>gb|BT009471.1| Triticum aestivum clone wr1.pk0028.b10:fis, full insert mRNA
           sequence
          Length = 588

 Score =  345 bits (174), Expect = 8e-92
 Identities = 299/340 (87%), Gaps = 3/340 (0%)
 Strand = Plus / Minus

                                                                       
Query: 141 gggatgctctgctcgtttctgaagtagtcggtgggatccacggccgccttcactgccgcg 200
           |||||||||||||||||||||||||||||  | ||||||||||| |||||||| | ||||
Sbjct: 387 gggatgctctgctcgtttctgaagtagtccattggatccacggctgccttcaccgacgcg 328

                                                                       
Query: 201 agcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcgaacgtg 260
           ||||||||| |||||||| |||||||  ||||||||||||||||| |||| | | |||||
Sbjct: 327 agcctctggtagttgctcatgaagtagcgctcaccccaaaccttgccgctctgggacgtg 268

                                                                       
Query: 261 gt---ggcgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtac 317
           ||   |  |||||||  |||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 267 gtactgaggtcgtccgacaccgcgttctggccgatgtccaggtcccggaagttgacgtac 208

                                                                       
Query: 318 gcctgcctcgggttcttgctcacgtactgccccatgaagtcgtacaagttgccgagccag 377
           ||||||||||||||  |||||||||| ||||||||||||||||| ||| |||||||||||
Sbjct: 207 gcctgcctcgggttgctgctcacgtagtgccccatgaagtcgtagaagctgccgagccag 148

                                                                       
Query: 378 gtgttcgccgccgtgcccccgtcaccctgccagaacaccatgtactggacgttgtacagc 437
           ||| | ||||||||||| ||||| || ||||||||| | |||||||||| | |||| |||
Sbjct: 147 gtggtggccgccgtgccgccgtcgccttgccagaacgcgatgtactggatgatgtagagc 88

                                                   
Query: 438 acgccgctccggtgagggtacggcgtcgcgtcggtgggga 477
           |||||||||||||| ||||||||||| ||| |||||||||
Sbjct: 87  acgccgctccggtgcgggtacggcgttgcggcggtgggga 48

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  200 bits (101), Expect = 3e-48
 Identities = 288/349 (82%), Gaps = 6/349 (1%)
 Strand = Plus / Plus

                                                                            
Query: 135      aatggcgggatgctctgctcgtttctgaagtagtcggtgggatccacggccgccttcact 194
                ||||||||||||||||||||||| |||||||||||||| |||||||  ||||||||||| 
Sbjct: 20436760 aatggcgggatgctctgctcgttcctgaagtagtcggtcggatccatcgccgccttcacc 20436819

                                                                            
Query: 195      gccgcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcg 254
                || |||||||||| ||||||||  | |||||||| ||| ||||| |||||| |||| |||
Sbjct: 20436820 gcggcgagcctctcgaagttgccggcgaagtacttctccccccacaccttgccgctctcg 20436879

                                                                            
Query: 255      aacgtggtggcgtcgt---ccaccaccacgttctggccgatgtccaggtcccggtagttg 311
                |||||| |  ||||||    | ||||| |||||| ||||||||||||||||||| |||| 
Sbjct: 20436880 aacgtgctcacgtcgttcggcgccaccgcgttctcgccgatgtccaggtcccggaagttc 20436939

                                                                            
Query: 312      acgtacgcctgcctcgggttcttgctcacgtactgccccatgaagtcgtacaagttgccg 371
                |||||||||| ||||||||   |||| |||||| || |||||||  |||||| |   | |
Sbjct: 20436940 acgtacgcctccctcgggtcgctgctgacgtacggctccatgaacgcgtacaggccactg 20436999

                                                                            
Query: 372      agccaggtgttcgccgccgtgcccccgtcaccctgccagaacaccatgtactggacgttg 431
                | |||  |||||||||||||    ||||| ||   |||| || | |||||||||| ||||
Sbjct: 20437000 atccacctgttcgccgccgt---tccgtcgccggaccagtacgcgatgtactggatgttg 20437056

