ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart24h10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X84056.1|HVPAF93 H.vulgare paf93 gene 825 0.0
2gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, c... 476 e-131
3gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein ... 383 e-103
4gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein ... 365 8e-98
5gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (... 365 8e-98
6gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence 351 1e-93
7gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, com... 347 2e-92
8emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin... 305 6e-80
9gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial seq... 121 2e-24
10gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydratio... 105 1e-19
11gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type d... 105 1e-19
12dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
13dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
14dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
15dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 1e-19
16dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds 105 1e-19
17gb|AY105067.1| Zea mays PCO081051 mRNA sequence 88 3e-14
18gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence 64 4e-07
19gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds 64 4e-07
20gb|AY111114.1| Zea mays CL2452_1 mRNA sequence 64 4e-07
21emb|AJ439990.1|OSA439990 Oryza sativa partial mRNA for putative ... 60 6e-06
22emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chr... 48 0.024
23gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, com... 42 1.5
24gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 ... 42 1.5
25gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 ... 42 1.5
26gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ... 42 1.5
27gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ... 42 1.5
28gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ... 42 1.5
29gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ... 42 1.5
30gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 42 1.5
31gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ... 42 1.5
32gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 42 1.5
33gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 42 1.5
34gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 42 1.5
35gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 42 1.5
36gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 42 1.5
37gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 42 1.5
38gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ... 42 1.5
39gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 42 1.5
40gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 42 1.5
41gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 42 1.5
42gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 42 1.5
43gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 42 1.5
44gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 42 1.5
45gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 42 1.5
46gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 42 1.5
47gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 42 1.5
48gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 42 1.5
49gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 42 1.5
50gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 42 1.5
51emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on ch... 42 1.5
52emb|AL772148.6| Zebrafish DNA sequence from clone CH211-153C20 i... 42 1.5
53gb|DQ015701.1| Ovis aries endothelial nitric oxide synthase mRNA... 42 1.5
54gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group ... 42 1.5
55emb|BX322785.6| Zebrafish DNA sequence from clone DKEYP-78B1 in ... 42 1.5
56gb|AC147034.2| Mus musculus BAC clone RP23-189C2 from chromosome... 42 1.5
57gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, com... 42 1.5
58gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, c... 42 1.5
59gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, com... 42 1.5
60gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, c... 42 1.5
61gb|M99057.1|BOVNIOXSY Bovine nitric oxide synthase mRNA, complet... 42 1.5
62gb|M89952.1|BOVECNOS Bos taurus endothelial nitric oxide synthas... 42 1.5
63gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.9
64gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com... 40 5.9
65gb|AC164098.4| Mus musculus BAC clone RP23-341D24 from chromosom... 40 5.9
66ref|XM_760938.1| Theileria parva strain Muguga chromosome 1 hypo... 40 5.9
67gb|AC144479.1| Pan troglodytes BAC clone RP43-126P12 from 7, com... 40 5.9
68emb|CR339044.19| Zebrafish DNA sequence from clone CH211-122G23 ... 40 5.9
69emb|BX927212.11| Zebrafish DNA sequence from clone CH211-262A5 i... 40 5.9
70dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
71dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
72gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group ... 40 5.9
73dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
74dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, ... 40 5.9
75gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 5.9
76dbj|BS000095.1| Pan troglodytes chromosome 22 clone:RP43-177D07,... 40 5.9
77dbj|BS000094.1| Pan troglodytes chromosome 22 clone:PTB-240N13, ... 40 5.9
78emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible ... 40 5.9
79emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 40 5.9
80emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) 40 5.9
81emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) 40 5.9
82gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds 40 5.9
83gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, com... 40 5.9
84gb|AC140483.3| Mus musculus BAC clone RP24-145A22 from 1, comple... 40 5.9
85gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, c... 40 5.9
86dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 5.9
87dbj|AP000469.3| Homo sapiens genomic DNA, chromosome 21q, clone:... 40 5.9
88gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 5.9 
>emb|X84056.1|HVPAF93 H.vulgare paf93 gene
          Length = 1154

