbjct: 13494 gtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatcca 13441



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                   
Query: 356   gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatcca 409
             |||||| | |||||| | |||||| ||||||||||| || ||||||||||||||
Sbjct: 23530 gtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatcca 23477



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 374   cgccgcgccgatgaacggtcccacccagaagatcca 409
             |||||| ||||||||||| || ||||||||||||||
Sbjct: 31425 cgccgccccgatgaacggcccaacccagaagatcca 31390



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                   
Query: 356   gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatcca 409
             |||||||| |||||| |  || ||||||| |||||| || ||||||||||||||
Sbjct: 62793 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatcca 62740



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                          
Query: 432    ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatg 491
              |||||||| |||| |||||||||||||  |||||||||||||||||||||||| ||||| 
Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 102310

                        
Query: 492    gggatcgtcg 501
              ||||||||||
Sbjct: 102309 gggatcgtcg 102300



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                          
Query: 432    ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatg 491
              |||||||||| || |||||||||||||  |||||||||||||||||||||||| |||| |
Sbjct: 110249 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 110190

                        
Query: 492    gggatcgtcg 501
              ||||| ||||
Sbjct: 110189 gggatggtcg 110180



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                         
Query: 432   ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatg 491
             ||||||||||  | |||| ||||||||  ||| |||||||||||||||||||| ||||| 
Sbjct: 92318 ttgttgtagaccacggcgacgccgaggctcctggccgggttgatgccggtgccggtgatc 92259

                       
Query: 492   gggatcgtcg 501
             ||||||||||
Sbjct: 92258 gggatcgtcg 92249



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                   
Query: 356   gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatcca 409
             |||||| | |||||| | |||||||||||||||||| || ||||||||||||||
Sbjct: 92508 gtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatcca 92455



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                    
Query: 356    gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatcca 409
              |||||| | |||||| | |||||| ||||||||||| || ||||||||||||||
Sbjct: 102544 gtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatcca 102491



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 374    cgccgcgccgatgaacggtcccacccagaagatcca 409
              |||||| ||||||||||| || ||||||||||||||
Sbjct: 110439 cgccgccccgatgaacggcccaacccagaagatcca 110404



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 142/174 (81%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| ||||| |||||||| | ||||  ||||||||| || ||||| || || ||
Sbjct: 346 gctcttgaacgggatggccctgatgatcacctggtggtagatggcagccagggcagcacc 287

                                                                       
Query: 383 gatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
            ||||| || || |||||||||||||| ||||||  ||| || || | | ||||||||||
Sbjct: 286 aatgaaggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagat 227

                                                                 
Query: 443 gatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| ||||| |||  ||| || ||||||||||| ||||| || ||||||||
Sbjct: 226 gatggcagcgccaaggctcctagctgggttgatgccagtgccagtaatggggat 173



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||  ||||| | |||||||||||| |  || || |||||||||||||| || ||
Sbjct: 887 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 828

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
            ||||| ||||  | |||||||||||||| |||||| || |||  ||  |||||||||||
Sbjct: 827 atcccaggccttgtccttgttgtagatgacggcggcccccaggctccgggccgggttgat 768

                                
Query: 476 gccggtgcccgtgatggggat 496
           ||||||||| |||||||||||
Sbjct: 767 gccggtgccggtgatggggat 747



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||| ||||||||||| ||||| | ||  | ||||||||||| || |||||||
Sbjct: 901 cccacccagaaaatccagtggtcatcccatggcttgtccttgttgtagacgacggcggcg 842

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || |||  ||| |||||||||||||||||||| |||| ||||||
Sbjct: 841 cccaggctcctggccgggttgatgccggtgccggtgacggggat 798



to top

>emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major intrinsic protein PIPa2
          Length = 1189

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 121/147 (82%)
 Strand = Plus / Minus

                                                                       
Query: 326 cttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgat 385
           |||||| || || ||||| ||||| ||||||||||| |  || || ||||| ||||||||
Sbjct: 920 cttgaatggaatggcccttatcacaaccacgtggtaaagtgcggcgagcgctgcgccgat 861

                                                                       
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgat 445
           ||| ||||| ||||| || | ||||||||||| ||||||  | |  | |||||| |||||
Sbjct: 860 gaatggtccgacccaaaatacccagtggtcgtgccacgcgcggtcgtggttgtatatgat 801

                                      
Query: 446 ggcggcgccgagggacctcgccgggtt 472
           |||||||||||||  ||||||||||||
Sbjct: 800 ggcggcgccgaggctcctcgccgggtt 774



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 325 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 384
           ||||||| ||||| || |||||||||||||| ||||| |  || ||||  || ||||| |
Sbjct: 841 tcttgaatgggatagctctgatcaccaccacatggtacagagctgccaatgctgcgccaa 782

                                                                       
Query: 385 tgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 444
           |||| ||||| |||||||||||||||||||| ||||| || || | | ||||||||||||
Sbjct: 781 tgaatggtccaacccagaagatccagtggtcatcccaggcgtggtccctgttgtagatga 722

                  
Query: 445 tggcggc 451
           | |||||
Sbjct: 721 ttgcggc 715



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 390 ggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcg 449
           ||||| |||||||||||||| |||||||||||  | |  |  ||||||||||||| ||||
Sbjct: 790 ggtccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcg 731

                                                          
Query: 450 gcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           ||||||| |  ||| || ||||||||||||||||| |||||||||||
Sbjct: 730 gcgccgaagctcctggcggggttgatgccggtgccggtgatggggat 684



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 120/146 (82%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           |||||||| |||||| |  || ||||||| |||||| || |||||||||||||| |||| 
Sbjct: 486 gtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggtt 427

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
           || ||| |||| ||  |||||| |||||| ||| |  |||  || ||| |||||||||||
Sbjct: 426 gtgccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgggttgat 367

                                     
Query: 476 gccggtgcccgtgatggggatcgtcg 501
           ||||||||| ||||| ||||||||||
Sbjct: 366 gccggtgccggtgatcgggatcgtcg 341



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                         
Query: 433   tgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatgg 492
             |||||||||||||||| ||||| |||  |||||| ||||||||||||||||| |||||||
Sbjct: 28000 tgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatgg 27941

                 
Query: 493   ggat 496
             ||||
Sbjct: 27940 ggat 27937



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                         
Query: 323   gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
             ||||||||| || || |||||||| ||||||  ||||||||| || || || || |||||
Sbjct: 28671 gctcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgcc 28612

                                        
Query: 383   gatgaacggtcccacccagaagatcca 409
              ||||| || || ||||||||||||||
Sbjct: 28611 aatgaaggggccaacccagaagatcca 28585



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                            
Query: 433      tgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatgg 492
                |||||||||||||||| ||||| |||  |||||| ||||||||||||||||| |||||||
Sbjct: 28020774 tgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatgg 28020715