                                                                 
Query: 432      tacagcacgccgctccggtgagggtacggcgtcgcgtcggtggggacgc 480
                ||||| |||||||||||||| ||||||||||||||  ||| ||||||||
Sbjct: 20437057 tacaggacgccgctccggtgcgggtacggcgtcgccgcggcggggacgc 20437105



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                            
Query: 276      accacgttctggccgatgtccaggtcccggtagttgacgtacgcctgcctcgggttcttg 335
                |||||||||| ||||| ||||||||||| ||||||| ||||||||| |||||||| ||||
Sbjct: 20485187 accacgttctcgccgaggtccaggtccctgtagttggcgtacgcctccctcgggtccttg 20485246

                                    
Query: 336      ctcacgtactgccccatgaa 355
                |||||| || || |||||||
Sbjct: 20485247 ctcacgaacggcgccatgaa 20485266



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                            
Query: 287      gccgatgtccaggtcccggtagttgacgtacgcctgcctcgggttcttgctcacgtactg 346
                ||||| ||| ||||||| ||||||||||||||||||||||||||||||| | |||||| |
Sbjct: 20420425 gccgaggtcgaggtccctgtagttgacgtacgcctgcctcgggttcttggtgacgtacgg 20420484

                         
Query: 347      ccccatgaa 355
                | |||||||
Sbjct: 20420485 ctccatgaa 20420493



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                                
Query: 134      caatggcgggatgctctgctcgtttctgaagtagtcggtgggatccac 181
                |||||| || |||||||||||||| |||||| ||||||||||||||||
Sbjct: 20420266 caatggaggaatgctctgctcgttcctgaagaagtcggtgggatccac 20420313



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                                  
Query: 137      tggcgggatgctctgctcgtttctgaagtagtcg 170
                ||||||||||||||||||||| ||||||||||||
Sbjct: 20485045 tggcgggatgctctgctcgttcctgaagtagtcg 20485078



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                   
Query: 416      catgtactggacgttgtacagcacgccgctccggtgagggtacggcgtcgc 466
                ||||||||||| |||||| ||||||||||  ||||| ||| ||||||||||
Sbjct: 20485339 catgtactggatgttgtagagcacgccgccgcggtgcgggaacggcgtcgc 20485389



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                               
Query: 297      aggtcccggtagttgacgtacgcctgcctcgggttcttgctcacgta 343
                ||||||| ||||||| | ||||||| ||| |||||||||||||||||
Sbjct: 20464873 aggtccctgtagttggcatacgcctccctggggttcttgctcacgta 20464919



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 138      ggcgggatgctctgctcgtttctgaagtagtcg 170
                |||||||||||||||||||| | ||||||||||
Sbjct: 20460574 ggcgggatgctctgctcgttccggaagtagtcg 20460606



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                          
Query: 406      gccagaacaccatgtactggacgttgtacagcacgccgctccggtgagggtacggcgt 463
                |||||||| | | |||||||| |||||| || ||||||  |||||| |||||||||||
Sbjct: 20460848 gccagaacgcgacgtactggatgttgtagaggacgccggaccggtgcgggtacggcgt 20460905

>dbj|AP003686.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0659D09
          Length = 168253

 Score =  200 bits (101), Expect = 3e-48
 Identities = 288/349 (82%), Gaps = 6/349 (1%)
 Strand = Plus / Plus

                                                                        
Query: 135  aatggcgggatgctctgctcgtttctgaagtagtcggtgggatccacggccgccttcact 194
            ||||||||||||||||||||||| |||||||||||||| |||||||  ||||||||||| 
Sbjct: 9055 aatggcgggatgctctgctcgttcctgaagtagtcggtcggatccatcgccgccttcacc 9114

                                                                        
Query: 195  gccgcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcg 254
            || |||||||||| ||||||||  | |||||||| ||| ||||| |||||| |||| |||
Sbjct: 9115 gcggcgagcctctcgaagttgccggcgaagtacttctccccccacaccttgccgctctcg 9174