 Score =  825 bits (416), Expect = 0.0
 Identities = 428/432 (99%)
 Strand = Plus / Minus

                                                                        
Query: 5    ggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagtgccc 64
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 ggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagtgccc 1095

                                                                        
Query: 65   gtaataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaag 124
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1094 gtaataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaag 1035

                                                                        
Query: 125  cccgtatacccaaactgaacacaagcatccgtcacctaacgggcttcacagaccggacct 184
            |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 1034 cccgtatacccaaactgaacacaagcatccgtcacctaacggacttcacagaccggacct 975

                                                                        
Query: 185  tcaaagacgatcaatccctccatcttgacacggatttaaacttaaagcaaacacgacaca 244
            |||||||||||||||||||||||||||||||||| ||| || ||||||||||||||||||
Sbjct: 974  tcaaagacgatcaatccctccatcttgacacggacttagacgtaaagcaaacacgacaca 915

                                                                        
Query: 245  cgccaacaatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctct 304
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 914  cgccaacaatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctct 855

                                                                        
Query: 305  gggcttgtgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaacc 364
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 854  gggcttgtgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaacc 795

                                                                        
Query: 365  gggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgct 424
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 794  gggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgct 735

                        
Query: 425  cacctcctcggc 436
            ||||||||||||
Sbjct: 734  cacctcctcggc 723
to top
>gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, complete cds
          Length = 2254

 Score =  476 bits (240), Expect = e-131
 Identities = 243/244 (99%)
 Strand = Plus / Minus

                                                                        
Query: 193  gatcaatccctccatcttgacacggatttaaacttaaagcaaacacgacacacgccaaca 252
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 2246 gatcaatccctccatcttgacacggacttaaacttaaagcaaacacgacacacgccaaca 2187

                                                                        
Query: 253  atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 312
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2186 atttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgt 2127

                                                                        
Query: 313  gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 372
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2126 gctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagct 2067

                                                                        
Query: 373  tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 432
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2066 tgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcct 2007

                
Query: 433  cggc 436
            ||||
Sbjct: 2006 cggc 2003
to top
>gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein WCOR410c (Wcor410c) mRNA,
            complete cds
          Length = 1242

 Score =  383 bits (193), Expect = e-103
 Identities = 281/305 (92%), Gaps = 4/305 (1%)
 Strand = Plus / Minus

                                                                        
Query: 134  ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 192
            |||||||||| ||||||||||||||||  |||||||||||| ||||| ||||||||||||
Sbjct: 1037 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 978

                                                                        
Query: 193  gatcaatccctcc-atcttgacacggatttaaacttaaagcaaacacgacacacgccaac 251
            |||||| |||||| | ||||||||  | |||| | |||||||||||| ||||||||||||
Sbjct: 977  gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 919

                                                                        
Query: 252  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 311
            |||| ||| |||||||||| | |||||||||| ||||||||||||||||| |||||||||
Sbjct: 918  aattcaatcgaggtccggtcacgagtctcggg-cacggcggcgatcaagcgctgggcttg 860

                                                                        
Query: 312  tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 371
            |||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 859  tgctcgcctgcagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800

                                                                        
Query: 372  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 431
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 799  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 740

                 
Query: 432  tcggc 436
            |||||
Sbjct: 739  tcggc 735



 Score =  123 bits (62), Expect = 5e-25
 Identities = 105/116 (90%), Gaps = 5/116 (4%)
 Strand = Plus / Minus

                                                                        
Query: 8    ggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagtgcccgta 67
            |||||||||||||||||||||||||||||||||||  ||||||||||| ||| ||||   
Sbjct: 1138 ggaaatctttaatatcaaggcataatgcccagcaaataaccaatacac-aagcgccc--- 1083

                                                                    
Query: 68   ataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 123
            |||||||| ||| |||||| |||||||||||||||||||||||| |||||||||||
Sbjct: 1082 ataataagtaaacaaactt-aacaacatccaggacctgactctgaaccaaactgaa 1028
to top
>gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein WCOR410b (Wcor410b) mRNA,
            complete cds
          Length = 1181