                    
Query: 493      ggat 496
                ||||
Sbjct: 28020714 ggat 28020711



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                           
Query: 410     gtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgg 469
               |||||||||||| |||| ||||| ||||||||||| ||||||||||| |  ||  || ||
Sbjct: 8906894 gtggtcgtcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagg 8906953

                                          
Query: 470     gttgatgccggtgcccgtgatggggat 496
               ||||||||| ||||| |||||||||||
Sbjct: 8906954 gttgatgcccgtgccggtgatggggat 8906980



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                            
Query: 323      gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
                ||||||||| || || |||||||| ||||||  ||||||||| || || || || |||||
Sbjct: 28021445 gctcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgcc 28021386

                                           
Query: 383      gatgaacggtcccacccagaagatcca 409
                 ||||| || || ||||||||||||||
Sbjct: 28021385 aatgaaggggccaacccagaagatcca 28021359



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 465      gccgggttgatgccggtgcccgtgatggggatcgt 499
                |||||||||||||||||||| ||||| ||||||||
Sbjct: 26074187 gccgggttgatgccggtgccggtgatcgggatcgt 26074153



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 381     ccgatgaacggtcccacccagaagatcca 409
               ||||||||||| ||| |||||||||||||
Sbjct: 8906782 ccgatgaacggccccgcccagaagatcca 8906810



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 378      gcgccgatgaacggtcccacccagaagatcca 409
                ||||||||||  || |||||||||||||||||
Sbjct: 26074783 gcgccgatgaggggccccacccagaagatcca 26074752



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                         
Query: 410   gtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgg 469
             |||||||||||| |||| ||||| ||||||||||| ||||||||||| |  ||  || ||
Sbjct: 91203 gtggtcgtcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagg 91262

                                        
Query: 470   gttgatgccggtgcccgtgatggggat 496
             ||||||||| ||||| |||||||||||
Sbjct: 91263 gttgatgcccgtgccggtgatggggat 91289



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 381   ccgatgaacggtcccacccagaagatcca 409
             ||||||||||| ||| |||||||||||||
Sbjct: 91091 ccgatgaacggccccgcccagaagatcca 91119



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 99/119 (83%)
 Strand = Plus / Minus

                                                                       
Query: 378 gcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttg 437
           |||||||| | ||| ||||||||||||||||| ||||| ||||| ||||  |  ||||||
Sbjct: 829 gcgccgatcagcggccccacccagaagatccattggtcatcccaggccttgtctttgttg 770

                                                                      
Query: 438 tagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||||  || || || | |   ||||||||||||||||||||||| |||||||||||
Sbjct: 769 tagatgacagcagctcccaagcttctcgccgggttgatgccggtgccggtgatggggat 711



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Minus

                                                                       
Query: 356 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||  || ||||| || ||||| | ||| || ||||||||||||||||| |||||
Sbjct: 910 gtggtagacggctgccagggcggcgccaacgaaggggcccacccagaagatccaatggtc 851

                                                                       
Query: 416 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 475
            | ||| || || | | |||||||||||||||| || || |||  ||| || ||||||||
Sbjct: 850 attccaggcatggtccctgttgtagatgatggcagccccaaggctcctagctgggttgat 791

                             
Query: 476 gccggtgcccgtgatggg 493
           ||||||||| ||||||||
Sbjct: 790 gccggtgccggtgatggg 773



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 87/104 (83%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||| ||||| ||||| ||||  | |||||||||||| |  ||||  
Sbjct: 840 cccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggtt 781

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || | |  |||||||||||| ||||||||||| |||||||||||
Sbjct: 780 cccaagctcctcgccgggttaatgccggtgccggtgatggggat 737



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           |||||||| |||||||||||||| ||||| || || ||||| || || | ||||||||||
Sbjct: 473 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 414

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           ||||| ||||| || |||  ||| || |||||||| ||||| || ||||| |||||
Sbjct: 413 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattgggat 358



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           |||||||| |||||||||||||| ||||| || || ||||| || || | ||||||||||
Sbjct: 803 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 744

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           ||||| ||||| || |||  ||| || |||||||| ||||| || ||||| |||||
Sbjct: 743 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattgggat 688



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 87/104 (83%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||| ||||| ||||| ||||  | |||||||||||| |  ||||  
Sbjct: 840 cccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggtt 781

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || | |  |||||||||||| ||||||||||| |||||||||||
Sbjct: 780 cccaagctcctcgccgggttaatgccggtgccggtgatggggat 737



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| ||||| |||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 258 gctcttgaacgggatggccctgatgatcacctggtggtagatggcagccagggcggcgcc 317

                                      
Query: 383 gatgaacggtcccacccagaagatcca 409
           |||||| || || ||||||||||||||
Sbjct: 318 gatgaaggggccgacccagaagatcca 344



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 323 gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
           ||||||||| ||||| |||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 519 gctcttgaacgggatggccctgatgatcacctggtggtagatggcagccagggcggcgcc 460

                                      
Query: 383 gatgaacggtcccacccagaagatcca 409
           |||||| || || ||||||||||||||
Sbjct: 459 gatgaaggggccgacccagaagatcca 433



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 140/175 (80%)
 Strand = Plus / Minus

                                                                       
Query: 327 ttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgatg 386
           ||||||||||| || ||||| || |||  |||||| | ||| ||||| || || ||||||
Sbjct: 936 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 877

                                                                       
Query: 387 aacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatg 446
           || || || |||||||| ||||| ||||| | ||| || ||     ||||||||||||||
Sbjct: 876 aatggcccaacccagaatatccaatggtcattccatgcgtgggatctgttgtagatgatg 817

                                                                  
Query: 447 gcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtcg 501
           || || || |||  ||| || ||||||||||||||||| ||||| ||||||||||
Sbjct: 816 gcagctcccaggctccttgcagggttgatgccggtgccggtgatcgggatcgtcg 762



to top

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 137/171 (80%)
 Strand = Plus / Minus

                                                                       
Query: 326 cttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgat 385
           ||||||||| || |||||||||||||| |||||||| |  || ||||| ||||| || ||
Sbjct: 916 cttgaagggaatggccctgatcaccacgacgtggtacagtgctgccagtgccgctccaat 857

                                                                       
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgat 445
           ||| |||||||||||||| | |||||| || | |||  |  | |  |||||| |||||||
Sbjct: 856 gaatggtcccacccagaaaacccagtgttcatgccagccaaggtgtttgttgaagatgat 797

                                                              
Query: 446 ggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||| |||||    |  || |||||||||||||| || |||||||||||
Sbjct: 796 ggcggctccgagacttcgagctgggttgatgccggttccggtgatggggat 746



to top

>gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mip-1) mRNA, complete cds
          Length = 1213

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 375 gccgcgccgatgaacggtcccacccagaagatccagtggtcgtccca 421
           ||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 843 gccgcaccgatgaatggtcccacccagaagatccagtgatcgtccca 797



