Clone Name | rbart24e08 |
---|---|
Clone Library Name | barley_pub |
>gb|AC122143.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0090F16, complete sequence Length = 147341 Score = 54.0 bits (27), Expect = 4e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 219 aggtactccgcggtgagaggcttgaagacacgctgctggtctgactctagcgcggccgcg 278 |||||| |||| |||||||||||||||| || || | ||| ||||| ||||| ||||| Sbjct: 94224 aggtacgccgccgtgagaggcttgaagatgcggtggtcgtcggactccagcgccgccgcc 94165 Query: 279 aggcgaggccatatgaaggcgct 301 || || ||||||||| ||||||| Sbjct: 94164 agccgcggccatatgtaggcgct 94142
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 54.0 bits (27), Expect = 4e-04 Identities = 69/83 (83%) Strand = Plus / Plus Query: 219 aggtactccgcggtgagaggcttgaagacacgctgctggtctgactctagcgcggccgcg 278 |||||| |||| |||||||||||||||| || || | ||| ||||| ||||| ||||| Sbjct: 24728264 aggtacgccgccgtgagaggcttgaagatgcggtggtcgtcggactccagcgccgccgcc 24728323 Query: 279 aggcgaggccatatgaaggcgct 301 || || ||||||||| ||||||| Sbjct: 24728324 agccgcggccatatgtaggcgct 24728346 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 3739473 catttgcatttgcatttgca 3739492
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 54.0 bits (27), Expect = 4e-04 Identities = 69/83 (83%) Strand = Plus / Plus Query: 219 aggtactccgcggtgagaggcttgaagacacgctgctggtctgactctagcgcggccgcg 278 |||||| |||| |||||||||||||||| || || | ||| ||||| ||||| ||||| Sbjct: 25039934 aggtacgccgccgtgagaggcttgaagatgcggtggtcgtcggactccagcgccgccgcc 25039993 Query: 279 aggcgaggccatatgaaggcgct 301 || || ||||||||| ||||||| Sbjct: 25039994 agccgcggccatatgtaggcgct 25040016 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 3748167 catttgcatttgcatttgca 3748186
>gb|S59242.1|S59189S4 Drosophila melanogaster calbindin-32 (cbn) gene, complete cds Length = 2162 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 119 ggatgcatttgcatttgcatttgca 143 ||||||||||||||||||||||||| Sbjct: 1422 ggatgcatttgcatttgcatttgca 1398
>emb|X68566.1|DMCALB32A D.melanogaster mRNA for calbindin-32 Length = 2648 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 119 ggatgcatttgcatttgcatttgca 143 ||||||||||||||||||||||||| Sbjct: 1909 ggatgcatttgcatttgcatttgca 1885
>ref|NM_057490.3| Drosophila melanogaster Calbindin 53E CG6702-RA (Cbp53E), mRNA Length = 2676 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 119 ggatgcatttgcatttgcatttgca 143 ||||||||||||||||||||||||| Sbjct: 1928 ggatgcatttgcatttgcatttgca 1904
>gb|AC099032.1| Drosophila melanogaster, chromosome 2R, region 53F-54A, BAC clone BACR32P08, complete sequence Length = 163072 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 119 ggatgcatttgcatttgcatttgca 143 ||||||||||||||||||||||||| Sbjct: 2806 ggatgcatttgcatttgcatttgca 2782
>gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53F-54X, BAC clone BACR09M08, complete sequence Length = 179283 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 119 ggatgcatttgcatttgcatttgca 143 ||||||||||||||||||||||||| Sbjct: 144489 ggatgcatttgcatttgcatttgca 144465
>gb|AE003805.3| Drosophila melanogaster chromosome 2R, section 45 of 73 of the complete sequence Length = 272948 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 119 ggatgcatttgcatttgcatttgca 143 ||||||||||||||||||||||||| Sbjct: 262986 ggatgcatttgcatttgcatttgca 262962
>gb|AC004335.1|AC004335 Drosophila melanogaster, chromosome 2R, region 53E1-53F1, P1 clone DS03108, complete sequence Length = 78592 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 119 ggatgcatttgcatttgcatttgca 143 ||||||||||||||||||||||||| Sbjct: 39122 ggatgcatttgcatttgcatttgca 39146
>gb|AC010921.12| Drosophila melanogaster clone BACR15L12, complete sequence Length = 163466 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgcag 144 ||||||||||||||||||||||| Sbjct: 57999 tgcatttgcatttgcatttgcag 57977
>gb|AC012160.7| Drosophila melanogaster clone BACR06G02, complete sequence Length = 172069 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgcag 144 ||||||||||||||||||||||| Sbjct: 45707 tgcatttgcatttgcatttgcag 45729
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgcag 144 ||||||||||||||||||||||| Sbjct: 32984624 tgcatttgcatttgcatttgcag 32984602
>gb|AC093713.6| Oryza sativa chromosome 3 BAC OSJNBa0094F01 genomic sequence, complete sequence Length = 151479 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgcag 144 ||||||||||||||||||||||| Sbjct: 5551 tgcatttgcatttgcatttgcag 5573
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgcag 144 ||||||||||||||||||||||| Sbjct: 33075134 tgcatttgcatttgcatttgcag 33075112
>gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence, complete sequence Length = 139823 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgcag 144 ||||||||||||||||||||||| Sbjct: 138684 tgcatttgcatttgcatttgcag 138706
>gb|AE003504.4| Drosophila melanogaster chromosome X, section 56 of 74 of the complete sequence Length = 298703 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgcag 144 ||||||||||||||||||||||| Sbjct: 175924 tgcatttgcatttgcatttgcag 175946
>ref|NM_191547.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 636 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 228 tgcatttgcatttgcatttgca 249
>ref|XM_477136.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1893 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 1886 tgcatttgcatttgcatttgca 1865
>ref|XM_715612.1| Candida albicans SC5314 putative mitochondrial chaperonin (CaO19_11745), mRNA Length = 1755 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 1353 tgcatttgcatttgcatttgca 1332
>ref|XM_715484.1| Candida albicans SC5314 putative mitochondrial chaperonin (CaO19_4269), mRNA Length = 1755 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 1353 tgcatttgcatttgcatttgca 1332
>gb|AY557668.1| Saccharomyces cerevisiae clone FLH001548.01X YDR073W gene, complete cds Length = 510 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 111 tgcatttgcatttgcatttgca 90 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 105 tgcatttgcatttgcatttg 86