 Score =  365 bits (184), Expect = 8e-98
 Identities = 270/296 (91%), Gaps = 2/296 (0%)
 Strand = Plus / Minus

                                                                        
Query: 142  aacacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagacgatcaatcc 201
            |||| ||||| |||||||  |||||||||||| |||||||||||||||||||||||| ||
Sbjct: 1038 aacagaagcacccgtcactcaacgggcttcacggaccggaccttcaaagacgatcaaccc 979

                                                                        
Query: 202  ctcc-atcttgacacggatttaaacttaaagcaaacacgacacacgccaacaatttaatg 260
            |||| | ||||||||  | ||| || |||||||||||| |||||||||||||||| ||| 
Sbjct: 978  ctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaacaattcaatc 919

                                                                        
Query: 261  gaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcgcct 320
            |||||||||| | | |||||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 918  gaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttgtgctcgcct 860

                                                                        
Query: 321  gaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtccatg 380
            | || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 859  gtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagcttgtccatg 800

                                                                    
Query: 381  atcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggc 436
            ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 799  atcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcctcggc 744



 Score =  113 bits (57), Expect = 5e-22
 Identities = 57/57 (100%)
 Strand = Plus / Minus

                                                                     
Query: 1    actgggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaa 57
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1145 actgggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaa 1089
to top
>gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (WCOR410) mRNA, complete
            cds
          Length = 1136

 Score =  365 bits (184), Expect = 8e-98
 Identities = 277/304 (91%), Gaps = 3/304 (0%)
 Strand = Plus / Minus

                                                                        
Query: 134  ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 192
            |||||||||| || ||||| |||||||  |||||||||||| ||||||||||||||||||
Sbjct: 1038 ccaaactgaaacagaagcacccgtcactgaacgggcttcacggaccggaccttcaaagac 979

                                                                        
Query: 193  gatcaatccctcc-atcttgacacggatttaaacttaaagcaaacacgacacacgccaac 251
            |||||| |||||| | ||||||||  | ||| || |||||||||||| ||||||||||||
Sbjct: 978  gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 919

                                                                        
Query: 252  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 311
            |||| ||| |||||||||| | | |||||||| ||||||||||||||||| |||||||||
Sbjct: 918  aattcaatcgaggtccggtcacgggtctcggg-cacggcggcgatcaagcgctgggcttg 860

                                                                        
Query: 312  tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 371
            |||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 859  tgctcgcctgtagcggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 800

                                                                        
Query: 372  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 431
            |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 799  ttgtccatgatcttgcccagcaggcccttcttctccttcgcgtcagggctgctcacctcc 740

                
Query: 432  tcgg 435
            ||||
Sbjct: 739  tcgg 736



 Score =  121 bits (61), Expect = 2e-24
 Identities = 104/116 (89%), Gaps = 8/116 (6%)
 Strand = Plus / Minus

                                                                        
Query: 8    ggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagtgcccgta 67
            |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||   
Sbjct: 1136 ggaaatctttaatatcaaggcataatgcccagcaataaaccaatacac-aagtgccc--- 1081

                                                                    
Query: 68   ataataagcaaataaacttaaacaacatccaggacctgactctggaccaaactgaa 123
               ||||| ||| ||||||  ||||||||||||||||||||||| |||||||||||
Sbjct: 1080 ---ataagtaaacaaactt-gacaacatccaggacctgactctgaaccaaactgaa 1029
to top
>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence
          Length = 1130

 Score =  351 bits (177), Expect = 1e-93
 Identities = 277/305 (90%), Gaps = 4/305 (1%)
 Strand = Plus / Minus

                                                                        
Query: 134  ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 192
            |||||||||| ||||| ||||||||||  ||||||||||||||||||||||||||| |||
Sbjct: 1009 ccaaactgaaacacaaacatccgtcactgaacgggcttcacagaccggaccttcaa-gac 951