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||||||||| || || | |||||||||||||
Sbjct: 917 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatg 858

             
Query: 444 at 445
           ||
Sbjct: 857 at 856



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 100/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 378 gcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttg 437
           ||||||||||  || ||||||||||||||||||||||| | ||| ||||  | || ||||
Sbjct: 791 gcgccgatgaggggccccacccagaagatccagtggtcatgccatgccttgtgctggttg 732

                                                                       
Query: 438 tagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatc 497
           ||||| |  || || || | |  ||| |||||||||||||||||||| ||||| ||||||
Sbjct: 731 tagatcaccgcagctcccaagctccttgccgggttgatgccggtgccggtgatcgggatc 672

             
Query: 498 gt 499
           ||
Sbjct: 671 gt 670



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||||||||| || || | |||||||||||||
Sbjct: 823 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatg 764

             
Query: 444 at 445
           ||
Sbjct: 763 at 762



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||||||||| || || | |||||||||||||
Sbjct: 804 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatg 745

             
Query: 444 at 445
           ||
Sbjct: 744 at 743



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||||||||| || || | |||||||||||||
Sbjct: 845 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatg 786

             
Query: 444 at 445
           ||
Sbjct: 785 at 784



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||||||||| || || | |||||||||||||
Sbjct: 791 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatg 732

             
Query: 444 at 445
           ||
Sbjct: 731 at 730



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||||||||| || || | |||||||||||||
Sbjct: 835 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatg 776

             
Query: 444 at 445
           ||
Sbjct: 775 at 774



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 93/110 (84%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgctt-cttgttgtagatgatggcggc 451
           ||||||||||||||||||||||| | ||| || ||| | || |||||| |  | ||||||
Sbjct: 801 cccacccagaagatccagtggtctttccaagc-tgcgtgctggttgtacagcacggcggc 743

                                                             
Query: 452 gccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtcg 501
           |||||||  |||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 742 gccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcg 693



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 93/110 (84%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgctt-cttgttgtagatgatggcggc 451
           ||||||||||||||||||||||| | ||| || ||| | || |||||| |  | ||||||
Sbjct: 799 cccacccagaagatccagtggtctttccaagc-tgcgtgctggttgtacagcacggcggc 741

                                                             
Query: 452 gccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtcg 501
           |||||||  |||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 740 gccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcg 691



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 93/110 (84%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgctt-cttgttgtagatgatggcggc 451
           ||||||||||||||||||||||| | ||| || ||| | || |||||| |  | ||||||
Sbjct: 794 cccacccagaagatccagtggtctttccaagc-tgcgtgctggttgtacagcacggcggc 736

                                                             
Query: 452 gccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtcg 501
           |||||||  |||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 735 gccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcg 686



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||||||||| || || | |||||||||||||
Sbjct: 791 atgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatg 732

             
Query: 444 at 445
           ||
Sbjct: 731 at 730



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| |||||   ||| ||||| || ||||   |||||||||||
Sbjct: 845 atgaagggtcccacccagaaaatccacatgtcatcccaggcatgctctctgttgtagatg 786

                                                                
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||||| || ||   ||| || |||||||||||||| || |||||||||||
Sbjct: 785 atggcggcccccagactcctagcagggttgatgccggttccggtgatggggat 733



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 378 gcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcct 426
           |||||||||||||| || |||||||||||||| ||||||||||| ||||
Sbjct: 789 gcgccgatgaacgggccaacccagaagatccactggtcgtcccaagcct 741



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                        
Query: 446      ggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtcg 501
                |||||||||||||  |||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 21009486 ggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcg 21009431



to top

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                      
Query: 446    ggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtcg 501
              |||||||||||||  |||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 101575 ggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcg 101520



to top

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 446 ggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtcg 501
           |||||||||||||  |||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 646 ggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcg 591



to top

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 446   ggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtcg 501
             |||||||||||||  |||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 30786 ggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcg 30731



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||| ||||| ||||| || || | |||||||||||||||||| || |||
Sbjct: 831 acccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagctccg 772

                                  
Query: 456 agggacctcgccgggttgatgcc 478
           ||   ||| |||||||| |||||
Sbjct: 771 agactcctggccgggttaatgcc 749



to top

>ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA
          Length = 823

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| |||||||||||||||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1), mRNA, complete
           cds
          Length = 2695

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| |||||||||||||||||||||||
Sbjct: 704 ccgatgaacggccccacccagaagatccagtggtc 670



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||| ||||| ||||| || || | |||||||||||||||||| || |||
Sbjct: 782 acccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagctccg 723

                                  
Query: 456 agggacctcgccgggttgatgcc 478
           ||   ||| |||||||| |||||
Sbjct: 722 agactcctggccgggttaatgcc 700



to top

>ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA
          Length = 2703

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| |||||||||||||||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, complete cds
          Length = 823

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| |||||||||||||||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||| ||||| ||||| || || | |||||||||||||||||| || |||
Sbjct: 831 acccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagctccg 772

                                  
Query: 456 agggacctcgccgggttgatgcc 478
           ||   ||| |||||||| |||||
Sbjct: 771 agactcctggccgggttaatgcc 749



to top

>gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:129064 IMAGE:8121557),
           complete cds
          Length = 2703

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| |||||||||||||||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||| ||||| ||||| || || | |||||||||||||||||| || |||
Sbjct: 87  acccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagctccg 28

                                  
Query: 456 agggacctcgccgggttgatgcc 478
           ||   ||| |||||||| |||||
Sbjct: 27  agactcctggccgggttaatgcc 5



to top

>gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocular ciliary epithelium,
           mRNA, 1211 nt, segment 1 of 2]
          Length = 1211

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| |||||||||||||||||||||||
Sbjct: 694 ccgatgaacggccccacccagaagatccagtggtc 660



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 462 ctcgccgggttgatgccggtgcccgtgatggggat 496
           ||||||||||||||||||||||| |||||||||||
Sbjct: 359 ctcgccgggttgatgccggtgccggtgatggggat 325



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||| ||||| ||||| || || | |||||||||||||||||| || |||
Sbjct: 155 acccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagctccg 96

                                  
Query: 456 agggacctcgccgggttgatgcc 478
           ||   ||| |||||||| |||||
Sbjct: 95  agactcctggccgggttaatgcc 73



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||| ||||| ||||| || || | |||||||||||||||||| || |||
Sbjct: 414 acccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagctccg 355

                                  
Query: 456 agggacctcgccgggttgatgcc 478
           ||   ||| |||||||| |||||
Sbjct: 354 agactcctggccgggttaatgcc 332



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||| ||||| ||||| || || | |||||||||||||||||| || |||
Sbjct: 820 acccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagctccg 761