>ref|XM_751605.1| Ustilago maydis 521 hypothetical protein (UM00551.1) partial mRNA Length = 2763 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 2252 tgcatttgcatttgcatttgca 2231
>ref|XM_754916.1| Ustilago maydis 521 hypothetical protein (UM03862.1) partial mRNA Length = 2751 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 2712 tgcatttgcatttgcatttgca 2691 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 2706 tgcatttgcatttgcatttgca 2685 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 2700 tgcatttgcatttgcatttgca 2679
>ref|XM_756814.1| Ustilago maydis 521 hypothetical protein (UM05760.1) partial mRNA Length = 4302 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgcag 144 |||||||||||||||||||||| Sbjct: 1543 gcatttgcatttgcatttgcag 1564
>ref|XM_756822.1| Ustilago maydis 521 hypothetical protein (UM05768.1) partial mRNA Length = 3120 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 597 tgcatttgcatttgcatttgca 576 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 591 tgcatttgcatttgcatttgca 570 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 602 gcatttgcatttgcatttgca 582
>gb|AC133172.4| Mus musculus BAC clone RP24-273H5 from chromosome 18, complete sequence Length = 206797 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 37617 tgcatttgcatttgcatttgca 37596 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 37611 tgcatttgcatttgcatttgca 37590 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 37605 tgcatttgcatttgcatttg 37586
>ref|XM_735817.1| Plasmodium chabaudi chabaudi hypothetical protein (PC104221.00.0) partial mRNA Length = 180 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 123 tgcatttgcatttgcatttgca 144
>gb|AC138010.13| Medicago truncatula clone mth2-21i21, complete sequence Length = 109275 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 66081 tgcatttgcatttgcatttgca 66060 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 66075 tgcatttgcatttgcatttg 66056
>gb|AC147013.4| Medicago truncatula clone mth2-159f24, complete sequence Length = 118017 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 74589 tgcatttgcatttgcatttgca 74568 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 74583 tgcatttgcatttgcatttg 74564
>gb|DQ450274.1| Drosophila melanogaster isolate tu1402102310 lim kinase (Lim1) gene, intron 1 Length = 953 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 753 tgcatttgcatttgcatttgca 774 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 759 tgcatttgcatttgcatttgc 779 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 748 gcatttgcatttgcatttgca 768
>gb|DQ450273.1| Drosophila melanogaster isolate bl3886 lim kinase (Lim1) gene, intron 1 Length = 952 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 752 tgcatttgcatttgcatttgca 773 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 758 tgcatttgcatttgcatttgc 778 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 747 gcatttgcatttgcatttgca 767
>gb|DQ450271.1| Drosophila melanogaster isolate bl3870 lim kinase (Lim1) gene, intron 1 Length = 959 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 759 tgcatttgcatttgcatttgca 780 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 765 tgcatttgcatttgcatttgc 785 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 754 gcatttgcatttgcatttgca 774
>gb|DQ450270.1| Drosophila melanogaster isolate bl3864 lim kinase (Lim1) gene, intron 1 Length = 954 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 754 tgcatttgcatttgcatttgca 775 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 760 tgcatttgcatttgcatttgc 780 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 749 gcatttgcatttgcatttgca 769
>gb|DQ450267.1| Drosophila melanogaster isolate bl3846 lim kinase (Lim1) gene, intron 1 Length = 953 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 753 tgcatttgcatttgcatttgca 774 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 759 tgcatttgcatttgcatttgc 779 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 748 gcatttgcatttgcatttgca 768
>gb|DQ450266.1| Drosophila melanogaster isolate bl3844 lim kinase (Lim1) gene, intron 1 Length = 959 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 759 tgcatttgcatttgcatttgca 780 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 765 tgcatttgcatttgcatttgc 785 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 754 gcatttgcatttgcatttgca 774
>gb|DQ450265.1| Drosophila melanogaster isolate bl3841 lim kinase (Lim1) gene, intron 1 Length = 953 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 753 tgcatttgcatttgcatttgca 774 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 759 tgcatttgcatttgcatttgc 779 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 748 gcatttgcatttgcatttgca 768
>emb|Z46796.1|SC8554 S.cerevisiae chromosome IV cosmid 8554 Length = 38760 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 8418 tgcatttgcatttgcatttgca 8397 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 8412 tgcatttgcatttgcatttg 8393
>emb|X82086.1|SCCHROIV S.cerevisiae DNA for right arm of chromosome IV Length = 32821 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 2777 tgcatttgcatttgcatttgca 2756 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 2771 tgcatttgcatttgcatttg 2752
>emb|AL121806.2|DMBR42I17 Drosophila melanogaster BAC clone BACR42I17 Length = 155168 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 88893 tgcatttgcatttgcatttgca 88872
>ref|NM_143606.1| Drosophila melanogaster CG15566-RA (CG15566), mRNA Length = 645 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 369 tgcatttgcatttgcatttgca 348 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 374 gcatttgcatttgcatttgca 354 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 363 tgcatttgcatttgcatttgc 343
>gb|AC067942.6| Homo sapiens BAC clone RP11-791G16 from 4, complete sequence Length = 187399 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 65645 tgcatttgcatttgcatttgca 65624 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 65649 catttgcatttgcatttgca 65630