                                                                        
Query: 193  gatcaatccctcc-atcttgacacggatttaaacttaaagcaaacacgacacacgccaac 251
            |||||| |||||| | ||||||||  | ||| || |||||||||||| ||||||||||||
Sbjct: 950  gatcaacccctcccaccttgacaccaacttagacgtaaagcaaacacaacacacgccaac 891

                                                                        
Query: 252  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 311
            |||| ||| ||| |||||| | |||||||||| |||||||||||| |||| |||||||||
Sbjct: 890  aattcaatcgagctccggtcacgagtctcggg-cacggcggcgattaagcgctgggcttg 832

                                                                        
Query: 312  tgctcgcctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagc 371
            |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 831  tgctcgcctgcaggggcggcggccttgtcctcctcccctgtcttgtggtaaccaggcagc 772

                                                                        
Query: 372  ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 431
            |||||||||||||||||||| | ||||||||||||||||||||| ||||||||||| |||
Sbjct: 771  ttgtccatgatcttgcccagcaagcccttcttctccttcgcgtcagggctgctcacttcc 712

                 
Query: 432  tcggc 436
            |||||
Sbjct: 711  tcggc 707



 Score =  143 bits (72), Expect = 5e-31
 Identities = 112/123 (91%), Gaps = 8/123 (6%)
 Strand = Plus / Minus

                                                                        
Query: 1    actgggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacacaaagt 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1114 actgggcggaaatctttaatatcaaggcataatgcccagcaataaaccaatacac-aagt 1056

                                                                        
Query: 61   gcccgtaataataagcaaataaacttaaacaacatccaggacctgactctggaccaaact 120
            ||||      ||||| ||| |||||| |||||||||||||||||||||||| ||||||||
Sbjct: 1055 gccc------ataagtaaacaaactt-aacaacatccaggacctgactctgaaccaaact 1003

               
Query: 121  gaa 123
            |||
Sbjct: 1002 gaa 1000
to top
>gb|AF181458.1|AF181458 Hordeum vulgare dehydrin (Dhn8) mRNA, complete cds
          Length = 808

 Score =  347 bits (175), Expect = 2e-92
 Identities = 178/179 (99%)
 Strand = Plus / Minus

                                                                       
Query: 258 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 317
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 808 atggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttgtgctcg 749

                                                                       
Query: 318 cctgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcagcttgtcc 377
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 748 cctgaaggggcggcggccttgtcctcctcctctgtcttgtggtaaccgggcagcttgtcc 689

                                                                      
Query: 378 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggc 436
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 688 atgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcctcggc 630
to top
>emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin (dhn11 gene)
          Length = 1127

 Score =  305 bits (154), Expect = 6e-80
 Identities = 273/306 (89%), Gaps = 5/306 (1%)
 Strand = Plus / Minus

                                                                        
Query: 134  ccaaactgaa-cacaagcatccgtcacctaacgggcttcacagaccggaccttcaaagac 192
            |||||||||| ||||||||||||||||  |||||||||||| ||||| ||||||||||||
Sbjct: 1035 ccaaactgaaacacaagcatccgtcactgaacgggcttcacggaccgaaccttcaaagac 976

                                                                        
Query: 193  gatcaatccctcc-atcttgacacggatttaaacttaaagcaaacacgacacacgccaac 251
            |||||| |||||| | ||||||||  | |||| | |||||||||||| ||||||||||||
Sbjct: 975  gatcaacccctcccaccttgacaccaacttaa-cgtaaagcaaacacaacacacgccaac 917

                                                                        
Query: 252  aatttaatggaggtccggtgatgagtctcggggcacggcggcgatcaagctctgggcttg 311
            |||| ||| | |||||||| | |||||||||| |||||||||| ||||||  |||| |||
Sbjct: 916  aattcaatcggggtccggtcacgagtctcggg-cacggcggcgttcaagcgttgggattg 858

                                                                        
Query: 312  tgctcgcc-tgaaggggcggcggccttgtcctcctcccctgtcttgtggtaaccgggcag 370
            |||||||| || || |||||||| |||||||||||||||||||||||||||||| |||||
Sbjct: 857  tgctcgccctgcagcggcggcggacttgtcctcctcccctgtcttgtggtaaccaggcag 798

