ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart24f03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, co... 365 9e-98
2gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltrans... 295 7e-77
3gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O... 133 6e-28
4gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O... 115 1e-22
5gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full ... 109 9e-21
6gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferas... 109 9e-21
7gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O... 103 5e-19
8emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caf... 100 8e-18
9gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltrans... 100 8e-18
10gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase m... 90 8e-15
11emb|AJ586106.1| Festuca arundinacea partial mRNA for putative ca... 88 3e-14
12gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferas... 86 1e-13
13gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-... 86 1e-13
14gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-... 84 5e-13
15ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA 82 2e-12
16dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
17dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
18gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltr... 82 2e-12
19dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
20emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic ... 80 8e-12
21gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltrans... 78 3e-11
22gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (com... 76 1e-10
23gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (co... 76 1e-10
24gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (co... 76 1e-10
25gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (... 76 1e-10
26gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (com... 76 1e-10
27gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (c... 76 1e-10
28gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt... 76 1e-10
29gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (co... 76 1e-10
30gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (co... 76 1e-10
31gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt... 76 1e-10
32gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (com... 76 1e-10
33gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (com... 76 1e-10
34gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (c... 76 1e-10
35gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (c... 76 1e-10
36gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt... 76 1e-10
37gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (co... 76 1e-10
38gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (co... 76 1e-10
39gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (co... 76 1e-10
40gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (co... 76 1e-10
41gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (com... 76 1e-10
42gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt... 76 1e-10
43gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt... 76 1e-10
44gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (co... 76 1e-10
45gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransfera... 76 1e-10
46gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferas... 76 1e-10
47gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) g... 76 1e-10
48gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt)... 76 1e-10
49gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gen... 76 1e-10
50gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) ge... 76 1e-10
51gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase... 76 1e-10
52gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (com... 76 1e-10
53gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (c... 76 1e-10
54gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (c... 76 1e-10
55gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (... 76 1e-10
56gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, com... 76 1e-10
57gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyl... 74 5e-10
58gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase ... 74 5e-10
59gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA,... 74 5e-10
60dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA... 74 5e-10
61dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 5e-10
62gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic ac... 56 1e-04
63gb|AC079258.4| Homo sapiens BAC clone RP11-410J22 from 2, comple... 46 0.11
64gb|AC163277.4| Mus musculus BAC clone RP24-471O20 from chromosom... 42 1.7
65gb|AC138084.4| Mus musculus BAC clone RP23-353F23 from chromosom... 42 1.7
66ref|XM_742823.1| Aspergillus fumigatus Af293 AMP-binding protein... 42 1.7
67emb|BX037446.1|CNS09122 Single read from an extremity of a full-... 42 1.7
68gb|AC099022.1| Drosophila melanogaster, chromosome 2L, region 23... 42 1.7
69gb|AC008321.7| Drosophila melanogaster, chromosome 2L, region 23... 42 1.7
70dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
71dbj|AP005826.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
72dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
73dbj|AK110984.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
74gb|AE003580.3| Drosophila melanogaster chromosome 2L, section 11... 42 1.7
75gb|L09204.1|DROTRS7A Drosophila melanogaster transfer RNA (tRNA-... 42 1.7
76gb|AC116850.10| Mus musculus chromosome 8, clone RP24-396C10, co... 40 6.7
77gb|AC123531.4| Mus musculus BAC clone RP24-289C11 from chromosom... 40 6.7
78gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 6.7
79gb|BC035017.2| Homo sapiens sodium channel, voltage-gated, type ... 40 6.7
80gb|AC007268.5| Arabidopsis thaliana chromosome 2 clone T27D6 map... 40 6.7
81gb|AF410153.1| Swinepox virus isolate 17077-99, complete genome 40 6.7
82ref|XM_693754.1| PREDICTED: Danio rerio similar to gamma filamin... 40 6.7
83dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.7
84gb|AF260441.1|AF260441 HIV-1 isolate 85CD220 from Democratic Rep... 40 6.7
85dbj|AP004754.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.7
86emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 i... 40 6.7
87emb|BX470230.5| Zebrafish DNA sequence from clone CH211-284B12 i... 40 6.7
88dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full ... 40 6.7
89emb|AL954190.5| Zebrafish DNA sequence from clone DKEY-30O6 in l... 40 6.7
90emb|AL772211.7| Mouse DNA sequence from clone RP23-473B24 on chr... 40 6.7 
>dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, complete cds
          Length = 1372

 Score =  365 bits (184), Expect = 9e-98
 Identities = 286/320 (89%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||||||||||||||||||||||||||  ||  |||||||| ||||||||||||| ||
Sbjct: 1154 ctacttggtgtactccattgcccagaagttcgcaaagatgtagctggccttgacgcctgt 1095

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
            |||||| |||||| |||| |||||||||| |||||| |||| ||||||||||||||||||
Sbjct: 1094 aaaccctgcagccttggctagcttctcgaagtccctgaggttcctttccttgccgccggg 1035

                                                                        
Query: 291  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 350
            |||||||||||||| |||  ||||||| | |||||||||||||| | ||||||| |||||
Sbjct: 1034 gctgtacgccagcaagctggcgtccacacagattaacccctgcgcgttgtttgtcgcgtc 975