>gb|AC104410.3| Drosophila melanogaster X BAC RP98-10H22 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179869 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 103730 tgcatttgcatttgcatttgca 103709
>emb|BX663616.13| Zebrafish DNA sequence from clone DKEY-287H22 in linkage group 7, complete sequence Length = 150010 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 80791 tgcatttgcatttgcatttgca 80770
>gb|AC095015.1| Drosophila melanogaster, chromosome 3R, region 84A-84B, BAC clone BACR32J03, complete sequence Length = 190642 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 67749 tgcatttgcatttgcatttgca 67770 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 67743 tgcatttgcatttgcatttgca 67764 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 67737 tgcatttgcatttgcatttgca 67758 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 67731 tgcatttgcatttgcatttgca 67752 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 67727 catttgcatttgcatttgca 67746
>gb|DQ204736.1| Oryza sativa (japonica cultivar-group) cultivar Jefferson brown pericarp and seed coat (Rc) pseudogene, complete sequence Length = 6429 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 6422 tgcatttgcatttgcatttgca 6401
>gb|DQ204735.1| Oryza sativa (japonica cultivar-group) cultivar H75 brown pericarp and seed coat (Rc) gene, complete cds Length = 6442 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 6435 tgcatttgcatttgcatttgca 6414
>gb|AE001572.2| Drosophila melanogaster Antennapedia complex (ANT-C),complete sequence Length = 429825 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 156062 tgcatttgcatttgcatttgca 156041 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 156056 tgcatttgcatttgcatttgca 156035 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 156050 tgcatttgcatttgcatttgca 156029 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 156044 tgcatttgcatttgcatttgca 156023 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 156066 catttgcatttgcatttgca 156047
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 26225458 tgcatttgcatttgcatttgca 26225479 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 6101462 tgcatttgcatttgcatttgca 6101441 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 26225464 tgcatttgcatttgcatttgc 26225484 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 2290654 gcatttgcatttgcatttgca 2290634 Score = 40.1 bits (20), Expect = 5.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 216 ccaaggtactccgcggtgagaggcttgaagac 247 ||||| ||| |||| ||||||||||||||||| Sbjct: 8092508 ccaagatacgccgccgtgagaggcttgaagac 8092477
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 27168840 tgcatttgcatttgcatttgca 27168861
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 30562652 tgcatttgcatttgcatttgca 30562673
>gb|AC009356.3|AC009356 Drosophila melanogaster, chromosome 2R, region 52E-53A, BAC clone BACR25I17, complete sequence Length = 157835 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 63531 tgcatttgcatttgcatttgca 63510
>gb|AC106743.4| Homo sapiens chromosome 16 clone RP11-116D9, complete sequence Length = 117710 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 139 ttgcaggagaagaattaatttagaga 164 ||||||||| |||||||||||||||| Sbjct: 92650 ttgcaggaggagaattaatttagaga 92675
>gb|AC008287.4|AC008287 Drosophila melanogaster, chromosome 3R, region 100C-100C, BAC clone BACR02G16, complete sequence Length = 177480 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 20374 tgcatttgcatttgcatttgca 20353 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 20379 gcatttgcatttgcatttgca 20359 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 20368 tgcatttgcatttgcatttgc 20348
>gb|AC008230.4|AC008230 Drosophila melanogaster, chromosome 2R, region 53A-53C, BAC clone BACR17I17, complete sequence Length = 159640 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 40081 tgcatttgcatttgcatttgca 40060
>dbj|AP003309.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBb0036G09 Length = 124118 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 45256 tgcatttgcatttgcatttgca 45277
>dbj|AP003560.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1060H01 Length = 157987 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 4929 tgcatttgcatttgcatttgca 4950
>gb|AC018716.4|AC018716 Homo sapiens BAC clone RP11-430H10 from 11, complete sequence Length = 179726 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 34931 tgcatttgcatttgcatttgca 34952
>gb|AF272705.1|F4I4 Arabidopsis thaliana BAC F4I4 Length = 145744 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 13340 tgcatttgcatttgcatttgca 13319 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 13334 tgcatttgcatttgcatttgca 13313 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 13328 tgcatttgcatttgcatttg 13309 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 2525 tgcatttgcatttgcatttg 2506
>dbj|AP004334.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0455H11 Length = 101607 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 86 tgcatttgcatttgcatttgca 107 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 92 tgcatttgcatttgcatttgc 112
>dbj|AP003633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0637D03 Length = 180159 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 25856 tgcatttgcatttgcatttgca 25877
>dbj|AP003628.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0473H04 Length = 155204 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 137650 tgcatttgcatttgcatttgca 137671
>dbj|AP005098.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0008C11 Length = 157205 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 156632 tgcatttgcatttgcatttgca 156611
>dbj|AP005779.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0042J07 Length = 126938 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 4472 tgcatttgcatttgcatttgca 4451