                                                                        
Query: 371  cttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctc 430
            ||||||||||||||||||||||||||||||||||||||||| ||| ||| || |||||||
Sbjct: 797  cttgtccatgatcttgcccagtaggcccttcttctccttcgggtcagggatggtcacctc 738

                  
Query: 431  ctcggc 436
            ||||||
Sbjct: 737  ctcggc 732



 Score =  105 bits (53), Expect = 1e-19
 Identities = 96/107 (89%), Gaps = 5/107 (4%)
 Strand = Plus / Minus

                                                                        
Query: 17   taatatcaaggcataatgcccagcaataaaccaatacacaaagtgcccgtaataataagc 76
            ||||||||||||||||||||||||||  ||||||||||| ||| ||||   |||||||| 
Sbjct: 1127 taatatcaaggcataatgcccagcaaataaccaatacac-aagcgccc---ataataagt 1072

                                                           
Query: 77   aaataaacttaaacaacatccaggacctgactctggaccaaactgaa 123
            ||| |||||| |||||||||||||||||||||||| |||||||||||
Sbjct: 1071 aaacaaactt-aacaacatccaggacctgactctgaaccaaactgaa 1026
to top
>gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial sequence
          Length = 391

 Score =  121 bits (61), Expect = 2e-24
 Identities = 64/65 (98%)
 Strand = Plus / Minus

                                                                       
Query: 372 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtccgggctgctcacctcc 431
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 390 ttgtccatgatcttgcccagtaggcccttcttctccttcgcgtcagggctgctcacctcc 331

                
Query: 432 tcggc 436
           |||||
Sbjct: 330 tcggc 326
to top
>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible
           protein 1 mRNA, complete cds
          Length = 1315

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 353 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 412
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 918 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 859

                                
Query: 413 gtccgggctgctcacctcctc 433
            |||||||||||||| |||||
Sbjct: 858 atccgggctgctcacttcctc 838



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 2    ctgggcggaaatctttaatatcaaggcataatgcccagcaataaaccaataca 54
            |||||| |||||| |||||| ||||||| ||||||||||   |||||||||||
Sbjct: 1265 ctgggcagaaatcattaataccaaggcagaatgcccagcccaaaaccaataca 1213



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 363 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 408
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 734 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 689
to top
>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1)
           mRNA, complete cds
          Length = 1117

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 353 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 412
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 908 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 849

                                
Query: 413 gtccgggctgctcacctcctc 433
            |||||||||||||| |||||
Sbjct: 848 atccgggctgctcacttcctc 828



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 363 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 408
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 724 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 679
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                            
Query: 353      cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 412
                |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 27184369 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 27184428

                                     
Query: 413      gtccgggctgctcacctcctc 433
                 |||||||||||||| |||||
Sbjct: 27184429 atccgggctgctcacttcctc 27184449



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                     
Query: 2        ctgggcggaaatctttaatatcaaggcataatgcccagcaataaaccaataca 54
                |||||| |||||| |||||| ||||||| ||||||||||   |||||||||||
Sbjct: 27184022 ctgggcagaaatcattaataccaaggcagaatgcccagcccaaaaccaataca 27184074



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                              
Query: 363      ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 408
                ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 27184553 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 27184598
to top
>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1725_H08
          Length = 155431

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                         
Query: 353   cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 412
             |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 80818 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 80877

                                  
Query: 413   gtccgggctgctcacctcctc 433
              |||||||||||||| |||||
Sbjct: 80878 atccgggctgctcacttcctc 80898



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 363   ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 408
             ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 81002 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 81047
to top
>dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0684A08
          Length = 137841

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                         
Query: 353   cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 412
             |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 35040 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 35099

                                  
Query: 413   gtccgggctgctcacctcctc 433
              |||||||||||||| |||||
Sbjct: 35100 atccgggctgctcacttcctc 35120



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 2     ctgggcggaaatctttaatatcaaggcataatgcccagcaataaaccaataca 54
             |||||| |||||| |||||| ||||||| ||||||||||   |||||||||||
Sbjct: 34693 ctgggcagaaatcattaataccaaggcagaatgcccagcccaaaaccaataca 34745