                                                                        
Query: 255  aacgtggtggcgtcgt---ccaccaccacgttctggccgatgtccaggtcccggtagttg 311
            |||||| |  ||||||    | ||||| |||||| ||||||||||||||||||| |||| 
Sbjct: 9175 aacgtgctcacgtcgttcggcgccaccgcgttctcgccgatgtccaggtcccggaagttc 9234

                                                                        
Query: 312  acgtacgcctgcctcgggttcttgctcacgtactgccccatgaagtcgtacaagttgccg 371
            |||||||||| ||||||||   |||| |||||| || |||||||  |||||| |   | |
Sbjct: 9235 acgtacgcctccctcgggtcgctgctgacgtacggctccatgaacgcgtacaggccactg 9294

                                                                        
Query: 372  agccaggtgttcgccgccgtgcccccgtcaccctgccagaacaccatgtactggacgttg 431
            | |||  |||||||||||||    ||||| ||   |||| || | |||||||||| ||||
Sbjct: 9295 atccacctgttcgccgccgt---tccgtcgccggaccagtacgcgatgtactggatgttg 9351

                                                             
Query: 432  tacagcacgccgctccggtgagggtacggcgtcgcgtcggtggggacgc 480
            ||||| |||||||||||||| ||||||||||||||  ||| ||||||||
Sbjct: 9352 tacaggacgccgctccggtgcgggtacggcgtcgccgcggcggggacgc 9400



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 276   accacgttctggccgatgtccaggtcccggtagttgacgtacgcctgcctcgggttcttg 335
             |||||||||| ||||| ||||||||||| ||||||| ||||||||| |||||||| ||||
Sbjct: 57482 accacgttctcgccgaggtccaggtccctgtagttggcgtacgcctccctcgggtccttg 57541

                                 
Query: 336   ctcacgtactgccccatgaa 355
             |||||| || || |||||||
Sbjct: 57542 ctcacgaacggcgccatgaa 57561



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                               
Query: 137   tggcgggatgctctgctcgtttctgaagtagtcg 170
             ||||||||||||||||||||| ||||||||||||
Sbjct: 57340 tggcgggatgctctgctcgttcctgaagtagtcg 57373



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                
Query: 416   catgtactggacgttgtacagcacgccgctccggtgagggtacggcgtcgc 466
             ||||||||||| |||||| ||||||||||  ||||| ||| ||||||||||
Sbjct: 57634 catgtactggatgttgtagagcacgccgccgcggtgcgggaacggcgtcgc 57684



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 297   aggtcccggtagttgacgtacgcctgcctcgggttcttgctcacgta 343
             ||||||| ||||||| | ||||||| ||| |||||||||||||||||
Sbjct: 37168 aggtccctgtagttggcatacgcctccctggggttcttgctcacgta 37214



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 138   ggcgggatgctctgctcgtttctgaagtagtcg 170
             |||||||||||||||||||| | ||||||||||
Sbjct: 32869 ggcgggatgctctgctcgttccggaagtagtcg 32901



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                       
Query: 406   gccagaacaccatgtactggacgttgtacagcacgccgctccggtgagggtacggcgt 463
             |||||||| | | |||||||| |||||| || ||||||  |||||| |||||||||||
Sbjct: 33143 gccagaacgcgacgtactggatgttgtagaggacgccggaccggtgcgggtacggcgt 33200

>emb|AJ862833.1| Triticum aestivum partial tria4 gene for pollen allergen Tri a 4,
            allele B
          Length = 1603

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 131/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 198  gcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcgaac 257
            |||||||| |||||||||||| ||||||||| ||| ||||| |||||| |||||  | | 
Sbjct: 1478 gcgagcctttggaagttgctcttgaagtacttctcgccccacaccttgccgctgctgtag 1419

                                                                        
Query: 258  gtggtggcgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtac 317
            || | |  ||||| ||||||| | |||  ||||| ||| | ||||| ||||||| |||||
Sbjct: 1418 gttgagatgtcgttcaccacctcattcctgccgaggtcgatgtccctgtagttggcgtac 1359