                                  
Query: 456 agggacctcgccgggttgatgcc 478
           ||   ||| |||||||| |||||
Sbjct: 760 agactcctggccgggttaatgcc 738



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||| ||||| ||||| || || | |||||||||||||||||| || |||
Sbjct: 795 acccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagctccg 736

                                  
Query: 456 agggacctcgccgggttgatgcc 478
           ||   ||| |||||||| |||||
Sbjct: 735 agactcctggccgggttaatgcc 713



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||| ||||| ||||| || || | |||||||||||||||||| || |||
Sbjct: 829 acccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagctccg 770

                                  
Query: 456 agggacctcgccgggttgatgcc 478
           ||   ||| |||||||| |||||
Sbjct: 769 agactcctggccgggttaatgcc 747



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                         
Query: 323   gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
             ||||||||| |||||||||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 37291 gctcttgaatgggatcgccctgatgatcacctggtggtagatggcagccagggcagcgcc 37232

                                        
Query: 383   gatgaacggtcccacccagaagatcca 409
              | ||| || || ||||||||||||||
Sbjct: 37231 aacgaagggaccaacccagaagatcca 37205



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 431   cttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
             |||||||||||||||||| ||||| |||  ||| || ||||||||||| || || |||||
Sbjct: 36696 cttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgat 36637

                   
Query: 491   ggggat 496
             ||||||
Sbjct: 36636 ggggat 36631



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                          
Query: 323    gctcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgcc 382
              ||||||||| |||||||||||||| | ||||  ||||||||| || ||||| || |||||
Sbjct: 118844 gctcttgaatgggatcgccctgatgatcacctggtggtagatggcagccagggcagcgcc 118785

                                         
Query: 383    gatgaacggtcccacccagaagatcca 409
               | ||| || || ||||||||||||||
Sbjct: 118784 aacgaagggaccaacccagaagatcca 118758



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                          
Query: 431    cttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
              |||||||||||||||||| ||||| |||  ||| || ||||||||||| || || |||||
Sbjct: 118249 cttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgat 118190

                    
Query: 491    ggggat 496
              ||||||
Sbjct: 118189 ggggat 118184



to top

>gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 mRNA, complete cds
          Length = 826

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| |||||||||||||||||||||||
Sbjct: 672 ccgatgaacggccccacccagaagatccagtggtc 638



to top

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacg 423
           |||||||| |||||||||||||| ||||||||||| |||||||
Sbjct: 804 ccgatgaatggtcccacccagaaaatccagtggtcatcccacg 762



to top

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 384 atgaacggtcccacccagaagatccagtggtcgt 417
           ||||| ||||||||||||||||||||||||||||
Sbjct: 836 atgaatggtcccacccagaagatccagtggtcgt 803



to top

>emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1
          Length = 1204

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| ||||| |||||||||||||||||||| ||||| |   |||||||||||
Sbjct: 866 atgaatggtccaacccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatg 807

                                                             
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
           || || || || ||   ||| || ||||||||||| || || ||||||||
Sbjct: 806 atcgcagctccaagactcctagcggggttgatgccagttccggtgatggg 757



to top

>dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane intrinsic protein
           1;1, complete cds
          Length = 1096

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 339 gccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgatgaacggtcccacc 398
           |||||||||||||| |||||||| |  || |||| ||| || |||||||| |||||||||
Sbjct: 921 gccctgatcaccacgacgtggtacagtgctgccaacgctgctccgatgaatggtcccacc 862

                         
Query: 399 cagaagatccagtg 412
           ||||| | ||||||
Sbjct: 861 cagaaaacccagtg 848



to top

>gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, complete cds
          Length = 1158

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| ||||| |||||||||||||||||||| ||||| |   |||||||||||
Sbjct: 866 atgaatggtccaacccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatg 807

                                                             
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
           || || || || ||   ||| || ||||||||||| || || ||||||||
Sbjct: 806 atcgcagctccaagactcctagcggggttgatgccagttccggtgatggg 757



to top

>gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrinsic protein 3 mRNA,
           complete cds
          Length = 1292

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 384 atgaacggtcccacccagaagatccagtggtcgt 417
           ||||| ||||||||||||||||||||||||||||
Sbjct: 878 atgaagggtcccacccagaagatccagtggtcgt 845



to top

>gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic protein PIP1-1 mRNA,
           complete cds
          Length = 1174

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 98/121 (80%)
 Strand = Plus / Minus

                                                                       
Query: 325 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 384
           ||||||| ||||| || |||||||| ||||| |||||||  || || || || || || |
Sbjct: 872 tcttgaatgggatggctctgatcacaaccacatggtagagagctgcaagtgctgccccaa 813

                                                                       
Query: 385 tgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 444
           |||| ||||| |||||||| ||||| || |||||||| || || |  |||||||||||||
Sbjct: 812 tgaatggtccaacccagaatatccaatgatcgtcccatgcgtggtctttgttgtagatga 753

            
Query: 445 t 445
           |
Sbjct: 752 t 752



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                       
Query: 396 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 455
           |||||||||||||||||||| ||||| || || |  |||||| ||||||||||||| || 
Sbjct: 860 acccagaagatccagtggtcatcccatgcatggtctttgttgaagatgatggcggctcca 801

                                                    
Query: 456 agggacctcgccgggttgatgccggtgcccgtgatggggat 496
           ||   ||| |||||||| ||||| || || || ||||||||
Sbjct: 800 agactccttgccgggttaatgccagttccagttatggggat 760



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| |||||   ||| ||||| || ||||  |||||||||| |
Sbjct: 853 atgaagggtccaacccagaaaatccacatgtcatcccaggcatgctctttgttgtagacg 794

                                                                
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           |||||||| || ||   ||| || |||||||||||||| || |||||||||||
Sbjct: 793 atggcggcccccagactcctagcagggttgatgccggttccagtgatggggat 741



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || |||||||||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 750 gaacggaccaacccagaagatccaatggtcatcccacgccttctcgttgttgtagat 694



to top

>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 126/156 (80%), Gaps = 2/156 (1%)
 Strand = Plus / Minus

                                                                       
Query: 327 ttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgatg 386
           ||||||||||| || ||||| || |||  |||||| | ||| ||||| || || ||||||
Sbjct: 176 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 117

                                                                       
Query: 387 aacggtcccacccagaagatccagtggtcgtcccacgcctg-cttcttgttgtagatgat 445
           || || || |||||||| ||||| ||||| ||||| || || |||| |||||||||||||
Sbjct: 116 aatggcccaacccagaaaatccaatggtcatcccatgcatgacttc-tgttgtagatgat 58

                                               
Query: 446 ggcggcgccgagggacctcgccgggttgatgccggt 481
            || || ||||||  ||  || ||||||||||||||
Sbjct: 57  agcagctccgaggctccgagcagggttgatgccggt 22



to top

>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA,
           partial cds
          Length = 380