                                                                        
Query: 351  cgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 410
            ||||||||| ||| ||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 974  cgggttcactggcaggatacattccacgttgatcaccttaccatgcgcgggcagtgcgtc 915

                                                                        
Query: 411  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 470
            ||||||||||||||| || |  ||||||||||||||||| ||||||  ||| ||||| ||
Sbjct: 914  gtagcagttcttgaggagtaccgcacactcgtcgtcgctgaagcaggggagaatccattt 855

                                
Query: 471  catgaggatggcgtctccgg 490
            |||| |||||||||||||||
Sbjct: 854  catggggatggcgtctccgg 835
to top
>gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltransferase (OMT2) mRNA, complete
            cds
          Length = 1436

 Score =  295 bits (149), Expect = 7e-77
 Identities = 281/325 (86%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||| ||||||||||| ||||||||||||||| |||||||||||||| |||||| |||
Sbjct: 1130 ctacttagtgtactccatggcccagaagtcggcgaagatgtaggtggccgtgacgctggt 1071

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
            ||| |||||  || ||||||||||||| ||||||||  ||||||| ||||||||||| ||
Sbjct: 1070 aaagccggcgcccttggcgagcttctccaggtccctgtggtacctctccttgccgcccgg 1011

                                                                        
Query: 291  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 350
            ||||||| | ||||||||||  || |||  ||| ||| ||||||  | ||| ||||||||
Sbjct: 1010 gctgtacacaagcaggctcaaatcgacggcgatcaacgcctgcgcaccgttggtggcgtc 951

                                                                        
Query: 351  cgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 410
            ||| |||||||||  ||| ||||| |||||||| || ||  |||| || ||||| |||||
Sbjct: 950  cggattcaccggcaagatgcactcgacgttgatgactttggcatgggcgggcagcgcgtc 891

                                                                        
Query: 411  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 470
            ||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||
Sbjct: 890  gtagcagttcttgagcagggtggcgcactcgtcgtcgctgaagcagttgaggatccactt 831

                                     
Query: 471  catgaggatggcgtctccggtgggc 495
            ||||||||||||||| |||| ||||
Sbjct: 830  catgaggatggcgtcgccggagggc 806
to top
>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1438

 Score =  133 bits (67), Expect = 6e-28
 Identities = 253/315 (80%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||||||| |||| || |||||   || |||||||||||| |||| ||||||||||||
Sbjct: 1144 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgccggt 1085

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
             || |||||  |||||||||||  |||||  |||||   |||||| ||| ||||||||||
Sbjct: 1084 gaagccggctcccctggcgagcgcctcgaactccctttcgtacctctccctgccgccggg 1025

                                                                        
Query: 291  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 350
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1024 gttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcctc 965

                                                                        
Query: 351  cgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 410
            ||||||||||||| |||| ||||| |||   | |||||| || ||||||||||| |||||
Sbjct: 964  cgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggcagcgcgtc 905

                                                                        
Query: 411  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 470
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 904  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 845

                           
Query: 471  catgaggatggcgtc 485
            |||||||||||||||
Sbjct: 844  catgaggatggcgtc 830
to top
>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1446

 Score =  115 bits (58), Expect = 1e-22
 Identities = 253/318 (79%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||||||| |||| || |||||   || |||||||||||| |||| ||||||||||||
Sbjct: 1127 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgccggt 1068

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
             || |||||  ||||||||||   || ||  ||||||  |||||| ||| ||||||||||
Sbjct: 1067 gaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgccggg 1008

                                                                        
Query: 291  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 350
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1007 gttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggcctc 948

                                                                        
Query: 351  cgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 410
            |||||| |||||| |||| ||||| |||   |  ||||| || ||||||||||| |||||
Sbjct: 947  cgggttgaccggcaggatgcactcgacgagcacgaccttgccgtgcgccggcagcgcgtc 888

                                                                        
Query: 411  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 470
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 887  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 828

                              
Query: 471  catgaggatggcgtctcc 488
            ||||||||||||||||||
Sbjct: 827  catgaggatggcgtctcc 810
to top
>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA
           sequence
          Length = 1314

 Score =  109 bits (55), Expect = 9e-21
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                       
Query: 343 gtggcgtccgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggc 402
           ||||| ||||||||||||||| |||| |||||||||   | |||||| || |||||||||
Sbjct: 904 gtggcctccgggttcaccggcaggatgcactccacgagcaccaccttgccgtgcgccggc 845

                                                                       
Query: 403 agtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgagg 462
           || |||||||||||||||||||||||  | || || |  ||||||||  ||  || ||||
Sbjct: 844 agcgcgtcgtagcagttcttgagcagcgtcgcgcagtgctcgtcgctccagtcgtggagg 785

                                  
Query: 463 atccacttcatgaggatggcgtc 485
           |||||||||||||||||||||||
Sbjct: 784 atccacttcatgaggatggcgtc 762
to top
>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA,
           complete cds
          Length = 1371

 Score =  109 bits (55), Expect = 9e-21
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                       
Query: 343 gtggcgtccgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggc 402
           ||||| ||||||||||||||| |||| |||||||||   | |||||| || |||||||||
Sbjct: 984 gtggcctccgggttcaccggcaggatgcactccacgagcaccaccttgccgtgcgccggc 925