>gb|AF049236.1|AF049236 Arabidopsis thaliana putative transmembrane protein G1p (AtG1), putative nuclear DNA-binding protein G2p (AtG2), Em1 protein (ATEM1), putative chlorophyll synthetase (AtG4), putative transmembrane protein G5p (AtG5), putative acyl-coA dehydrogenase (AtG6), and calcium dependent protein kinase genes, complete cds; and unknown genes Length = 60000 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 27029 tgcatttgcatttgcatttgca 27050
>gb|AC157472.3| Medicago truncatula chromosome 7 BAC clone mth2-41h16, complete sequence Length = 114287 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 38847 tgcatttgcatttgcatttgca 38826
>dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0519E12 Length = 152448 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 117316 tgcatttgcatttgcatttgca 117337 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 117322 tgcatttgcatttgcatttgc 117342
>emb|Z74369.1|SCYDR073W S.cerevisiae chromosome IV reading frame ORF YDR073w Length = 4120 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 2777 tgcatttgcatttgcatttgca 2756 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 2771 tgcatttgcatttgcatttg 2752
>gb|AC001653.1|AC001653 Drosophila melanogaster, chromosome 3R, region 84B1-84B2, P1 clone DS07876, complete sequence Length = 66991 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 62996 tgcatttgcatttgcatttgca 63017 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 62990 tgcatttgcatttgcatttgca 63011 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 62984 tgcatttgcatttgcatttgca 63005 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 62978 tgcatttgcatttgcatttgca 62999 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 62974 catttgcatttgcatttgca 62993
>gb|AE003673.3| Drosophila melanogaster chromosome 3R, section 11 of 118 of the complete sequence Length = 308146 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 122609 tgcatttgcatttgcatttgca 122630 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 122603 tgcatttgcatttgcatttgca 122624 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 122597 tgcatttgcatttgcatttgca 122618 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 122591 tgcatttgcatttgcatttgca 122612 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 122587 catttgcatttgcatttgca 122606
>gb|AE003807.3| Drosophila melanogaster chromosome 2R, section 43 of 73 of the complete sequence Length = 258223 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 99146 tgcatttgcatttgcatttgca 99125
>gb|AE003778.3| Drosophila melanogaster chromosome 3R, section 116 of 118 of the complete sequence Length = 225974 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 2641 tgcatttgcatttgcatttgca 2620 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 2646 gcatttgcatttgcatttgca 2626 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 2635 tgcatttgcatttgcatttgc 2615
>gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 of 74 of the complete sequence Length = 308311 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 44973 tgcatttgcatttgcatttgca 44952
>gb|AC004318.1|AC004318 Drosophila melanogaster DNA sequence (P1 DS06464 (D212)), complete sequence Length = 86188 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 64890 tgcatttgcatttgcatttgca 64869
>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome Length = 5498450 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 1520754 tgcatttgcatttgcatttgca 1520733 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 1520758 catttgcatttgcatttgca 1520739
>dbj|AP004579.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT11E23, TM0557 Length = 87695 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 17634 tgcatttgcatttgcatttgca 17655
>dbj|AP004578.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT17H01, TM0541, complete sequence Length = 110985 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgca 143 |||||||||||||||||||||| Sbjct: 105237 tgcatttgcatttgcatttgca 105258
>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome Length = 4607203 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgcag 144 ||||||||||||||||||||| Sbjct: 1149368 catttgcatttgcatttgcag 1149348 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 382 ccggcatcgccagcgcggcg 401 |||||||||||||||||||| Sbjct: 3198311 ccggcatcgccagcgcggcg 3198292
>ref|XM_635042.1| Dictyostelium discoideum hypothetical protein (DDB0204846), partial mRNA Length = 1227 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgcag 144 ||||||||||||||||||||| Sbjct: 961 catttgcatttgcatttgcag 941
>gb|AC164176.12| Mus musculus 10 BAC RP23-8O18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 216064 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 157052 tgcatttgcatttgcatttgc 157032
>gb|AY392542.1| Porcine teschovirus isolate 2-AK-III polyprotein gene, partial cds Length = 3583 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 131 atttgcatttgcaggagaaga 151 ||||||||||||||||||||| Sbjct: 2318 atttgcatttgcaggagaaga 2338
>gb|AY392541.1| Porcine teschovirus isolate 12-PL polyprotein gene, partial cds Length = 3857 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 131 atttgcatttgcaggagaaga 151 ||||||||||||||||||||| Sbjct: 2312 atttgcatttgcaggagaaga 2332
>gb|AC168279.3| Mus musculus 10 BAC RP23-345H24 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 196860 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 154885 tgcatttgcatttgcatttgc 154905
>gb|AC151537.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0087D01, complete sequence Length = 83225 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 45348 gcatttgcatttgcatttgca 45368
>gb|AC151407.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0073M15, complete sequence Length = 143071 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 124247 gcatttgcatttgcatttgca 124267
>emb|CR715518.2|CNS0GF1M Tetraodon nigroviridis full-length cDNA Length = 1081 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 223 tgcatttgcatttgcatttgc 203
>gb|AC090711.3| Homo sapiens chromosome 8 clone RP11-89H1 map 8q21-q23, complete sequence Length = 153053 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 25 atttattcaatggagaaacttttacaact 53 |||| ||||||||| |||||||||||||| Sbjct: 35388 attttttcaatggaaaaacttttacaact 35360