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||| ||||||||||| |  || | |||||||||||| 
Sbjct: 228 atgaatggtccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgtagata 169

                   
Query: 444 atggcggc 451
           ||||||||
Sbjct: 168 atggcggc 161



to top

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctg 427
           ||||| ||||| |||||||||||||||||||| ||||| |||||
Sbjct: 875 atgaatggtccaacccagaagatccagtggtcatcccatgcctg 832



to top

>gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP1;1 (PIP1;1) mRNA,
           complete cds
          Length = 1244

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 326 cttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccgat 385
           ||||||||| || || ||||| || |||||||||||||  || || || || || || ||
Sbjct: 915 cttgaagggaatggctctgattacaaccacgtggtagagtgctgcaagagctgctccaat 856

                                               
Query: 386 gaacggtcccacccagaagatccagtggtcgtccca 421
            || ||||||||||||||||||||||| || |||||
Sbjct: 855 aaatggtcccacccagaagatccagtgatcatccca 820



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||| ||||| ||||| ||||  |   ||||||||||||  || || 
Sbjct: 902 cccacccagaagatccattggtcatcccaggccttgtcagtgttgtagatgacagcagct 843

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || | |   ||||| ||||||||||||||||| |||||||||||
Sbjct: 842 cccaagcttctcgcggggttgatgccggtgccggtgatggggat 799



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 461   cctcgccgggttgatgccggtgcccgtgatggggat 496
             |||||||||||| ||||||||||| |||||||||||
Sbjct: 84384 cctcgccgggttaatgccggtgccggtgatggggat 84349



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcg 452
           ||||||||||||||||| ||||| ||||| ||||  |   ||||||||||||  || || 
Sbjct: 822 cccacccagaagatccattggtcatcccaggccttgtcagtgttgtagatgacagcagct 763

                                                       
Query: 453 ccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || | |   ||||| ||||||||||||||||| |||||||||||
Sbjct: 762 cccaagcttctcgcggggttgatgccggtgccggtgatggggat 719



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 94/116 (81%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           |||||||| ||||| |||||||| |||||||| || ||||| || ||   ||||||| ||
Sbjct: 820 ccgatgaagggtccaacccagaaaatccagtgatcatcccaagcgtggcccttgttgaag 761

                                                                   
Query: 441 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           ||||| || || |||||   ||| || |||||||||||||| || ||||| |||||
Sbjct: 760 atgatagcagcaccgagactccttgctgggttgatgccggttccagtgattgggat 705



to top

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacg 423
           ||||| |||||||||||||| ||||||||||| |||||||
Sbjct: 800 atgaatggtcccacccagaatatccagtggtcatcccacg 761



to top

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||||||||| ||||| | ||   ||||||| ||||| 
Sbjct: 827 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctcttgttatagatt 768

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||| || ||||    ||| ||||||||||||||||| || |||||
Sbjct: 767 acggcagctccgaaactcctagccgggttgatgccggttccggtgat 721



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 434 gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
           |||||||| || ||||||||||| |  ||||||||| |||||||| ||||| ||||| ||
Sbjct: 588 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 529

              
Query: 494 gat 496
           |||
Sbjct: 528 gat 526



to top

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 ggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcg 449
           ||||| |||||||||||||||||||| | ||| || ||||  | |||||||||||| || 
Sbjct: 860 ggtccaacccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagca 801

                                                          
Query: 450 gcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || || ||   ||| || ||||||||||| || || |||||||||||
Sbjct: 800 gctccaagactcctggcggggttgatgccagttccggtgatggggat 754



to top

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 ggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcg 449
           ||||| |||||||||||||||||||| | ||| || ||||  | |||||||||||| || 
Sbjct: 800 ggtccaacccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagca 741

                                                          
Query: 450 gcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || || ||   ||| || ||||||||||| || || |||||||||||
Sbjct: 740 gctccaagactcctggcggggttgatgccagttccggtgatggggat 694



to top

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 ggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcg 449
           ||||| |||||||||||||||||||| | ||| || ||||  | |||||||||||| || 
Sbjct: 611 ggtccaacccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagca 552

                                                          
Query: 450 gcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || || ||   ||| || ||||||||||| || || |||||||||||
Sbjct: 551 gctccaagactcctggcggggttgatgccagttccggtgatggggat 505



to top

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           ||||| ||||| |||||||| ||||||||||| ||||| ||||  | ||||||||||||
Sbjct: 812 atgaaaggtccaacccagaaaatccagtggtcatcccatgccttttccttgttgtagat 754



to top

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           ||||| ||||| |||||||| ||||||||||| ||||| ||||  | ||||||||||||
Sbjct: 812 atgaaaggtccaacccagaaaatccagtggtcatcccatgccttttccttgttgtagat 754



to top

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
             sequence
          Length = 178692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                         
Query: 434   gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
             |||||||| || ||||||||||| |  ||||||||| |||||||| ||||| ||||| ||
Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712

                
Query: 494   gat 496
             |||
Sbjct: 47713 gat 47715



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                            
Query: 434      gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
                |||||||| || ||||||||||| |  ||||||||| |||||||| ||||| ||||| ||
Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919

                   
Query: 494      gat 496
                |||
Sbjct: 17626918 gat 17626916



to top

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||||||||| ||||| | ||   ||||||| ||||| 
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctcttgttatagatt 753

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||| || ||||    ||| ||||||||||||||||| || |||||
Sbjct: 752 acggcagctccgaaactcctagccgggttgatgccggttccggtgat 706



to top

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||||||||| ||||| | ||   ||||||| ||||| 
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctcttgttatagatt 753

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||| || ||||    ||| ||||||||||||||||| || |||||
Sbjct: 752 acggcagctccgaaactcctagccgggttgatgccggttccggtgat 706



to top

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||||||||| ||||| | ||   ||||||| ||||| 
Sbjct: 803 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctcttgttatagatt 744

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||| || ||||    ||| ||||||||||||||||| || |||||
Sbjct: 743 acggcagctccgaaactcctagccgggttgatgccggttccggtgat 697



to top

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||||||||| ||||| | ||   ||||||| ||||| 
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctcttgttatagatt 753

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||| || ||||    ||| ||||||||||||||||| || |||||
Sbjct: 752 acggcagctccgaaactcctagccgggttgatgccggttccggtgat 706



to top

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||||||||| ||||| | ||   ||||||| ||||| 
Sbjct: 812 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctcttgttatagatt 753

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||| || ||||    ||| ||||||||||||||||| || |||||
Sbjct: 752 acggcagctccgaaactcctagccgggttgatgccggttccggtgat 706



to top

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||||||||| ||||| | ||   ||||||| ||||| 
Sbjct: 504 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctcttgttatagatt 445