                                                                       
Query: 403 agtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgagg 462
           || |||||||||||||||||||||||  | || || |  ||||||||  ||  || ||||
Sbjct: 924 agcgcgtcgtagcagttcttgagcagcgtcgcgcagtgctcgtcgctccagtcgtggagg 865

                                  
Query: 463 atccacttcatgaggatggcgtc 485
           |||||||||||||||||||||||
Sbjct: 864 atccacttcatgaggatggcgtc 842
to top
>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1440

 Score =  103 bits (52), Expect = 5e-19
 Identities = 226/284 (79%)
 Strand = Plus / Minus

                                                                        
Query: 202  gcgtagatgtaggtggccttgacgccggtaaacccggcagccctggcgagcttctcgagg 261
            ||||||||||| |||| |||||||||||| ||||| ||  ||||||| ||   |||||  
Sbjct: 1122 gcgtagatgtacgtggacttgacgccggtgaacccagctcccctggccagggcctcgaac 1063

                                                                        
Query: 262  tccctcaggtacctttccttgccgccggggctgtacgccagcaggctcacgtccacgctg 321
            ||||||  |||||| ||| ||||||||||| ||| ||| |||| | ||| ||| |||  |
Sbjct: 1062 tccctctcgtacctctccctgccgccggggttgtgcgcgagcatgatcatgtcgacgtgg 1003

                                                                        
Query: 322  attaacccctgcgtgctgtttgtggcgtccgggttcaccggctggatacactccacgttg 381
            |  | |||||||| ||||    |||| |||||||| |||||| |||| ||||| |||   
Sbjct: 1002 aagaccccctgcgagctgggcttggcctccgggttgaccggcaggatgcactcgacgagc 943

                                                                        
Query: 382  atcaccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcg 441
            |  ||||| || ||||||||||| |||||||||||||||||||||||  |||| || |  
Sbjct: 942  acgaccttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgc 883

                                                        
Query: 442  tcgtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
            | ||||||  ||  || |||||||||||||||||||||||||||
Sbjct: 882  tggtcgctccagtcgtggaggatccacttcatgaggatggcgtc 839
to top
>emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 119/142 (83%)
 Strand = Plus / Minus

                                                                       
Query: 344 tggcgtccgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggca 403
           |||| ||||||||||||||| |||| ||||| |||   | |||||| || ||||||||||
Sbjct: 804 tggcctccgggttcaccggcaggatgcactcgacgagcaccaccttgccgtgcgccggca 745

                                                                       
Query: 404 gtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgagga 463
           | |||||||||||||||||||||||  |||| || |  | ||||||  ||  || |||||
Sbjct: 744 gcgcgtcgtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggagga 685

                                 
Query: 464 tccacttcatgaggatggcgtc 485
           ||||||||||||||||||||||
Sbjct: 684 tccacttcatgaggatggcgtc 663
to top
>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA, complete
            cds
          Length = 1455

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 251/318 (78%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||||||| |||| || |||||   || |||||||||||| |||| ||||||||||||
Sbjct: 1134 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgccggt 1075

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
             || |||||  ||||||||||   || ||  ||||||  |||||| ||| ||||||||||
Sbjct: 1074 gaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgccggg 1015

                                                                        
Query: 291  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 350
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1014 gttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggcctc 955

                                                                        
Query: 351  cgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 410
            |||||| |||||| |||| ||||  |||   |  ||||| || ||||||||||| |||||
Sbjct: 954  cgggttgaccggcaggatgcactggacgagcacgaccttgccgtgcgccggcagcgcgtc 895

                                                                        
Query: 411  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 470
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 894  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 835

                              
Query: 471  catgaggatggcgtctcc 488
            ||||||||||| ||||||
Sbjct: 834  catgaggatggtgtctcc 817
to top
>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds
          Length = 1233

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 114/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 349 tccgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggcagtgcg 408
           ||||||||||| ||| |||| |||||||||   | |||||| || ||||||||||  |||
Sbjct: 967 tccgggttcacaggcaggatgcactccacgagcaccaccttgccgtgcgccggcaacgcg 908

                                                                       
Query: 409 tcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccac 468
           ||||||||||||||||||||  | || || |  ||||||||  ||  || ||||||||||
Sbjct: 907 tcgtagcagttcttgagcagcgtcgcgcagtgctcgtcgctccagtcgtggaggatccac 848

                            
Query: 469 ttcatgaggatggcgtc 485
           |||||||||||||||||
Sbjct: 847 ttcatgaggatggcgtc 831
to top
>emb|AJ586106.1| Festuca arundinacea partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 385 accttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcg 444
           ||||| || ||||||||||| |||||||||||||||||||||||  |||| || |  | |
Sbjct: 763 accttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgctgg 704

                                                       
Query: 445 tcgctaaagcagttgaggatccacttcatgaggatggcgtctcc 488
           |||||  ||  || ||||||||||||||||||||||||||||||
Sbjct: 703 tcgctccagtcgtggaggatccacttcatgaggatggcgtctcc 660
to top
>gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferase mRNA, partial
           cds
          Length = 604

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 115/139 (82%)
 Strand = Plus / Minus