>emb|AL451005.9| Human DNA sequence from clone RP11-92B10 on chromosome X Contains the 5' end of a variant of the CUL4B gene for cullin 4B and the 5' end of a variant of the gene for MCT-1 protein (MCT-1), complete sequence Length = 26768 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 306 atccacgttcctgggtttccc 326 ||||||||||||||||||||| Sbjct: 17593 atccacgttcctgggtttccc 17573
>gb|DQ450278.1| Drosophila melanogaster isolate tu1402102317 lim kinase (Lim1) gene, intron 1 Length = 946 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 752 tgcatttgcatttgcatttgc 772 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 747 gcatttgcatttgcatttgca 767
>gb|DQ450277.1| Drosophila melanogaster isolate tu1402102316 lim kinase (Lim1) gene, intron 1 Length = 947 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 753 tgcatttgcatttgcatttgc 773 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 748 gcatttgcatttgcatttgca 768
>gb|DQ450276.1| Drosophila melanogaster isolate tu1402102314 lim kinase (Lim1) gene, intron 1 Length = 947 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 753 tgcatttgcatttgcatttgc 773 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 748 gcatttgcatttgcatttgca 768
>gb|DQ450275.1| Drosophila melanogaster isolate tu1402102311 lim kinase (Lim1) gene, intron 1 Length = 935 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 741 tgcatttgcatttgcatttgc 761 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 736 gcatttgcatttgcatttgca 756
>gb|DQ450272.1| Drosophila melanogaster isolate bl3875 lim kinase (Lim1) gene, intron 1 Length = 947 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 753 tgcatttgcatttgcatttgc 773 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 748 gcatttgcatttgcatttgca 768
>gb|DQ450269.1| Drosophila melanogaster isolate bl3853 lim kinase (Lim1) gene, intron 1 Length = 945 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 751 tgcatttgcatttgcatttgc 771 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 746 gcatttgcatttgcatttgca 766
>gb|DQ450268.1| Drosophila melanogaster isolate bl3852 lim kinase (Lim1) gene, intron 1 Length = 947 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 753 tgcatttgcatttgcatttgc 773 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 748 gcatttgcatttgcatttgca 768
>gb|DQ450264.1| Drosophila melanogaster isolate bl3839 lim kinase (Lim1) gene, intron 1 Length = 947 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 753 tgcatttgcatttgcatttgc 773 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 748 gcatttgcatttgcatttgca 768
>gb|DQ450263.1| Drosophila melanogaster isolate bl1 lim kinase (Lim1) gene, intron 1 Length = 947 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 753 tgcatttgcatttgcatttgc 773 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 748 gcatttgcatttgcatttgca 768
>gb|AC023748.4| Drosophila melanogaster X BAC RP98-36F8 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 156096 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 103648 gcatttgcatttgcatttgca 103628 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 103643 tgcatttgcatttgcatttgc 103623
>gb|AC023718.4| Drosophila melanogaster X BAC RP98-7P15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 164415 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 82165 gcatttgcatttgcatttgca 82185
>tpg|BK003634.1| TPA: TPA_inf: Drosophila melanogaster HDC04273 (HDC04273) gene, complete cds Length = 405 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 8 tgcatttgcatttgcatttgc 28
>gb|AC087110.3| Homo sapiens chromosome 8, clone CTD-2033B22, complete sequence Length = 145544 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 25 atttattcaatggagaaacttttacaact 53 |||| ||||||||| |||||||||||||| Sbjct: 84355 attttttcaatggaaaaacttttacaact 84383
>gb|AC092190.1|AC092190 Drosophila melanogaster, chromosome X, region 20C-20D, BAC clone BACR08A09, complete sequence Length = 172266 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 41190 gcatttgcatttgcatttgca 41170
>gb|AC021325.5|AC021325 Homo sapiens chromosome , clone RP11-23N15, complete sequence Length = 180568 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 152 attaatttagagacgaggtct 172 ||||||||||||||||||||| Sbjct: 27684 attaatttagagacgaggtct 27664
>gb|AC007144.13|AC007144 Drosophila melanogaster, chromosome 2L, region 38F-39A, BAC clone BACR06G10, complete sequence Length = 176082 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 110875 tgcatttgcatttgcatttgc 110895
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 28064685 tgcatttgcatttgcatttgc 28064665
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 7248446 tgcatttgcatttgcatttgc 7248426 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 35156207 tgcatttgcatttgcatttg 35156226
>gb|AC008304.3|AC008304 Drosophila melanogaster, chromosome 2R, region 59D2-59D3, BAC clone BACR04G19, complete sequence Length = 181955 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 74294 tgcatttgcatttgcatttgc 74314
>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome Length = 4599354 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgcag 144 ||||||||||||||||||||| Sbjct: 1152260 catttgcatttgcatttgcag 1152240 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 382 ccggcatcgccagcgcggcg 401 |||||||||||||||||||| Sbjct: 3186973 ccggcatcgccagcgcggcg 3186954
>gb|AC023724.5| Drosophila melanogaster X BAC RP98-14B2 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 181974 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 71583 gcatttgcatttgcatttgca 71563 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 71578 tgcatttgcatttgcatttgc 71558
>dbj|AP005524.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0562A06 Length = 154198 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 142177 tgcatttgcatttgcatttgc 142157