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 363   ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 408
             ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 35224 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 35269
to top
>dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N13, full
           insert sequence
          Length = 1292

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 353 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 412
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 930 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 871

                                
Query: 413 gtccgggctgctcacctcctc 433
            |||||||||||||| |||||
Sbjct: 870 atccgggctgctcacttcctc 850



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 2    ctgggcggaaatctttaatatcaaggcataatgcccagcaataaaccaataca 54
            |||||| |||||| |||||| ||||||| ||||||||||   |||||||||||
Sbjct: 1277 ctgggcagaaatcattaataccaaggcagaatgcccagcccaaaaccaataca 1225



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 363 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 408
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 746 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 701
to top
>dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds
          Length = 680

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 353 cttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcgc 412
           |||||||||||||||||| || |||||||||||||||||||  ||||||||||||||| |
Sbjct: 351 cttgtggtaaccgggcagtttctccatgatcttgcccagtatacccttcttctccttccc 292

                                
Query: 413 gtccgggctgctcacctcctc 433
            |||||||||||||| |||||
Sbjct: 291 atccgggctgctcacttcctc 271



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 363 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctcct 408
           ||||||||||| ||| |||||||| | || | ||||||||||||||
Sbjct: 167 ccgggcagcttctccttgatcttgtcgaggaagcccttcttctcct 122
to top
>gb|AY105067.1| Zea mays PCO081051 mRNA sequence
          Length = 1398

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                       
Query: 352 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttcttctccttcg 411
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||||||||  
Sbjct: 928 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttcttctccttgc 869

                           
Query: 412 cgtccgggctgctcac 427
           | ||||||||||||||
Sbjct: 868 catccgggctgctcac 853
to top
>gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence
          Length = 722

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 352 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 403
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||
Sbjct: 353 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 302
to top
>gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds
          Length = 1277

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 352 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 403
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||
Sbjct: 864 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 813
to top
>gb|AY111114.1| Zea mays CL2452_1 mRNA sequence
          Length = 1256

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 352 tcttgtggtaaccgggcagcttgtccatgatcttgcccagtaggcccttctt 403
           |||||||||| ||||| | ||||||||||||||||||||| | |||||||||
Sbjct: 843 tcttgtggtagccgggtatcttgtccatgatcttgcccagcaagcccttctt 792
to top
>emb|AJ439990.1|OSA439990 Oryza sativa partial mRNA for putative cold acclimation protein
           (cap-L gene)
          Length = 504

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 353 cttgtggtaaccgggcagcttgtccatgatcttgcccagta 393
           |||||||||||||||||| || | |||||||||||||||||
Sbjct: 123 cttgtggtaaccgggcagtttctncatgatcttgcccagta 83
to top
>emb|AL808127.4| Mouse DNA sequence from clone RP23-263L18 on chromosome 2, complete
              sequence
          Length = 205838

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 103    ctgactctggaccaaactgaagcc 126
              ||||||||||||||||||||||||
Sbjct: 138293 ctgactctggaccaaactgaagcc 138316
to top
>gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, complete sequence
          Length = 156547

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 132    acccaaactgaacacaagcat 152
              |||||||||||||||||||||
Sbjct: 134241 acccaaactgaacacaagcat 134261
to top
>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957
to top
>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348
to top
>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348
to top
>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957
to top
>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1061

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 366  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 1003 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 963
to top
>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957
to top
>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348
to top
>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 388 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 348
to top
>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957
to top
>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 991 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 951
to top
>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 366 ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 997 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 957
to top
>emb|AL138725.19| Human DNA sequence from clone RP11-528A10 on chromosome 6 Contains an
             IMPDH1 (IMP (inosine monophosphate) dehydrogenase 1)
             pseudogene, an RNA helicase pseudogene and part of a novel
             gene similar to KIAA0161, complete sequence
          Length = 165653