                                                                       
Query: 343 gtggcgtccgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggc 402
           ||||| |||||||||||||||  ||| |||||||||   || ||||| || |||| ||||
Sbjct: 536 gtggcttccgggttcaccggcaagatgcactccacgagcattaccttgccgtgcgtcggc 477

                                                                       
Query: 403 agtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgagg 462
           || ||||||||||||||||| |||||  | ||||| |  ||||||||  ||  || ||||
Sbjct: 476 agcgcgtcgtagcagttcttaagcagcgttgcacagtgctcgtcgctccagtcgtggagg 417

                              
Query: 463 atccacttcatgaggatgg 481
           |||||||||||||||||||
Sbjct: 416 atccacttcatgaggatgg 398
to top
>gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1430

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 247/315 (78%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||||||| |||| || ||||||  || |||||||||||| |||| ||||| ||||| 
Sbjct: 1160 ctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagccggc 1101

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
             || || ||  || ||||||||  |||||  ||||||  |||||| ||| |||| |||||
Sbjct: 1100 gaagccagctcccttggcgagcgcctcgaactccctctcgtacctctccctgccaccggg 1041

                                                                        
Query: 291  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 350
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1040 gttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcctc 981

                                                                        
Query: 351  cgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 410
            ||||| ||||||| |||| ||||||||    | |||||| || ||||| ||||| |||||
Sbjct: 980  cgggtgcaccggcaggatgcactccaccagtaccaccttgccgtgcgctggcagcgcgtc 921

                                                                        
Query: 411  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 470
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 920  gtagcagttcttgagcagcgtggcgcaatgctggtcgctccagtcgtggaggatccactt 861

                           
Query: 471  catgaggatggcgtc 485
            ||| |||||||||||
Sbjct: 860  catcaggatggcgtc 846
to top
>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid
            O-methyltransferase mRNA, complete cds
          Length = 1475

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 249/318 (78%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||||||| |||| || |||||   || |||||||||||| |||| |||||| |||||
Sbjct: 1153 ctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacaccggt 1094

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
             || |||||  ||||||||||   || ||  ||||||  |||||| ||| |||| |||||
Sbjct: 1093 gaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgcccccggg 1034

                                                                        
Query: 291  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 350
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1033 gttgtgcgcgagcatgatcatgtcgacgtggaagaccccctgcgagctgggattggcctc 974

                                                                        
Query: 351  cgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 410
            |||||| |||||| |||| ||||| |||   |  ||||| || | ||||||||| |||||
Sbjct: 973  cgggttgaccggcaggatgcactcgacgagcacgaccttgccgttcgccggcagcgcgtc 914

                                                                        
Query: 411  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 470
            ||||||||||||||||||  |||| || |  | ||||||  ||  || ||||||||||||
Sbjct: 913  gtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatccactt 854

                              
Query: 471  catgaggatggcgtctcc 488
            |||||||||||| |||||
Sbjct: 853  catgaggatggcatctcc 836
to top
>ref|XM_480185.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1425

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 1189 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
             || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

             
Query: 291  g 291
            |
Sbjct: 1069 g 1069



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 443
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 976 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 917

                                                     
Query: 444 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 916 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 875
to top
>dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G09, full
           insert sequence
          Length = 1227

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 171 ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
           |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 987 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 928

                                                                       
Query: 231 aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
            || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 927 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 868

            
Query: 291 g 291
           |
Sbjct: 867 g 867



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 443
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 774 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 715

                                                     
Query: 444 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 714 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 673
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                           
Query: 171     ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
               |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 3331696 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 3331755

                                                                           
Query: 231     aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
                || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 3331756 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 3331815

                
Query: 291     g 291
               |
Sbjct: 3331816 g 3331816



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                           
Query: 384     caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 443
               |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 3331909 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 3331968

                                                         
Query: 444     gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
               ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 3331969 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 3332010
to top
>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9)
            mRNA, complete cds
          Length = 1190

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 1121 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1062

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
             || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 1061 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1002

             
Query: 291  g 291
            |
Sbjct: 1001 g 1001



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 443
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 908 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 849

                                                     
Query: 444 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 848 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 807
to top
>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0438H08
          Length = 148626

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                          
Query: 171    ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
              |||||||||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 109263 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 109322

                                                                          
Query: 231    aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
               || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 109323 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 109382

               
Query: 291    g 291
              |
Sbjct: 109383 g 109383



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                          
Query: 384    caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 443
              |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 109476 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 109535

                                                        
Query: 444    gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
              ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 109536 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 109577
to top
>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase
          Length = 1486

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 cactccacgttgatcaccttaccatgcgccggcagtgcgtcgtagcagttcttgagcagg 429
           ||||| ||| |||||||||| || | | ||||||| ||||||||||||||||||||||| 
Sbjct: 994 cactcgacgatgatcaccttgccgttctccggcagcgcgtcgtagcagttcttgagcagc 935

                                                                   
Query: 430 atggcacactcgtcgtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
            |||| || |   |||||||  ||  || |||||||||||||||||||||||||||
Sbjct: 934 gtggcgcagtgcgcgtcgctccagtcgtggaggatccacttcatgaggatggcgtc 879



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 172  tacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttga 223
            |||||| || |||| || ||||||  || |||||||||||||||||||||||
Sbjct: 1192 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 1141
to top
>gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltransferase (OMT3) mRNA, complete
            cds
          Length = 1436