>emb|BX005447.8| Zebrafish DNA sequence from clone DKEY-29B14, complete sequence Length = 283185 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgcag 144 ||||||||||||||||||||| Sbjct: 190928 catttgcatttgcatttgcag 190948
>dbj|AP005394.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0620H05 Length = 161808 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 148383 tgcatttgcatttgcatttgc 148363
>dbj|AP005756.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0035N08 Length = 136267 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 24254 tgcatttgcatttgcatttgc 24234
>dbj|AP005544.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0604E01 Length = 159049 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 62180 tgcatttgcatttgcatttgc 62160
>dbj|AK100833.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123D15, full insert sequence Length = 1037 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 672 gcatttgcatttgcatttgca 652
>emb|AL391749.4|CNS06C8I Human chromosome 14 DNA sequence BAC R-233L14 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 195007 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 119695 tgcatttgcatttgcatttgc 119675
>dbj|AP003824.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1343_B12 Length = 121362 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 64353 gcatttgcatttgcatttgca 64333
>gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77 of 83 of the complete sequence Length = 270158 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 209693 tgcatttgcatttgcatttgc 209713
>gb|AE003573.4| Drosophila melanogaster chromosome X, section 74 of 74 of the complete sequence Length = 313035 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 51610 gcatttgcatttgcatttgca 51630
>gb|AE003486.2| Drosophila melanogaster chromosome X, section 38 of 74 of the complete sequence Length = 328128 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 79393 gcatttgcatttgcatttgca 79413
>gb|AE003460.2| Drosophila melanogaster chromosome 2R, section 68 of 73 of the complete sequence Length = 299331 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 126771 tgcatttgcatttgcatttgc 126791
>gb|AE003445.2| Drosophila melanogaster chromosome X, section 29 of 74 of the complete sequence Length = 334222 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttgc 142 ||||||||||||||||||||| Sbjct: 82745 tgcatttgcatttgcatttgc 82765 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 82740 gcatttgcatttgcatttgca 82760
>dbj|AB085897.1| Cucumis sativus CS-PIN1 mRNA for PIN1-like auxin transport protein, complete cds Length = 2262 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgca 143 ||||||||||||||||||||| Sbjct: 1103 gcatttgcatttgcatttgca 1083
>gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome Length = 3730232 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 349 accccgtgcacagcctgccg 368 |||||||||||||||||||| Sbjct: 3446202 accccgtgcacagcctgccg 3446221
>ref|XM_629023.1| Dictyostelium discoideum hypothetical protein (DDB0192024), partial mRNA Length = 6045 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 1814 tgcatttgcatttgcatttg 1795
>gb|AC005965.1| Arabidopsis thaliana BAC T19G15, from chromosome V near 60.5 cM, complete sequence Length = 77036 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 67971 tgcatttgcatttgcatttg 67952
>ref|XM_477237.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1047 Score = 40.1 bits (20), Expect = 5.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 216 ccaaggtactccgcggtgagaggcttgaagac 247 ||||| ||| |||| ||||||||||||||||| Sbjct: 1037 ccaagatacgccgccgtgagaggcttgaagac 1006
>gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1007D10, complete sequence Length = 153366 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 tttatttattcaatggagaa 41 |||||||||||||||||||| Sbjct: 63221 tttatttattcaatggagaa 63240
>gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence Length = 1653225 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 742306 gcatttgcatttgcatttgc 742287
>gb|AC120539.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0063D09 map S1559, complete sequence Length = 190721 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 107145 catttgcatttgcatttgca 107164
>gb|AC104642.11| Trypanosoma brucei chromosome 3 clone RPCI93-27C5, complete sequence Length = 126762 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 51254 gcatttgcatttgcatttgc 51235
>gb|AC016158.4| Drosophila melanogaster clone BACR38H07, complete sequence Length = 172841 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 123095 gcatttgcatttgcatttgc 123114
>gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete sequence Length = 176395 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 77525 tgcatttgcatttgcatttg 77544
>ref|XM_709592.1| Candida albicans SC5314 hypothetical protein (CaO19.6979), mRNA Length = 2343 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 1387 catttgcatttgcatttgca 1368
>gb|AY264885.1|AY227363S2 Zea mays MADS-box transcription factor MADS2 (mads2) gene, exons 3 through 8, and complete cds Length = 2598 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 1128 tgcatttgcatttgcatttg 1147
>ref|XM_751533.1| Ustilago maydis 521 hypothetical protein (UM00479.1) partial mRNA Length = 4668 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 4457 tgcatttgcatttgcatttg 4438
>ref|XM_820523.1| Trypanosoma brucei TREU927 clone RPCI93-27C5 hypothetical protein (Tb927.3.2870) partial mRNA Length = 1965 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 60 gcatttgcatttgcatttgc 79
>ref|XM_750891.1| Aspergillus fumigatus Af293 ubiquitin conjugating enzyme UbcF (Afu2g16470) partial mRNA Length = 939 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 656 gcatttgcatttgcatttgc 637
>gb|AE014311.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 8 of 11 of the complete sequence Length = 250029 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 86810 tgcatttgcatttgcatttg 86829