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 384   ttgcccagtaggcccttcttc 404
             |||||||||||||||||||||
Sbjct: 48697 ttgcccagtaggcccttcttc 48717
to top
>emb|AL772148.6| Zebrafish DNA sequence from clone CH211-153C20 in linkage group 24
              Contains part of a novel gene similar to human DECR2
              (peroxisomal 2,4-dienoyl CoA reductase 2),  a novel gene
              similar to human KIAA0665, a novel gene similar to human
              KIAA0683, a novel gene similar to human KIAA0590, part of a
              novel gene and three CpG islands, complete sequence
          Length = 161218

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 40     caataaaccaatacacaaagt 60
              |||||||||||||||||||||
Sbjct: 156591 caataaaccaatacacaaagt 156571
to top
>gb|DQ015701.1| Ovis aries endothelial nitric oxide synthase mRNA, complete cds
          Length = 4097

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 325  gggcggcggccttgtcctcctcccc 349
            |||||||||||||| ||||||||||
Sbjct: 2195 gggcggcggccttggcctcctcccc 2171
to top
>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2)
            mRNA, complete cds
          Length = 1518

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 366  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 1282 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1242
to top
>emb|BX322785.6| Zebrafish DNA sequence from clone DKEYP-78B1 in linkage group 24,
             complete sequence
          Length = 176602

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 40    caataaaccaatacacaaagt 60
             |||||||||||||||||||||
Sbjct: 34762 caataaaccaatacacaaagt 34782
to top
>gb|AC147034.2| Mus musculus BAC clone RP23-189C2 from chromosome 7, complete sequence
          Length = 213581

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 28    cataatgcccagcaataaacc 48
             |||||||||||||||||||||
Sbjct: 49844 cataatgcccagcaataaacc 49824
to top
>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds
          Length = 3447

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 366  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 2313 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2273
to top
>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds
          Length = 2814

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 366  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 2311 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2271
to top
>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds
          Length = 1243

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 366  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 1213 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 1173
to top
>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds
          Length = 2432

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 366  ggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
            |||||||||||| |||||||| |||  |||| |||||||||
Sbjct: 2306 ggcagcttgtccttgatcttgtccatgaggctcttcttctc 2266
to top
>gb|M99057.1|BOVNIOXSY Bovine nitric oxide synthase mRNA, complete cds
          Length = 4096

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 325  gggcggcggccttgtcctcctcccc 349
            |||||||||||||| ||||||||||
Sbjct: 2196 gggcggcggccttggcctcctcccc 2172
to top
>gb|M89952.1|BOVECNOS Bos taurus endothelial nitric oxide synthase mRNA, complete cds
          Length = 3738

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 325  gggcggcggccttgtcctcctcccc 349
            |||||||||||||| ||||||||||
Sbjct: 2186 gggcggcggccttggcctcctcccc 2162
to top
>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0034E03 map near 50283S, complete sequence
          Length = 134074

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 363   ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
             ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 60504 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 60461
to top
>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 328   cggcggccttgtcctcctcc 347
             ||||||||||||||||||||
Sbjct: 72754 cggcggccttgtcctcctcc 72735
to top
>gb|AC164098.4| Mus musculus BAC clone RP23-341D24 from chromosome 1, complete sequence
          Length = 221754

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 70     aataagcaaataaacttaaa 89
              ||||||||||||||||||||
Sbjct: 153660 aataagcaaataaacttaaa 153679
to top
>ref|XM_760938.1| Theileria parva strain Muguga chromosome 1 hypothetical protein
            (TP01_0511) partial mRNA
          Length = 5448

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 77   aaataaacttaaacaacatc 96
            ||||||||||||||||||||
Sbjct: 4865 aaataaacttaaacaacatc 4884
to top
>gb|AC144479.1| Pan troglodytes BAC clone RP43-126P12 from 7, complete sequence
          Length = 211515

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 65     gtaataataagcaaataaacttaaacaa 92
              |||||||||||||||| || ||||||||
Sbjct: 140814 gtaataataagcaaattaaattaaacaa 140841
to top
>emb|CR339044.19| Zebrafish DNA sequence from clone CH211-122G23 in linkage group 5,
             complete sequence
          Length = 177385