                                                  
Query: 318  gcctgcctcgggttcttgctcacgtactgccccatgaa 355
            |||||||| |||||||||||||||||| || |||||||
Sbjct: 1358 gcctgcctggggttcttgctcacgtacggctccatgaa 1321



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 138  ggcgggatgctctgctcgtttctgaagtagtc 169
            ||||||||||| ||||| || |||||||||||
Sbjct: 1538 ggcgggatgctttgctcattcctgaagtagtc 1507

>emb|AJ862832.1| Triticum aestivum partial tria4 gene for pollen allergen Tri a 4,
            allele A
          Length = 1603

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 131/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 198  gcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcgaac 257
            |||||||| |||||||||| | ||||||||| ||| |||||||||||| |||||    | 
Sbjct: 1478 gcgagcctttggaagttgcccttgaagtacttctcgccccaaaccttgccgctgctatag 1419

                                                                        
Query: 258  gtggtggcgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtac 317
            || | |  ||||| ||||||| |||||  ||||| ||| | ||||| ||||||| |||||
Sbjct: 1418 gttgagatgtcgttcaccacctcgttcctgccgaggtcaatgtccctgtagttggcgtac 1359

                                                  
Query: 318  gcctgcctcgggttcttgctcacgtactgccccatgaa 355
            |||||||| |||||||||||||||||| || |||||||
Sbjct: 1358 gcctgcctggggttcttgctcacgtacggctccatgaa 1321



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 138  ggcgggatgctctgctcgtttctgaagtagtc 169
            |||||||||||||||||||| |||||||||||
Sbjct: 1538 ggcgggatgctctgctcgttcctgaagtagtc 1507

>emb|AJ862834.1| Hordeum vulgare partial horv4 gene for pollen allergen Hor v 4
          Length = 1608

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 198  gcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcgaac 257
            |||||||| |||||||||| | ||||||||| ||| ||||| |||||| |||||  | | 
Sbjct: 1481 gcgagcctttggaagttgcccttgaagtacttctcgccccacaccttgccgctgctgtag 1422

                                                                        
Query: 258  gtggtggcgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtac 317
            || | |  ||||| ||||||| |||||  ||||| ||| | ||||| ||||||| |||||
Sbjct: 1421 gttgagatgtcgttcaccacctcgttcctgccgaggtcgatgtccctgtagttggcgtac 1362

                                                  
Query: 318  gcctgcctcgggttcttgctcacgtactgccccatgaa 355
            |||||||| ||||||||||||||| || || |||||||
Sbjct: 1361 gcctgcctggggttcttgctcacgaacggctccatgaa 1324



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 138  ggcgggatgctctgctcgtttctgaagtagtc 169
            |||||||||||||||||||| |||||||||||
Sbjct: 1541 ggcgggatgctctgctcgttcctgaagtagtc 1510

>dbj|AK109673.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-145-B05, full
            insert sequence
          Length = 1972

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                        
Query: 276  accacgttctggccgatgtccaggtcccggtagttgacgtacgcctgcctcgggttcttg 335
            |||||||||| ||||| ||||||||||| ||||||| ||||||||| |||||||| ||||
Sbjct: 1485 accacgttctcgccgaggtccaggtccctgtagttggcgtacgcctccctcgggtccttg 1426

                                
Query: 336  ctcacgtactgccccatgaa 355
            |||||| || || |||||||
Sbjct: 1425 ctcacgaacggcgccatgaa 1406



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                              
Query: 137  tggcgggatgctctgctcgtttctgaagtagtcg 170
            ||||||||||||||||||||| ||||||||||||
Sbjct: 1627 tggcgggatgctctgctcgttcctgaagtagtcg 1594



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 416  catgtactggacgttgtacagcacgccgctccggtgagggtacggcgtcgc 466
            ||||||||||| |||||| ||||||||||  ||||| ||| ||||||||||
Sbjct: 1333 catgtactggatgttgtagagcacgccgccgcggtgcgggaacggcgtcgc 1283

>emb|AJ512488.2|PPR512488 Phleum pratense partial phlp4 gene for pollen allergen Phl p 4,
            allele B1
          Length = 1580