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 246/315 (78%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||||||| |||| || ||||||  || |||||||||||| |||| ||||| ||||| 
Sbjct: 1171 ctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagccggc 1112

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
             || || ||  |||||||||||  ||||   ||||||  |||||| ||| ||||||| ||
Sbjct: 1111 gaagccagctcccctggcgagcgcctcgtactccctctcgtacctctccctgccgcctgg 1052

                                                                        
Query: 291  gctgtacgccagcaggctcacgtccacgctgattaacccctgcgtgctgtttgtggcgtc 350
            | ||| ||| |||| | ||| ||| |||  ||  | |||||||| ||||    |||| ||
Sbjct: 1051 gttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgagctgggcttggcctc 992

                                                                        
Query: 351  cgggttcaccggctggatacactccacgttgatcaccttaccatgcgccggcagtgcgtc 410
            ||||||||||||| |||| ||||||||    | ||||||||| |||   ||||| |||||
Sbjct: 991  cgggttcaccggcaggatgcactccaccagcaccaccttaccgtgcattggcagcgcgtc 932

                                                                        
Query: 411  gtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagttgaggatccactt 470
            ||||||||||||||||||  || |||| |  | ||| ||  ||  || ||||||||||||
Sbjct: 931  gtagcagttcttgagcagcgtgccacaatgctggtcactccagtcgtggaggatccactt 872

                           
Query: 471  catgaggatggcgtc 485
            ||| |||||||||||
Sbjct: 871  catcaggatggcgtc 857
to top
>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial cds
          Length = 2782

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2576 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2517

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2516 ggaggatccacttcatgaggatggcgtcgccggcgggc 2479



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2773 ggcgtagatgtaggtggccttga 2751
to top
>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete
            cds
          Length = 2955

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2392 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2333

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2332 ggaggatccacttcatgaggatggcgtcgccggcgggc 2295



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2589 ggcgtagatgtaggtggccttga 2567
to top
>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial
            cds
          Length = 2925

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2719 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2660

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2659 ggaggatccacttcatgaggatggcgtcgccggcgggc 2622



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2916 ggcgtagatgtaggtggccttga 2894
to top
>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete
            cds
          Length = 3282

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2719 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2660

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2659 ggaggatccacttcatgaggatggcgtcgccggcgggc 2622



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2916 ggcgtagatgtaggtggccttga 2894
to top
>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial cds
          Length = 2757

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2551 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2492

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2491 ggaggatccacttcatgaggatggcgtcgccggcgggc 2454



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2748 ggcgtagatgtaggtggccttga 2726
to top
>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial
            cds
          Length = 2850

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2644 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2585

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2584 ggaggatccacttcatgaggatggcgtcgccggcgggc 2547



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2841 ggcgtagatgtaggtggccttga 2819
to top
>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial cds
          Length = 2675

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2467 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2408

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2407 ggaggatccacttcatgaggatggcgtcgccggcgggc 2370



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2664 ggcgtagatgtaggtggccttga 2642
to top
>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial
            cds
          Length = 2782

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2576 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2517

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2516 ggaggatccacttcatgaggatggcgtcgccggcgggc 2479



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2773 ggcgtagatgtaggtggccttga 2751
to top
>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial
            cds
          Length = 2927

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2719 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2660

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2659 ggaggatccacttcatgaggatggcgtcgccggcgggc 2622



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2916 ggcgtagatgtaggtggccttga 2894
to top
>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds
          Length = 3206

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2997 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2938

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2937 ggaggatccacttcatgaggatggcgtcgccggcgggc 2900



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3194 ggcgtagatgtaggtggccttga 3172
to top
>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete
            cds
          Length = 2676

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2437 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2378

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2377 ggaggatccacttcatgaggatggcgtcgccggcgggc 2340



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2634 ggcgtagatgtaggtggccttga 2612
to top
>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial cds
          Length = 2643

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2437 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2378

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2377 ggaggatccacttcatgaggatggcgtcgccggcgggc 2340



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2634 ggcgtagatgtaggtggccttga 2612
to top
>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial
            cds
          Length = 3151

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2943 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2884

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2883 ggaggatccacttcatgaggatggcgtcgccggcgggc 2846



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3140 ggcgtagatgtaggtggccttga 3118
to top
>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial
            cds
          Length = 2639

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2433 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2374

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2373 ggaggatccacttcatgaggatggcgtcgccggcgggc 2336



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2630 ggcgtagatgtaggtggccttga 2608
to top
>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds
          Length = 3102

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2896 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2837

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2836 ggaggatccacttcatgaggatggcgtcgccggcgggc 2799



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3093 ggcgtagatgtaggtggccttga 3071
to top
>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial
            cds
          Length = 3154

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2948 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2889

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2888 ggaggatccacttcatgaggatggcgtcgccggcgggc 2851



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3145 ggcgtagatgtaggtggccttga 3123
to top
>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial
            cds
          Length = 2892

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2686 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2627

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2626 ggaggatccacttcatgaggatggcgtcgccggcgggc 2589



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2883 ggcgtagatgtaggtggccttga 2861
to top
>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial
            cds
          Length = 2951

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2743 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2684

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2683 ggaggatccacttcatgaggatggcgtcgccggcgggc 2646