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||| || ||||    ||| ||||||||||||||||| || |||||
Sbjct: 444 acggcagctccgaaactcctagccgggttgatgccggttccggtgat 398



to top

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||||||||| ||||| | ||   ||||||| ||||| 
Sbjct: 813 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctcttgttatagatt 754

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||| || ||||    ||| ||||||||||||||||| || |||||
Sbjct: 753 acggcagctccgaaactcctagccgggttgatgccggttccggtgat 707



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcct 426
           ||||| ||||||||||| |||||||||||||| ||||| ||||
Sbjct: 807 atgaaaggtcccacccaaaagatccagtggtcatcccatgcct 765



to top

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||||||||| ||||| | ||   ||||||| ||||| 
Sbjct: 828 atgaatggtcccacccagaatatccagtggtcatcccatggcttgctcttgttatagatt 769

                                                          
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           | ||| || ||||    ||| ||||||||||||||||| || |||||
Sbjct: 768 acggcagctccgaaactcctagccgggttgatgccggttccggtgat 722



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 434 gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
           |||||||| || ||||||||||| |  ||||||||| |||||||| ||||| ||||| ||
Sbjct: 770 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 711

              
Query: 494 gat 496
           |||
Sbjct: 710 gat 708



to top

>gb|AF440271.1| Nicotiana tabacum aquaporin (NtPIP1;1) mRNA, complete cds
          Length = 1083

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           ||||| ||||| |||||||||||||| ||||| ||||| ||||| || |||||| ||||
Sbjct: 866 atgaatggtccaacccagaagatccaatggtcatcccatgcctgttttttgttgaagat 808



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                            
Query: 434      gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
                |||||||| || ||||||||||| |  ||||||||| |||||||| ||||| ||||| ||
Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959

                   
Query: 494      gat 496
                |||
Sbjct: 17635958 gat 17635956



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 465    gccgggttgatgccggtgcccgtgatggggatcgt 499
              |||||||||||||||||||| ||||| ||||||||
Sbjct: 108514 gccgggttgatgccggtgccggtgatcgggatcgt 108480



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 378    gcgccgatgaacggtcccacccagaagatcca 409
              ||||||||||  || |||||||||||||||||
Sbjct: 109110 gcgccgatgaggggccccacccagaagatcca 109079



to top

>dbj|AB002147.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1112

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||| ||||| || || |  | ||||||||||
Sbjct: 836 atgaaaggtccaacccagaaaatccagtggtcatcccatgcgtggtcttggttgtagatg 777

                      
Query: 444 atggcggcgcc 454
           ||||| |||||
Sbjct: 776 atggctgcgcc 766



to top

>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA,
           complete cds
          Length = 1143

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 384 atgaacggtcccacccagaagatccagtggtcgtccca 421
           ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 831 atgaatggtcccacccagaatatccagtggtcatccca 794



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||| ||||| ||||  |  ||||||||||||
Sbjct: 827 atgaatggtccaacccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatg 768

             
Query: 444 at 445
           ||
Sbjct: 767 at 766



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||||||||| |||||||| |||||||| || ||||| ||||  |  ||||||||||||
Sbjct: 811 atgaacggtccaacccagaatatccagtgatcatcccatgccttgtctttgttgtagatg 752

             
Query: 444 at 445
           ||
Sbjct: 751 at 750



to top

>gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds
          Length = 358

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 384 atgaacggtcccacccagaagatccagtggtcgtccca 421
           ||||| ||||| |||||||||||||||||||| |||||
Sbjct: 103 atgaatggtccaacccagaagatccagtggtcatccca 66



to top

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 384 atgaacggtcccacccagaagatccagtggtcgtccca 421
           ||||| ||||||||||| |||||||||||||| |||||
Sbjct: 452 atgaaaggtcccacccaaaagatccagtggtcatccca 415



to top

>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA,
           complete cds
          Length = 889

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 384 atgaacggtcccacccagaagatccagtggtcgtccca 421
           ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 764 atgaatggtcccacccagaatatccagtggtcatccca 727



to top

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 384 atgaacggtcccacccagaagatccagtggtcgtccca 421
           ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 779 atgaatggtcccacccagaatatccagtggtcatccca 742



to top

>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 2C (At2g37180) mRNA, complete cds
          Length = 1151

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 384 atgaacggtcccacccagaagatccagtggtcgtccca 421
           ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 831 atgaatggtcccacccagaatatccagtggtcatccca 794



to top

>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence
          Length = 1060

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 384 atgaacggtcccacccagaagatccagtggtcgtccca 421
           ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 831 atgaatggtcccacccagaatatccagtggtcatccca 794



to top

>gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1b) mRNA, complete cds
          Length = 1119

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 384 atgaacggtcccacccagaagatcca 409
           ||||||||||||||||||||||||||
Sbjct: 851 atgaacggtcccacccagaagatcca 826



to top

>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel
           protein
          Length = 1121

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 384 atgaacggtcccacccagaagatccagtggtcgtccca 421
           ||||| |||||||||||||| ||||||||||| |||||
Sbjct: 814 atgaatggtcccacccagaatatccagtggtcatccca 777



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||||||||| ||||| ||||| || | ||  | |||| |||| 
Sbjct: 826 atgaatggtcccacccagaagatccaatggtcatcccaggctttctgttggttgaagata 767

                                                         
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtga 489
           |  || || |||||   ||| |||||||||||||||||||| ||||
Sbjct: 766 acagcagctccgagactcctggccgggttgatgccggtgccggtga 721



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||||||||||||||| | ||| ||||  |  ||||||||||||
Sbjct: 837 atgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttgtagatg 778

             
Query: 444 at 445
           ||
Sbjct: 777 at 776



to top

>gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipD) mRNA, complete cds
          Length = 1135

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| |||||||||||||| ||||| ||||| ||||| || ||   |||||||||||||
Sbjct: 852 atgaagggtcccacccagaaaatccaatggtcatcccatgcatgggccttgttgtagatg 793

             
Query: 444 at 445
           ||
Sbjct: 792 at 791



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||||||||||||||| | ||| ||||  |  ||||||||||||
Sbjct: 827 atgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttgtagatg 768

             
Query: 444 at 445
           ||
Sbjct: 767 at 766



to top

>dbj|AB002148.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1116

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| ||||| |||||||||||||||||||| || || |  | ||||||||||
Sbjct: 859 atgaatggtccaacccaaaagatccagtggtcgtcccatgcatgttcgtcgttgtagatg 800

                                                             
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggg 493
           || || || || ||   ||| || ||||||||||| || || ||||||||
Sbjct: 799 atcgcagctccaagactcctagcggggttgatgccagttccggtgatggg 750



to top

>ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3);
           water channel AT4G35100 (PIP3) mRNA, complete cds
          Length = 1182

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 796 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic protein (PIP) mRNA,
           complete cds
          Length = 1254

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 384 atgaacggtcccacccagaagatccagtg 412
           ||||| |||||||||||||||||||||||
Sbjct: 887 atgaatggtcccacccagaagatccagtg 859