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 120/146 (82%)
 Strand = Plus / Minus

                                                                        
Query: 198  gcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcgaac 257
            |||||||||| |||||||| | ||||||| | ||  ||||| |||||| ||||| || | 
Sbjct: 1448 gcgagcctctcgaagttgcccttgaagtatttctggccccagaccttgccgctggcgtag 1389

                                                                        
Query: 258  gtggtggcgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtac 317
            |||| | ||||||  |||||| |||||  ||||| ||| | ||||| ||||||  |||||
Sbjct: 1388 gtggagacgtcgttgaccacctcgttcctgccgaggtcgatgtccctgtagtttgcgtac 1329

                                      
Query: 318  gcctgcctcgggttcttgctcacgta 343
            |||||||| |||||||||||||||||
Sbjct: 1328 gcctgcctggggttcttgctcacgta 1303



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 138  ggcgggatgctctgctcgtttctgaagtagtcggtgggatc 178
            |||||||||||||||||||| |||||||||||||| |||||
Sbjct: 1508 ggcgggatgctctgctcgttcctgaagtagtcggtaggatc 1468

>gb|DQ251188.1| Phleum pratense major pollen allergen Phl p 4 precursor, mRNA,
            complete cds
          Length = 1741

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 120/146 (82%)
 Strand = Plus / Minus

                                                                        
Query: 198  gcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcgaac 257
            |||||||||| |||||||| | ||||||| | ||  ||||| |||||| ||||| || | 
Sbjct: 1534 gcgagcctctcgaagttgcccttgaagtatttctggccccagaccttgccgctggcgtag 1475

                                                                        
Query: 258  gtggtggcgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtac 317
            |||| | ||||||  |||||| |||||  ||||| ||| | ||||| ||||||  |||||
Sbjct: 1474 gtggagacgtcgttgaccacctcgttcctgccgaggtcgatgtccctgtagtttgcgtac 1415

                                      
Query: 318  gcctgcctcgggttcttgctcacgta 343
            |||||||| |||||||||||||||||
Sbjct: 1414 gcctgcctggggttcttgctcacgta 1389



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 138  ggcgggatgctctgctcgtttctgaagtagtcggtgggatc 178
            |||||||||||||||||||| |||||||||||||| |||||
Sbjct: 1594 ggcgggatgctctgctcgttcctgaagtagtcggtaggatc 1554

>dbj|AP004731.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0016D02
          Length = 157822

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                          
Query: 287    gccgatgtccaggtcccggtagttgacgtacgcctgcctcgggttcttgctcacgtactg 346
              ||||| ||| ||||||| ||||||||||||||||||||||||||||||| | |||||| |
Sbjct: 143820 gccgaggtcgaggtccctgtagttgacgtacgcctgcctcgggttcttggtgacgtacgg 143879

                       
Query: 347    ccccatgaa 355
              | |||||||
Sbjct: 143880 ctccatgaa 143888



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                              
Query: 134    caatggcgggatgctctgctcgtttctgaagtagtcggtgggatccac 181
              |||||| || |||||||||||||| |||||| ||||||||||||||||
Sbjct: 143661 caatggaggaatgctctgctcgttcctgaagaagtcggtgggatccac 143708

>dbj|AK072611.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133A01, full
            insert sequence
          Length = 2030

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                        
Query: 287  gccgatgtccaggtcccggtagttgacgtacgcctgcctcgggttcttgctcacgtactg 346
            ||||| ||| ||||||| ||||||||||||||||||||||||||||||| | |||||| |
Sbjct: 1441 gccgaggtcgaggtccctgtagttgacgtacgcctgcctcgggttcttggtgacgtacgg 1382

                     
Query: 347  ccccatgaa 355
            | |||||||
Sbjct: 1381 ctccatgaa 1373



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 134  caatggcgggatgctctgctcgtttctgaagtagtcggtgggatccac 181
            |||||| || |||||||||||||| |||||| ||||||||||||||||
Sbjct: 1600 caatggaggaatgctctgctcgttcctgaagaagtcggtgggatccac 1553