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2940 ggcgtagatgtaggtggccttga 2918
to top
>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete
            cds
          Length = 2982

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2743 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2684

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2683 ggaggatccacttcatgaggatggcgtcgccggcgggc 2646



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2940 ggcgtagatgtaggtggccttga 2918
to top
>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds
          Length = 2948

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2742 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2683

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2682 ggaggatccacttcatgaggatggcgtcgccggcgggc 2645



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2939 ggcgtagatgtaggtggccttga 2917
to top
>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds
          Length = 3131

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2925 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2866

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2865 ggaggatccacttcatgaggatggcgtcgccggcgggc 2828



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3122 ggcgtagatgtaggtggccttga 3100
to top
>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds
          Length = 3190

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2951 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2892

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2891 ggaggatccacttcatgaggatggcgtcgccggcgggc 2854



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3148 ggcgtagatgtaggtggccttga 3126
to top
>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial
            cds
          Length = 2748

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2542 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2483

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2482 ggaggatccacttcatgaggatggcgtcgccggcgggc 2445



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2739 ggcgtagatgtaggtggccttga 2717
to top
>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene,
            complete cds
          Length = 3088

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2849 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2790

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2789 ggaggatccacttcatgaggatggcgtcgccggcgggc 2752



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3046 ggcgtagatgtaggtggccttga 3024
to top
>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene,
            complete cds
          Length = 3095

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2856 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2797

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2796 ggaggatccacttcatgaggatggcgtcgccggcgggc 2759



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3053 ggcgtagatgtaggtggccttga 3031
to top
>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds
          Length = 3105

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2899 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2840

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2839 ggaggatccacttcatgaggatggcgtcgccggcgggc 2802



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3096 ggcgtagatgtaggtggccttga 3074
to top
>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds
          Length = 3111

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2903 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2844

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2843 ggaggatccacttcatgaggatggcgtcgccggcgggc 2806



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3100 ggcgtagatgtaggtggccttga 3078
to top
>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds
          Length = 3146

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2938 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2879

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2878 ggaggatccacttcatgaggatggcgtcgccggcgggc 2841



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3135 ggcgtagatgtaggtggccttga 3113
to top
>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds
          Length = 3073

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2865 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2806

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2805 ggaggatccacttcatgaggatggcgtcgccggcgggc 2768



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3062 ggcgtagatgtaggtggccttga 3040
to top
>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene,
            complete cds
          Length = 3061

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2834 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2775

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 2774 ggaggatccacttcatgaggatggcgtcgccggcgggc 2737



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 3031 ggcgtagatgtaggtggccttga 3009
to top
>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete
            cds
          Length = 2041

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1814 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1755

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 1754 ggaggatccacttcatgaggatggcgtcgccggcgggc 1717



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2011 ggcgtagatgtaggtggccttga 1989
to top
>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1763 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1704

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 1703 ggaggatccacttcatgaggatggcgtcgccggcgggc 1666



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 1960 ggcgtagatgtaggtggccttga 1938
to top
>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene, complete
            cds
          Length = 2074

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1835 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1776

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 1775 ggaggatccacttcatgaggatggcgtcgccggcgggc 1738



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2032 ggcgtagatgtaggtggccttga 2010
to top
>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1763 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1704

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 1703 ggaggatccacttcatgaggatggcgtcgccggcgggc 1666



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 1960 ggcgtagatgtaggtggccttga 1938
to top
>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds
          Length = 2512

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 1914 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 1855

                                                  
Query: 458  tgaggatccacttcatgaggatggcgtctccggtgggc 495
             ||||||||||||||||||||||||||| |||| ||||
Sbjct: 1854 ggaggatccacttcatgaggatggcgtcgccggcgggc 1817



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 201  ggcgtagatgtaggtggccttga 223
            |||||||||||||||||||||||
Sbjct: 2111 ggcgtagatgtaggtggccttga 2089
to top
>gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyltransferase (COMT)
            gene, complete cds
          Length = 2012

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                        
Query: 381  gatcaccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactc 440
            ||||||||| || | | ||||||| |||||||||||||||||||||||  |||| || | 
Sbjct: 1802 gatcaccttgccgttctccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtg 1743

                                                         
Query: 441  gtcgtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
              |||||||  ||  || |||||||||||||||||||||||||||
Sbjct: 1742 cgcgtcgctccagtcgtggaggatccacttcatgaggatggcgtc 1698



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 172  tacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttga 223
            |||||| || |||| || ||||||  || |||||||||||||||||||||||
Sbjct: 2011 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 1960
to top
>gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase gene, complete cds
          Length = 3312

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
            ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 2549 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 2490

                                             
Query: 458  tgaggatccacttcatgaggatggcgtctccgg 490
             ||||||||||||||||||||||||||| ||||
Sbjct: 2489 ggaggatccacttcatgaggatggcgtcgccgg 2457



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 172  tacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttga 223
            |||||| || |||| || ||||||  || |||||||||||||||||||||||
Sbjct: 2778 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 2727
to top
>gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA, complete cds
          Length = 1458

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                       
Query: 398 ccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtcgtcgctaaagcagt 457
           ||||||| |||||||||||||||||||||||  |||| || |   |||||||  ||  ||
Sbjct: 968 ccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgt 909