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                   
Query: 343    tgatcaccaccacgtggtagatcgccgccagcgccgc 379
              |||||||| ||||| ||||||||||||||||| ||||
Sbjct: 685604 tgatcaccgccacgaggtagatcgccgccagcaccgc 685640



to top

>emb|BX842573.1| Mycobacterium tuberculosis H37Rv complete genome; segment 2/13
          Length = 342416

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                   
Query: 343    tgatcaccaccacgtggtagatcgccgccagcgccgc 379
              |||||||| ||||| ||||||||||||||||| ||||
Sbjct: 342248 tgatcaccgccacgaggtagatcgccgccagcaccgc 342284



to top

>emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment
             3/14
          Length = 320050

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                  
Query: 343   tgatcaccaccacgtggtagatcgccgccagcgccgc 379
             |||||||| ||||| ||||||||||||||||| ||||
Sbjct: 18398 tgatcaccgccacgaggtagatcgccgccagcaccgc 18434



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 390 ggtcccacccagaagatccagtggtcgtcccacgcct 426
           ||||| ||||||||||||||||||| |||||| ||||
Sbjct: 777 ggtccaacccagaagatccagtggtggtcccaggcct 741



to top

>gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100) mRNA, complete cds
          Length = 946

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 747 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 691



to top

>gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete
           cds
          Length = 1123

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| |||||||| ||||||||||| | ||| || || | || ||||||||||
Sbjct: 842 atgaatggtccaacccagaatatccagtggtcattccatgcgtgttcctggttgtagatg 783

                
Query: 444 atggc 448
           |||||
Sbjct: 782 atggc 778



to top

>gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100; M4E13.150) mRNA, complete cds
          Length = 1036

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 794 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 738



to top

>gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 mRNA, complete cds
          Length = 1026

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 796 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           mRNA, complete cds
          Length = 1030

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 775 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 719



to top

>emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 787 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 731



to top

>emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB11ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 999

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 785 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 729



to top

>emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 784 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 728



to top

>emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS11ZH09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 779 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 723



to top

>gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete sequence
          Length = 1033

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 796 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds
          Length = 748

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 486 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 430



to top

>gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrinsic protein PIP3 mRNA,
           complete cds
          Length = 1046

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 386 gaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           |||||| || ||||| |||||||| ||||| |||||||||| ||  |||||||||||
Sbjct: 794 gaacggaccaacccaaaagatccattggtcatcccacgccttctcgttgttgtagat 738



to top

>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA,
           complete cds
          Length = 1179

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 468 gggttgatgccggtgcccgtgatggggat 496
           ||||||||||||||||| |||||||||||
Sbjct: 799 gggttgatgccggtgccagtgatggggat 771



to top

>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipE) mRNA, partial cds
          Length = 963

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 468 gggttgatgccggtgcccgtgatggggat 496
           ||||||||||||||||| |||||||||||
Sbjct: 583 gggttgatgccggtgccagtgatggggat 555



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Minus

                                                                       
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatg 443
           ||||| ||||| ||||||||||||||||| || ||||| ||||| |  | |||| |||||
Sbjct: 827 atgaatggtccaacccagaagatccagtgatcatcccatgcctggtcgtggttgaagatg 768

                                                                
Query: 444 atggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggat 496
           || || || || |||  ||  || |||||||||||||| || ||||| |||||
Sbjct: 767 atagcagctccaaggctccgggcggggttgatgccggttccagtgatagggat 715



to top

>gb|AY489268.1| Physcomitrella patens aquaporin PIP 2 mRNA, complete cds
          Length = 1223

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 386 gaacggtcccacccagaagatccagtggtcgtccca 421
           |||||| ||||||||||| |||||||| ||||||||
Sbjct: 813 gaacggacccacccagaaaatccagtgatcgtccca 778



to top

>ref|XM_606158.2| PREDICTED: Bos taurus similar to aquaporin 6 (LOC527759), mRNA
          Length = 846

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 390 ggtcccacccagaagatccagtgg 413
           ||||||||||||||||||||||||
Sbjct: 650 ggtcccacccagaagatccagtgg 627



to top

>emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1
          Length = 1240

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 393 cccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggc 448
           ||||||||||| |||||||| |||||||| || ||   |||||||||||| |||||
Sbjct: 862 cccacccagaaaatccagtgatcgtcccaggcgtgagacttgttgtagataatggc 807



to top

>gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1026

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacg 423
           ||||| ||||| |||||||| ||||||||||| |||||||
Sbjct: 789 atgaatggtccaacccagaatatccagtggtcatcccacg 750



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 126     gaacaggcgacgctgccggcgggc 149
               ||||||||||||||||||||||||
Sbjct: 1380459 gaacaggcgacgctgccggcgggc 1380482



to top

>gb|M97477.1|PEAALDIB Pisum sativum L. aldolase gene, 3' end cds
          Length = 1646

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 390  ggtcccacccagaagatccagtggtcgtccca 421
            ||||| |||||||| |||||||||||||||||
Sbjct: 1410 ggtccaacccagaatatccagtggtcgtccca 1379



to top

>dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane aquaporin 1c,
           complete cds
          Length = 1074

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 440
           |||||||| ||||| ||||| |||| ||| ||||||||||| || |  | ||||||| ||
Sbjct: 820 ccgatgaatggtccaacccaaaagacccaatggtcgtcccaagcgttatccttgttgaag 761

                   
Query: 441 atgatggc 448
           ||||||||
Sbjct: 760 atgatggc 753



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           ||||| ||||| ||||| |||||||| ||||| ||||| |||| ||  |||||||||||
Sbjct: 836 atgaagggtccaacccaaaagatccactggtcatcccaggccttctcattgttgtagat 778



to top

>gb|AC092193.4| Bos taurus clone RP42-459A17, complete sequence
          Length = 258544

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 381    ccgatgaacggtcccacccagaagatc 407
              ||||||||||| |||||||||||||||
Sbjct: 249736 ccgatgaacggccccacccagaagatc 249710



to top

>ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood group) (AQP1), mRNA
          Length = 945

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| || |||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>ref|NM_007472.1| Mus musculus aquaporin 1 (Aqp1), mRNA
          Length = 2627

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 712 atgaacggccccacccagaaaatccagtggt 682



to top

>gb|BT014251.1| Lycopersicon esculentum clone 133453R, mRNA sequence
          Length = 1084

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcct 426
           ||||| ||||| |||||||| ||||||||||| ||||| ||||
Sbjct: 831 atgaatggtccaacccagaaaatccagtggtcatcccatgcct 789



to top

>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence
          Length = 1260