>emb|AJ512487.2|PPR512487 Phleum pratense partial phlp4 gene for pollen allergen Phl p 4,
            allele A1
          Length = 1567

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                        
Query: 138  ggcgggatgctctgctcgtttctgaagtagtcggtgggatccac 181
            |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 1508 ggcgggatgctctgctcgttcctgaagtagtcggtgggatccac 1465



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                        
Query: 265  cgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtacgcctgcc 324
            |||||| ||||||| |||||   |||| ||| | ||||| ||||||| |||| |||||||
Sbjct: 1381 cgtcgttcaccacctcgttcctcccgaggtcgatgtccctgtagttggcgtaggcctgcc 1322

                               
Query: 325  tcgggttcttgctcacgta 343
            | |||||||||||||||||
Sbjct: 1321 tggggttcttgctcacgta 1303

>emb|AJ862831.1| Secale cereale partial secc4 gene for pollen allergen Sec c 4, allele
            B
          Length = 1644

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 128/158 (81%)
 Strand = Plus / Minus

                                                                        
Query: 198  gcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcgaac 257
            |||||||| |||||||||| | ||||||||| ||| ||||| |||||| ||||| |  | 
Sbjct: 1487 gcgagcctttggaagttgcccttgaagtacttctcgccccagaccttgccgctggcatag 1428

                                                                        
Query: 258  gtggtggcgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtac 317
            |||| |  |||||  |||||| |||||  ||||| ||| | ||||| ||||||| |||| 
Sbjct: 1427 gtggagatgtcgttgaccacctcgttcctgccgaggtcgatgtccctgtagttggcgtag 1368

                                                  
Query: 318  gcctgcctcgggttcttgctcacgtactgccccatgaa 355
            ||||| || ||||||||||| |||||| || |||||||
Sbjct: 1367 gcctgtctggggttcttgctgacgtacggctccatgaa 1330



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 138  ggcgggatgctctgctcgtttctgaagtagtc 169
            |||||||||||||||||||| |||||||||||
Sbjct: 1547 ggcgggatgctctgctcgttcctgaagtagtc 1516

>gb|AY451241.1| Cynodon dactylon FAD-linked oxidoreductase BG60 mRNA, complete cds
          Length = 1569

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 132/164 (80%)
 Strand = Plus / Minus

                                                                        
Query: 198  gcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcgaac 257
            |||||||||| |||||||| | ||||||||| ||| ||||| |||||| ||||| || | 
Sbjct: 1499 gcgagcctctcgaagttgcccttgaagtacttctctccccataccttgccgctggcgtag 1440

                                                                        
Query: 258  gtggtggcgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtac 317
            |||| | |||   | ||||||  |||   ||| | ||| ||||| | |||||||||||||
Sbjct: 1439 gtggagacgttaccgaccacctggttgacgccaaggtcgaggtctctgtagttgacgtac 1380

                                                        
Query: 318  gcctgcctcgggttcttgctcacgtactgccccatgaagtcgta 361
            |||||||| ||||||||||| |||||  ||  ||||||||||||
Sbjct: 1379 gcctgcctggggttcttgctgacgtagggcgtcatgaagtcgta 1336



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 134  caatggcgggatgctctgctcgtttctgaagtagtc 169
            ||||||||||||||||||||| || |||||||||||
Sbjct: 1563 caatggcgggatgctctgctcattcctgaagtagtc 1528

>emb|AJ862830.1| Secale cereale partial secc4 gene for pollen allergen Sec c 4, allele
            A
          Length = 1603

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 127/158 (80%)
 Strand = Plus / Minus

                                                                        
Query: 198  gcgagcctctggaagttgctcgtgaagtactgctcaccccaaaccttggcgctgtcgaac 257
            |||||||| |||||||||| | ||||||||| ||||||||| || ||| |||||  | | 
Sbjct: 1478 gcgagcctttggaagttgcccttgaagtacttctcaccccacactttgccgctgctgtag 1419