                                            
Query: 458 tgaggatccacttcatgaggatggcgtctccgg 490
            ||||||||||||||||||||||||||| ||||
Sbjct: 908 ggaggatccacttcatgaggatggcgtcgccgg 876



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 172  tacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttga 223
            |||||| || |||| || ||||||  || |||||||||||||||||||||||
Sbjct: 1197 tacttgatgaactcgatggcccaggcgttggcgtagatgtaggtggccttga 1146
to top
>dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA for caffeic acid
           o-methyl transferase, partial cds
          Length = 1067

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 171 ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
           |||||| ||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 807 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 748

                                                                       
Query: 231 aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
            || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 747 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 688

            
Query: 291 g 291
           |
Sbjct: 687 g 687



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 443
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 594 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 535

                                                     
Query: 444 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 534 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 493
to top
>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full
            insert sequence
          Length = 1425

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                        
Query: 171  ctacttggtgtactccattgcccagaagtcggcgtagatgtaggtggccttgacgccggt 230
            |||||| ||| |||| || ||||||  || ||||||||||||||||||||||| ||||||
Sbjct: 1189 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 231  aaacccggcagccctggcgagcttctcgaggtccctcaggtacctttccttgccgccggg 290
             || ||||| || | |||||||| |  ||  ||||||  |||||| ||||||||||||||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

             
Query: 291  g 291
            |
Sbjct: 1069 g 1069



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 caccttaccatgcgccggcagtgcgtcgtagcagttcttgagcaggatggcacactcgtc 443
           |||||| || ||| ||||||| |||||||||||||||||||||||    || || |  ||
Sbjct: 976 caccttcccgtgctccggcagcgcgtcgtagcagttcttgagcagccgcgcgcagtgctc 917

                                                     
Query: 444 gtcgctaaagcagttgaggatccacttcatgaggatggcgtc 485
           ||||||  ||  || ||||||||||||||| |||||||||||
Sbjct: 916 gtcgctccagtcgtggaggatccacttcatcaggatggcgtc 875
to top
>gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic acid
           O-methyltransferase mRNA, complete cds
          Length = 1408

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 398 ccggcagtgcgtcgtagcagttcttgag 425
           ||||||||||||||||||||||||||||
Sbjct: 936 ccggcagtgcgtcgtagcagttcttgag 909
to top
>gb|AC079258.4| Homo sapiens BAC clone RP11-410J22 from 2, complete sequence
          Length = 169408

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 133   caagaacacagcagcatgctata 155
             |||||||||||||||||||||||
Sbjct: 96328 caagaacacagcagcatgctata 96350
to top
>gb|AC163277.4| Mus musculus BAC clone RP24-471O20 from chromosome 18, complete
             sequence
          Length = 173704

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 452   agcagttgaggatccacttca 472
             |||||||||||||||||||||
Sbjct: 32332 agcagttgaggatccacttca 32312
to top
>gb|AC138084.4| Mus musculus BAC clone RP23-353F23 from chromosome 18, complete sequence
          Length = 186489

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 452    agcagttgaggatccacttca 472
              |||||||||||||||||||||
Sbjct: 133655 agcagttgaggatccacttca 133635
to top
>ref|XM_742823.1| Aspergillus fumigatus Af293 AMP-binding protein (Afu5g04270) partial
            mRNA
          Length = 2127

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 245  tggcgagcttctcgaggtccctcag 269
            |||||| ||||||||||||||||||
Sbjct: 1930 tggcgatcttctcgaggtccctcag 1906
to top
>emb|BX037446.1|CNS09122 Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 3-PRIME end
          of clone FK0AAA9DF09 of strain 6-9 of Anopheles gambiae
          (African malaria mosquito)
          Length = 691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 30 cttccttttattcgaacacaa 50
          |||||||||||||||||||||
Sbjct: 25 cttccttttattcgaacacaa 45
to top
>gb|AC099022.1| Drosophila melanogaster, chromosome 2L, region 23C-23D, BAC clone
             BACR48B06, complete sequence
          Length = 184554

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 26    cttgcttccttttattcgaacacaa 50
             |||||||||||||||||||| ||||
Sbjct: 29824 cttgcttccttttattcgaatacaa 29800
to top
>gb|AC008321.7| Drosophila melanogaster, chromosome 2L, region 23D-23F, BAC clone
             BACR11E09, complete sequence
          Length = 169931

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 26    cttgcttccttttattcgaacacaa 50
             |||||||||||||||||||| ||||
Sbjct: 88188 cttgcttccttttattcgaatacaa 88164
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 364     tggatacactccacgttgatc 384
               |||||||||||||||||||||
Sbjct: 6810537 tggatacactccacgttgatc 6810557
to top
>dbj|AP005826.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0758B01
          Length = 159206

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 364   tggatacactccacgttgatc 384
             |||||||||||||||||||||
Sbjct: 28263 tggatacactccacgttgatc 28283
to top
>dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:B1131G07
          Length = 133992

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 364    tggatacactccacgttgatc 384
              |||||||||||||||||||||
Sbjct: 131590 tggatacactccacgttgatc 131610
to top
>dbj|AK110984.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-174-C12, full
           insert sequence
          Length = 2189