>gb|AC146133.3| Pan troglodytes BAC clone RP43-38C10 from 7, complete sequence Length = 168763 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 70775 tgcatttgcatttgcatttg 70756
>ref|XM_723534.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY01087) partial mRNA Length = 4725 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 3541 catttgcatttgcatttgca 3522 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 3537 tgcatttgcatttgcatttg 3518
>ref|XM_960987.1| Plasmodium falciparum 3D7 hypothetical protein (PFF0445w) partial mRNA Length = 18234 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 7500 tgcatttgcatttgcatttg 7481
>gb|U41992.1| Caenorhabditis elegans cosmid F32E10, complete sequence Length = 33318 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 3924 catttgcatttgcatttgca 3943
>gb|AE014075.1| Escherichia coli CFT073, complete genome Length = 5231428 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 382 ccggcatcgccagcgcggcg 401 |||||||||||||||||||| Sbjct: 3649866 ccggcatcgccagcgcggcg 3649847
>emb|CR759789.8| Zebrafish DNA sequence from clone CH211-153M1, complete sequence Length = 165831 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 47218 catttgcatttgcatttgca 47199
>gb|CP000243.1| Escherichia coli UTI89, complete genome Length = 5065741 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 382 ccggcatcgccagcgcggcg 401 |||||||||||||||||||| Sbjct: 3437082 ccggcatcgccagcgcggcg 3437063
>emb|AL606823.4| Human DNA sequence from clone RP11-49K6 on chromosome 13, complete sequence Length = 39184 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 4798 tgcatttgcatttgcatttg 4817
>emb|AL356967.23| Human DNA sequence from clone RP11-427E4 on chromosome 6 Contains a novel pseudogene, complete sequence Length = 163869 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 attcaatggagaaactttta 48 |||||||||||||||||||| Sbjct: 39215 attcaatggagaaactttta 39196
>gb|AC124926.7| Rattus norvegicus X BAC CH230-155H3 (Children's Hospital Oakland Research Institute) complete sequence Length = 217309 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 210115 gcatttgcatttgcatttgc 210134
>gb|AC093489.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1116_A10, complete sequence Length = 102275 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 tttatttattcaatggagaa 41 |||||||||||||||||||| Sbjct: 62061 tttatttattcaatggagaa 62080
>emb|Z98547.2|PFMAL3P3 Plasmodium falciparum MAL3P3, complete sequence Length = 116696 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 80341 catttgcatttgcatttgca 80360
>emb|CR382399.1| Plasmodium falciparum chromosome 6, complete sequence; segment 2/5 Length = 348174 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 28388 tgcatttgcatttgcatttg 28369
>emb|AL161511.2|ATCHRIV23 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 23 Length = 197306 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 130213 tgcatttgcatttgcatttg 130232
>emb|BX927166.14| Zebrafish DNA sequence from clone DKEY-28M24 in linkage group 18, complete sequence Length = 108091 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 121 atgcatttgcatttgcattt 140 |||||||||||||||||||| Sbjct: 45958 atgcatttgcatttgcattt 45977
>gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 192681 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 94411 catttgcatttgcatttgca 94430
>gb|AC113619.5| Drosophila melanogaster X BAC RP98-22D21 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 160001 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 77156 gcatttgcatttgcatttgc 77175
>gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 177096 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 113780 tgcatttgcatttgcatttg 113761
>gb|AC010031.8| Drosophila melanogaster 3L BAC RP98-2M20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 173509 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 106546 tgcatttgcatttgcatttg 106527
>gb|AC023710.5| Drosophila melanogaster X BAC RP98-19D3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 189976 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 9077 gcatttgcatttgcatttgc 9058
>tpg|BK002861.1| TPA: TPA_inf: Drosophila melanogaster HDC15820 (HDC15820) gene, complete cds Length = 1544 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 1317 catttgcatttgcatttgca 1298
>gb|AC007167.5| Arabidopsis thaliana chromosome 2 clone F3C11 map mi310, complete sequence Length = 103874 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 35310 tgcatttgcatttgcatttg 35329
>gb|AC006446.4| Arabidopsis thaliana chromosome 2 clone F15O11 map PRI, complete sequence Length = 91688 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 53621 tgcatttgcatttgcatttg 53640
>gb|AC027251.6| Homo sapiens chromosome 8, clone RP11-14G5, complete sequence Length = 130377 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 121 atgcatttgcatttgcattt 140 |||||||||||||||||||| Sbjct: 25264 atgcatttgcatttgcattt 25245
>gb|DP000033.1| Carollia perspicillata target 116 genomic scaffold Length = 347743 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 268087 catttgcatttgcatttgca 268068
>gb|AC155282.1| Medicago truncatula chromosome 2 BAC clone mth2-63e12, complete sequence Length = 251117 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 30820 catttgcatttgcatttgca 30801
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 tttatttattcaatggagaa 41 |||||||||||||||||||| Sbjct: 5376547 tttatttattcaatggagaa 5376566
>gb|AC009981.6|AC009981 Drosophila melanogaster, chromosome 3R, region 97C-97D, BAC clone BACR24O14, complete sequence Length = 170356 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 110546 catttgcatttgcatttgca 110527
>gb|AC008358.4|AC008358 Drosophila melanogaster, chromosome 3R, region 86E-86E, BAC clone BACR48B07, complete sequence Length = 170307 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 90429 catttgcatttgcatttgca 90448
>gb|AC007710.11|AC007710 Drosophila melanogaster, chromosome 3R, region 86E-86E, BAC clone BACR05C15, complete sequence Length = 174426 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 40950 catttgcatttgcatttgca 40969