                                                                        
Query: 258  gtggtggcgtcgtccaccaccacgttctggccgatgtccaggtcccggtagttgacgtac 317
            |||| |  ||||| ||||||| | |||  ||| | ||| | ||||| ||||||| | |||
Sbjct: 1418 gtggagatgtcgttcaccacctcattcctgccaaggtcgatgtccctgtagttggcatac 1359

                                                  
Query: 318  gcctgcctcgggttcttgctcacgtactgccccatgaa 355
            |||||||| || || |||||||||||| || |||||||
Sbjct: 1358 gcctgcctgggatttttgctcacgtacggctccatgaa 1321



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                   
Query: 131  gaccaatggcgggatgctctgctcgtttctgaagtagtc 169
            ||||| ||||||||||||||||||||| |||||||||||
Sbjct: 1545 gaccagtggcgggatgctctgctcgttcctgaagtagtc 1507

>gb|AY105422.1| Zea mays PCO091928 mRNA sequence
          Length = 664

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 134 caatggcgggatgctctgctcgtttctgaagtagtcg 170
           |||||||||||||||||||||||| ||||||||||||
Sbjct: 145 caatggcgggatgctctgctcgttcctgaagtagtcg 109

>gb|BT009387.1| Triticum aestivum clone wlm96.pk035.d7:fis, full insert mRNA sequence
          Length = 1805

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 135  aatggcgggatgctctgctcgtttctgaagtagtcg 170
            ||||||||||||||||||||||| ||||||||||||
Sbjct: 1592 aatggcgggatgctctgctcgttcctgaagtagtcg 1557



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 279  acgttctggccgatgtccaggtcccggtagttgacgtacgcctgcctcgggtt 331
            ||||||| ||||| ||||||||||| |||||||| ||| |||| |||||||||
Sbjct: 1448 acgttctcgccgaggtccaggtccctgtagttgaagtaggcctccctcgggtt 1396



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 416  catgtactggacgttgtacagcacgccgctccggtgagggtacggcgtcgc 466
            ||||||||||| |||||| |||||||||   ||||| ||||||||||||||
Sbjct: 1305 catgtactggatgttgtagagcacgccggcgcggtgcgggtacggcgtcgc 1255



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 197  cgcgagcctctggaagttgctcgtgaagtact 228
            ||||||||||||| |||||| | |||||||||
Sbjct: 1530 cgcgagcctctggtagttgcccttgaagtact 1499

>emb|AJ862835.1| Lolium perenne partial lolp4 gene for pollen allergen Lol p 4
          Length = 1272

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 299  gtcccggtagttgacgtacgcctgcctcgggttcttgctcacgtactgccccatg 353
            ||||| ||||||| |||| |||||||| |||||||||||||||||| || |||||
Sbjct: 1123 gtccctgtagttggcgtaggcctgcctggggttcttgctcacgtacggctccatg 1069

>gb|AC133608.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0085G12, complete sequence
          Length = 121470

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                          
Query: 137   tggcgggatgctctgctcgtttctgaagtagtcggtgggatccac 181
             ||||||||||||||||||||| | ||||||||||  |||||||||
Sbjct: 73145 tggcgggatgctctgctcgttgcggaagtagtcgccgggatccac 73189



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 419   gtactggacgttgtacagcacgccg 443
             |||||||| ||||||||||||||||
Sbjct: 73439 gtactggatgttgtacagcacgccg 73463

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 137      tggcgggatgctctgctcgtttctgaagtagtcggtgggatccac 181
                ||||||||||||||||||||| | ||||||||||  |||||||||
Sbjct: 17005538 tggcgggatgctctgctcgttgcggaagtagtcgccgggatccac 17005582



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 419      gtactggacgttgtacagcacgccg 443
                |||||||| ||||||||||||||||
Sbjct: 17005832 gtactggatgttgtacagcacgccg 17005856

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 137      tggcgggatgctctgctcgtttctgaagtagtcggtgggatccac 181
                ||||||||||||||||||||| | ||||||||||  |||||||||
Sbjct: 17100190 tggcgggatgctctgctcgttgcggaagtagtcgccgggatccac 17100234