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 396 acccagaagatccagtggtcgtcccacgcct 426
           |||||||| |||||||| |||||||||||||
Sbjct: 854 acccagaaaatccagtgttcgtcccacgcct 824



to top

>gb|AY585335.1| Sus scrofa aquaporin-1 (AQP1) mRNA, complete cds
          Length = 816

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| ||||||||||| | |||||||||
Sbjct: 662 ccgatgaacggccccacccagaaaacccagtggtc 628



to top

>gb|BC007125.1| Mus musculus aquaporin 1, mRNA (cDNA clone MGC:5663 IMAGE:3491276),
           complete cds
          Length = 2614

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 698 atgaacggccccacccagaaaatccagtggt 668



to top

>ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1), mRNA
          Length = 945

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| || |||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>emb|X67948.1|RNCHIP28 R.norvegicus mRNA for channel integral membrane protein 28
          Length = 2623

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           ||||| |||||||||||||| ||||||||||
Sbjct: 713 atgaatggtcccacccagaaaatccagtggt 683



to top

>emb|X70257.1|RNCHIP28K R.norvegicus mRNA for channel integral protein 28k (CHIP28k)
          Length = 810

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           ||||| |||||||||||||| ||||||||||
Sbjct: 653 atgaatggtcccacccagaaaatccagtggt 623



to top

>emb|X71069.1|RNCHIPA R.norvegicus CHIP 28 mRNA
          Length = 1092

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           ||||| |||||||||||||| ||||||||||
Sbjct: 664 atgaatggtcccacccagaaaatccagtggt 634



to top

>emb|BX572597.1| Rhodopseudomonas palustris CGA009 complete genome; segment 5/16
          Length = 349737

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 431    cttgttgtagatgatggcggcgccgag 457
              |||||||| ||||||||||||||||||
Sbjct: 197662 cttgttgtcgatgatggcggcgccgag 197688



to top

>emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial
          Length = 1051

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 390 ggtcccacccagaagatccagtg 412
           |||||||||||||||||||||||
Sbjct: 792 ggtcccacccagaagatccagtg 770



to top

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 432 ttgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgat 490
           |||||| |||| | ||||||||||| |  |||||||||||| || |||||||| |||||
Sbjct: 465 ttgttgaagatcacggcggcgccgaagctcctcgccgggttaatcccggtgccggtgat 407



to top

>dbj|AK128905.1| Mus musculus cDNA fis, clone TRACH2020336, highly similar to
           AQUAPORIN-CHIP
          Length = 2626

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 712 atgaacggccccacccagaaaatccagtggt 682



to top

>ref|NM_012778.1| Rattus norvegicus aquaporin 1 (Aqp1), mRNA
          Length = 2623

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           ||||| |||||||||||||| ||||||||||
Sbjct: 713 atgaatggtcccacccagaaaatccagtggt 683



to top

>dbj|AK158226.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930043L24 product:aquaporin 1, full
           insert sequence
          Length = 2629

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaacggccccacccagaaaatccagtggt 683



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           ||||| ||||| ||||| |||||||| ||||| ||||| |||| ||  |||||||||||
Sbjct: 832 atgaagggtccaacccaaaagatccactggtcatcccaggccttctcattgttgtagat 774



to top

>dbj|AK172361.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830204G14 product:aquaporin 1, full
           insert sequence
          Length = 2628

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK158389.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930113F12 product:aquaporin 1, full
           insert sequence
          Length = 2628

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK157333.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830211K06 product:aquaporin 1, full
           insert sequence
          Length = 2629

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK166280.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN
           full-length enriched library, clone:G830031A05
           product:aquaporin 1, full insert sequence
          Length = 2628

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK171627.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830001F09 product:aquaporin 1, full
           insert sequence
          Length = 1736

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK081886.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130084O08 product:aquaporin 1, full
           insert sequence
          Length = 2628

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaacggccccacccagaaaatccagtggt 683



to top

>dbj|AK086688.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
           library, clone:D930045N08 product:aquaporin 1, full
           insert sequence
          Length = 2633

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 713 atgaacggccccacccagaaaatccagtggt 683



to top

>ref|NM_214454.1| Sus scrofa aquaporin 1 (AQP1), mRNA
          Length = 816

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| ||||||||||| | |||||||||
Sbjct: 662 ccgatgaacggccccacccagaaaacccagtggtc 628



to top

>gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-1 mRNA, partial cds
          Length = 477

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| || |||||||| |||||||||||
Sbjct: 341 ccgatgaacggcccgacccagaaaatccagtggtc 307



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           ||||||||||| |||||||| ||||| || || ||||| ||||  || |||||||||||
Sbjct: 854 atgaacggtccgacccagaaaatccactgatcatcccaggccttgttgttgttgtagat 796



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 384 atgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagat 442
           ||||| ||||| ||||| |||||||| ||||| ||||| |||| ||  |||||||||||
Sbjct: 386 atgaagggtccaacccaaaagatccactggtcatcccaggccttctcattgttgtagat 328



to top

>gb|BC090068.1| Rattus norvegicus aquaporin 1, mRNA (cDNA clone MGC:93653
           IMAGE:7190406), complete cds
          Length = 2637

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           ||||| |||||||||||||| ||||||||||
Sbjct: 695 atgaatggtcccacccagaaaatccagtggt 665



to top

>gb|L02914.1|MUSGROEARB Mus musculus aquaporin-1 (AQ1) mRNA, complete cds
          Length = 2627

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           |||||||| ||||||||||| ||||||||||
Sbjct: 712 atgaacggccccacccagaaaatccagtggt 682



to top

>gb|L07268.1|RATCHIP28A Rattus norvegicus water channel (CHIP28) mRNA, complete cds
          Length = 1403

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 384 atgaacggtcccacccagaagatccagtggt 414
           ||||| |||||||||||||| ||||||||||
Sbjct: 704 atgaatggtcccacccagaaaatccagtggt 674



to top

>gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, complete cds
          Length = 1278

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 381  ccgatgaacggtcccacccagaagatccagtggtc 415
            |||||||| |||||||||||||| ||||| |||||
Sbjct: 1012 ccgatgaagggtcccacccagaaaatccaatggtc 978



to top

>dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, partial cds
          Length = 273

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| || |||||||| |||||||||||
Sbjct: 233 ccgatgaacggcccgacccagaaaatccagtggtc 199



to top

>dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, complete cds
          Length = 945

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 381 ccgatgaacggtcccacccagaagatccagtggtc 415
           ||||||||||| || |||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,797,292
Number of Sequences: 3902068
Number of extensions: 3797292
Number of successful extensions: 86841
Number of sequences better than 10.0: 390
Number of HSP's better than 10.0 without gapping: 386
Number of HSP's successfully gapped in prelim test: 8
Number of HSP's that attempted gapping in prelim test: 84211
Number of HSP's gapped (non-prelim): 2572
length of query: 501
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 479
effective length of database: 17,147,199,772
effective search space: 8213508690788
effective search space used: 8213508690788
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top