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 66    taataataagcaaataaacttaaa 89
             |||||||||| |||||||||||||
Sbjct: 63646 taataataagtaaataaacttaaa 63623
to top
>emb|BX927212.11| Zebrafish DNA sequence from clone CH211-262A5 in linkage group 5,
             complete sequence
          Length = 157791

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 66    taataataagcaaataaacttaaa 89
             |||||||||| |||||||||||||
Sbjct: 81135 taataataagtaaataaacttaaa 81112
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 363      ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
                ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 14766556 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14766599
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 376      ccatgatcttgcccagtagg 395
                ||||||||||||||||||||
Sbjct: 42400771 ccatgatcttgcccagtagg 42400752
to top
>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3)
           mRNA, complete cds
          Length = 793

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 363 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 430
to top
>dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0483G10
          Length = 190721

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 376   ccatgatcttgcccagtagg 395
             ||||||||||||||||||||
Sbjct: 60109 ccatgatcttgcccagtagg 60090
to top
>dbj|AB105039.1| Daucus carota CAISE1 mRNA for dehydrin protein, complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 362 accgggcagcttgtccatgatctt 385
           |||||||||||||||| |||||||
Sbjct: 506 accgggcagcttgtccttgatctt 483
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 398     cttcttctccttcgcgtccgggct 421
               |||||||||||||||| |||||||
Sbjct: 4529751 cttcttctccttcgcggccgggct 4529728
to top
>dbj|BS000095.1| Pan troglodytes chromosome 22 clone:RP43-177D07, map 22, complete
            sequences
          Length = 181678

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 97   caggacctgactctggaccaaactgaag 124
            |||||| ||||||||||||| |||||||
Sbjct: 3276 caggacttgactctggaccagactgaag 3249
to top
>dbj|BS000094.1| Pan troglodytes chromosome 22 clone:PTB-240N13, map 22, complete
              sequences
          Length = 155513

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 97     caggacctgactctggaccaaactgaag 124
              |||||| ||||||||||||| |||||||
Sbjct: 131204 caggacttgactctggaccagactgaag 131177
to top
>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21
          Length = 2537

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 363  ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
            ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 2163 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 2120
to top
>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16
          Length = 814

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 363 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 462
to top
>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18)
          Length = 1049

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 363 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 699
to top
>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17)
          Length = 812

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 363 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 492
to top
>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds
          Length = 864

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 363 ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
           ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 572 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 529
to top
>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds
          Length = 1575

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 363  ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
            ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1307
to top
>gb|AC140483.3| Mus musculus BAC clone RP24-145A22 from 1, complete sequence
          Length = 176649

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     aataagcaaataaacttaaa 89
              ||||||||||||||||||||
Sbjct: 121495 aataagcaaataaacttaaa 121476
to top
>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds
          Length = 1560

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 363  ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
            ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 1270
to top
>dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, section 34/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 97    caggacctgactctggaccaaactgaag 124
             |||||| ||||||||||||| |||||||
Sbjct: 80688 caggacttgactctggaccagactgaag 80661
to top
>dbj|AP000469.3| Homo sapiens genomic DNA, chromosome 21q, clone:RP11-132H24, complete
              sequence
          Length = 136804

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 97     caggacctgactctggaccaaactgaag 124
              |||||| ||||||||||||| |||||||
Sbjct: 102805 caggacttgactctggaccagactgaag 102778
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 363      ccgggcagcttgtccatgatcttgcccagtaggcccttcttctc 406
                ||||||||||| ||| |||||||| |||  | ||||||||||||
Sbjct: 14846993 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 14847036


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,745,881
Number of Sequences: 3902068
Number of extensions: 3745881
Number of successful extensions: 79791
Number of sequences better than 10.0: 88
Number of HSP's better than 10.0 without gapping: 88
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79464
Number of HSP's gapped (non-prelim): 313
length of query: 436
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 414
effective length of database: 17,147,199,772
effective search space: 7098940705608
effective search space used: 7098940705608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top