>gb|AC013437.8| Homo sapiens BAC clone RP11-190J23 from 2, complete sequence Length = 167424 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 116125 tgcatttgcatttgcatttg 116106
>dbj|AP003738.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1058_C08 Length = 117923 Score = 40.1 bits (20), Expect = 5.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 216 ccaaggtactccgcggtgagaggcttgaagac 247 ||||| ||| |||| ||||||||||||||||| Sbjct: 26280 ccaagatacgccgccgtgagaggcttgaagac 26249
>dbj|AP004048.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1202_E07 Length = 145014 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 51563 tgcatttgcatttgcatttg 51582
>dbj|AB028618.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MOD1 Length = 85690 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 237 tgcatttgcatttgcatttg 256
>dbj|AB005248.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI10 Length = 83646 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 34577 tgcatttgcatttgcatttg 34596 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 24444 tgcatttgcatttgcatttg 24463
>emb|AL110116.1|ATC18G5 Arabidopsis thaliana DNA chromosome 4, BAC clone C18G5, partial sequence (ESSA project) Length = 30649 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 9701 tgcatttgcatttgcatttg 9720
>dbj|AK069089.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008B14, full insert sequence Length = 3756 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 tttatttattcaatggagaa 41 |||||||||||||||||||| Sbjct: 3680 tttatttattcaatggagaa 3699
>gb|AF077407.1|F9D12 Arabidopsis thaliana BAC F9D12 Length = 112253 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 56721 tgcatttgcatttgcatttg 56702
>emb|AL445363.7|CNS07ECY Human chromosome 14 DNA sequence BAC R-671J11 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 181987 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 ttaatttagagacgaggtct 172 |||||||||||||||||||| Sbjct: 120425 ttaatttagagacgaggtct 120406
>emb|AL132951.3|CEY67H2A Caenorhabditis elegans YAC Y67H2A, complete sequence Length = 57745 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 24058 tgcatttgcatttgcatttg 24039
>emb|BX957286.14| Zebrafish DNA sequence from clone CH211-119B12 in linkage group 20, complete sequence Length = 161104 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 tggcaacacaatgcaacaaa 72 |||||||||||||||||||| Sbjct: 96448 tggcaacacaatgcaacaaa 96467
>gb|AY110277.1| Zea mays CL615_-1 mRNA sequence Length = 982 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 294 aaggcgctgatgatccacgt 313 |||||||||||||||||||| Sbjct: 617 aaggcgctgatgatccacgt 636
>gb|AE003758.4| Drosophila melanogaster chromosome 3R, section 96 of 118 of the complete sequence Length = 228635 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 64062 catttgcatttgcatttgca 64043
>gb|AE003730.3| Drosophila melanogaster chromosome 3R, section 68 of 118 of the complete sequence Length = 221402 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 88422 gcatttgcatttgcatttgc 88441
>gb|AE003691.4| Drosophila melanogaster chromosome 3R, section 29 of 118 of the complete sequence Length = 266829 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 61220 catttgcatttgcatttgca 61239
>gb|AE003705.3| Drosophila melanogaster chromosome 3R, section 43 of 118 of the complete sequence Length = 216741 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 7559 tgcatttgcatttgcatttg 7540
>gb|AE003536.4| Drosophila melanogaster chromosome 3L, section 49 of 83 of the complete sequence Length = 350428 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 153574 tgcatttgcatttgcatttg 153593
>gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 of 83 of the complete sequence Length = 301691 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 90783 catttgcatttgcatttgca 90802
>gb|AE003436.3| Drosophila melanogaster chromosome X, section 20 of 74 of the complete sequence Length = 317322 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 gcatttgcatttgcatttgc 142 |||||||||||||||||||| Sbjct: 316198 gcatttgcatttgcatttgc 316179
>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete sequence Length = 304204 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 176090 tgcatttgcatttgcatttg 176071
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 1997787 tgcatttgcatttgcatttg 1997806
>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome Length = 4369232 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 382 ccggcatcgccagcgcggcg 401 |||||||||||||||||||| Sbjct: 3009575 ccggcatcgccagcgcggcg 3009556
>gb|AC115031.11| Mus musculus chromosome 3, clone RP24-257J5, complete sequence Length = 170460 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 ttcaatggagaaacttttacaact 53 ||||||||| |||||||||||||| Sbjct: 151426 ttcaatggaaaaacttttacaact 151403
>emb|AL009146.1|DMC17A9 Drosophila melanogaster cosmid 17A9 Length = 39582 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 tgcatttgcatttgcatttg 141 |||||||||||||||||||| Sbjct: 14352 tgcatttgcatttgcatttg 14333
>dbj|AB071804.1| Oryza sativa (japonica cultivar-group) mRNA for transcription factor PCF3, partial cds Length = 1649 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 catttgcatttgcatttgca 143 |||||||||||||||||||| Sbjct: 1349 catttgcatttgcatttgca 1330 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,461,028 Number of Sequences: 3902068 Number of extensions: 3461028 Number of successful extensions: 74009 Number of sequences better than 10.0: 194 Number of HSP's better than 10.0 without gapping: 199 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 72663 Number of HSP's gapped (non-prelim): 1196 length of query: 407 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 385 effective length of database: 17,147,199,772 effective search space: 6601671912220 effective search space used: 6601671912220 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)