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 419      gtactggacgttgtacagcacgccg 443
                |||||||| ||||||||||||||||
Sbjct: 17100484 gtactggatgttgtacagcacgccg 17100508

>dbj|AK073505.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033046H14, full
            insert sequence
          Length = 1813

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 138  ggcgggatgctctgctcgtttctgaagtagtcg 170
            |||||||||||||||||||| | ||||||||||
Sbjct: 1613 ggcgggatgctctgctcgttccggaagtagtcg 1581



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                      
Query: 406  gccagaacaccatgtactggacgttgtacagcacgccgctccggtgagggtacggcgt 463
            |||||||| | | |||||||| |||||| || ||||||  |||||| |||||||||||
Sbjct: 1339 gccagaacgcgacgtactggatgttgtagaggacgccggaccggtgcgggtacggcgt 1282

>emb|X78330.1|HVB191 H.vulgare (cv Bomi) B191 gene intron
          Length = 119

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 88  gcatacaaatacagtagtacaac 110
           |||||||||||||||||||||||
Sbjct: 102 gcatacaaatacagtagtacaac 80

>gb|AC020728.4|AC020728 Homo sapiens BAC clone RP11-506H20 from 5, complete sequence
          Length = 201404

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 375    caggtgttcgccgccgtgccc 395
              |||||||||||||||||||||
Sbjct: 159148 caggtgttcgccgccgtgccc 159168

>gb|AC168055.3| Mus musculus BAC clone RP24-360I1 from chromosome 10, complete
            sequence
          Length = 206775

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gaagcacaaattgccttggt 20
            ||||||||||||||||||||
Sbjct: 6658 gaagcacaaattgccttggt 6639

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 274   ccaccacgttctggccgatg 293
             ||||||||||||||||||||
Sbjct: 55041 ccaccacgttctggccgatg 55022

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 448    ggtgagggtacggcgtcgcg 467
              ||||||||||||||||||||
Sbjct: 548473 ggtgagggtacggcgtcgcg 548454

>gb|AC102647.8| Mus musculus chromosome 10, clone RP23-269A24, complete sequence
          Length = 201670

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 1      gaagcacaaattgccttggt 20
              ||||||||||||||||||||
Sbjct: 165935 gaagcacaaattgccttggt 165916

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 185     cgccttcactgccgcgagcc 204
               ||||||||||||||||||||
Sbjct: 1448601 cgccttcactgccgcgagcc 1448582

>gb|AC073156.19| Homo sapiens 3 BAC RP11-223L18 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 131142

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    tcctacttccgttttcacaa 43
             ||||||||||||||||||||
Sbjct: 60321 tcctacttccgttttcacaa 60302

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 462     gtcgcgtcggtggggacgct 481
               ||||||||||||||||||||
Sbjct: 4843092 gtcgcgtcggtggggacgct 4843073

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 380     gttcgccgccgtgcccccgtcacc 403
               ||||||||||||| ||||||||||
Sbjct: 1572179 gttcgccgccgtgtccccgtcacc 1572156

>gb|AE004993.1| Halobacterium sp. NRC-1 section 24 of 170 of the complete genome
          Length = 10286

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 265  cgtcgtccaccaccacgttc 284
            ||||||||||||||||||||
Sbjct: 8155 cgtcgtccaccaccacgttc 8174

>gb|BC098940.1| Rattus norvegicus ATPase, class I, type 8B, member 4, mRNA (cDNA
           clone IMAGE:7455768), complete cds
          Length = 1618

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 113 tgctcacttacgtccttgga 132
           ||||||||||||||||||||
Sbjct: 196 tgctcacttacgtccttgga 177

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 264     gcgtcgtccaccaccacgtt 283
               ||||||||||||||||||||
Sbjct: 2751445 gcgtcgtccaccaccacgtt 2751426


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,817,988
Number of Sequences: 3902068
Number of extensions: 2817988
Number of successful extensions: 47122
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46706
Number of HSP's gapped (non-prelim): 416
length of query: 495
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 473
effective length of database: 17,147,199,772
effective search space: 8110625492156
effective search space used: 8110625492156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)