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 364 tggatacactccacgttgatc 384
           |||||||||||||||||||||
Sbjct: 790 tggatacactccacgttgatc 810
to top
>gb|AE003580.3| Drosophila melanogaster chromosome 2L, section 11 of 83 of the complete
             sequence
          Length = 286920

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 26    cttgcttccttttattcgaacacaa 50
             |||||||||||||||||||| ||||
Sbjct: 28588 cttgcttccttttattcgaatacaa 28612
to top
>gb|L09204.1|DROTRS7A Drosophila melanogaster transfer RNA (tRNA-Ser7) gene
          Length = 3485

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 26  cttgcttccttttattcgaacacaa 50
           |||||||||||||||||||| ||||
Sbjct: 239 cttgcttccttttattcgaatacaa 215
to top
>gb|AC116850.10| Mus musculus chromosome 8, clone RP24-396C10, complete sequence
          Length = 147264

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 450   aaagcagttgaggatccact 469
             ||||||||||||||||||||
Sbjct: 81080 aaagcagttgaggatccact 81099
to top
>gb|AC123531.4| Mus musculus BAC clone RP24-289C11 from chromosome 15, complete
             sequence
          Length = 165766

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 5     atggaggacacgcatgttgcccttgctt 32
             ||||| |||| |||||||||||||||||
Sbjct: 70575 atggaagacatgcatgttgcccttgctt 70602
to top
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 289     gggctgtacgccagcaggct 308
               ||||||||||||||||||||
Sbjct: 1331511 gggctgtacgccagcaggct 1331530
to top
>gb|BC035017.2| Homo sapiens sodium channel, voltage-gated, type IV, beta, mRNA
           (cDNA clone MGC:33513 IMAGE:4817294), complete cds
          Length = 4577

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 202 gcgtagatgtaggtggcctt 221
           ||||||||||||||||||||
Sbjct: 271 gcgtagatgtaggtggcctt 252
to top
>gb|AC007268.5| Arabidopsis thaliana chromosome 2 clone T27D6 map PR1, complete
            sequence
          Length = 89685

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 31   ttccttttattcgaacacaaaata 54
            ||||||| ||||||||||||||||
Sbjct: 1413 ttcctttaattcgaacacaaaata 1390
to top
>gb|AF410153.1| Swinepox virus isolate 17077-99, complete genome
          Length = 146454

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 95    tacggtcgattaagatttattagaaatt 122
             |||||| ||| |||||||||||||||||
Sbjct: 80246 tacggttgatgaagatttattagaaatt 80219
to top
>ref|XM_693754.1| PREDICTED: Danio rerio similar to gamma filamin (LOC570288), mRNA
          Length = 7913

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 48   caaaatacaaaatgaaacga 67
            ||||||||||||||||||||
Sbjct: 7345 caaaatacaaaatgaaacga 7326
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 282     gccgccggggctgtacgcca 301
               ||||||||||||||||||||
Sbjct: 5399480 gccgccggggctgtacgcca 5399499
to top
>gb|AF260441.1|AF260441 HIV-1 isolate 85CD220 from Democratic Republic of the Congo, env
           glycoprotein, C2-V3 region (env) gene, partial cds
          Length = 522

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 323 ttaacccctgcgtgctgttt 342
           ||||||||||||||||||||
Sbjct: 420 ttaacccctgcgtgctgttt 401
to top
>dbj|AP004754.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0529B09
          Length = 138188

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 282   gccgccggggctgtacgcca 301
             ||||||||||||||||||||
Sbjct: 30414 gccgccggggctgtacgcca 30433
to top
>emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 in linkage group 19,
             complete sequence
          Length = 182182

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 45    acacaaaatacaaaatgaaa 64
             ||||||||||||||||||||
Sbjct: 13106 acacaaaatacaaaatgaaa 13125
to top
>emb|BX470230.5| Zebrafish DNA sequence from clone CH211-284B12 in linkage group 4,
             complete sequence
          Length = 173564

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    caaaatacaaaatgaaacga 67
             ||||||||||||||||||||
Sbjct: 65724 caaaatacaaaatgaaacga 65705
to top
>dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full insert sequence
          Length = 1703

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 51   aatacaaaatgaaacgattg 70
            ||||||||||||||||||||
Sbjct: 1599 aatacaaaatgaaacgattg 1580
to top
>emb|AL954190.5| Zebrafish DNA sequence from clone DKEY-30O6 in linkage group 4,
             complete sequence
          Length = 144062

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    caaaatacaaaatgaaacga 67
             ||||||||||||||||||||
Sbjct: 28373 caaaatacaaaatgaaacga 28354
to top
>emb|AL772211.7| Mouse DNA sequence from clone RP23-473B24 on chromosome 4, complete
             sequence
          Length = 189040

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   agaacacagcagcatgctat 154
             ||||||||||||||||||||
Sbjct: 51136 agaacacagcagcatgctat 51155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,392,459
Number of Sequences: 3902068
Number of extensions: 4392459
Number of successful extensions: 74713
Number of sequences better than 10.0: 90
Number of HSP's better than 10.0 without gapping: 90
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74365
Number of HSP's gapped (non-prelim): 336
length of query: 495
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 473
effective length of database: 17,147,199,772
effective search space: 8110625492156
effective search space used: 8110625492156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top