ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart24a06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY854249.1| Human T-lymphotropic virus 1 LTR, partial sequenc... 72 6e-11
2gb|AY563954.1| Human T-lymphotropic virus 1 strain BRRP438, comp... 72 6e-11
3gb|AY563953.1| Human T-lymphotropic virus 1, complete genome 72 6e-11
4gb|AY786219.1| Human T-lymphotropic virus 1 isolate ID3053 LTR, ... 72 6e-11
5gb|AY786218.1| Human T-lymphotropic virus 1 isolate ID3050 LTR, ... 72 6e-11
6gb|AY786217.1| Human T-lymphotropic virus 1 isolate ID3048 LTR, ... 72 6e-11
7gb|AY786216.1| Human T-lymphotropic virus 1 isolate ID3046 LTR, ... 72 6e-11
8gb|AY786215.1| Human T-lymphotropic virus 1 isolate CRM41 LTR, p... 72 6e-11
9gb|AY786214.1| Human T-lymphotropic virus 1 isolate CHI444 LTR, ... 72 6e-11
10gb|AY786213.1| Human T-lymphotropic virus 1 isolate CHI431 LTR, ... 72 6e-11
11gb|AY786211.1| Human T-lymphotropic virus 1 isolate CHI408 LTR, ... 72 6e-11
12gb|AY786210.1| Human T-lymphotropic virus 1 isolate CHI399 LTR, ... 72 6e-11
13gb|AY786209.1| Human T-lymphotropic virus 1 isolate CHI384 LTR, ... 72 6e-11
14gb|AY786208.1| Human T-lymphotropic virus 1 isolate BOL010 LTR, ... 72 6e-11
15gb|AY786207.1| Human T-lymphotropic virus 1 isolate BOL011 LTR, ... 72 6e-11
16gb|AY786206.1| Human T-lymphotropic virus 1 isolate ARG009 LTR, ... 72 6e-11
17gb|AY660719.1| Mammalian expression vector pBGSA, partial sequence 72 6e-11
18gb|AY611015.1| Human T-lymphotropic virus 1 isolate PE5ra 3' lon... 72 6e-11
19gb|AY611014.1| Human T-lymphotropic virus 1 isolate PE3pe 3' lon... 72 6e-11
20gb|AY611012.1| Human T-lymphotropic virus 1 isolate PE1ga 3' lon... 72 6e-11
21gb|AY611011.1| Human T-lymphotropic virus 1 isolate CH1va 3' lon... 72 6e-11
22gb|AY611010.1| Human T-lymphotropic virus 1 isolate PE4cu 3' lon... 72 6e-11
23gb|AY611009.1| Human T-lymphotropic virus 1 isolate HT1IC1ta 3' ... 72 6e-11
24gb|AY342304.1| Human T-lymphotropic virus 1 isolate PH907 3' LTR... 72 6e-11
25gb|AY342303.1| Human T-lymphotropic virus 1 isolate PH906 3' LTR... 72 6e-11
26gb|AY342302.1| Human T-lymphotropic virus 1 isolate 2B-Abdou 3' ... 72 6e-11
27gb|AY342301.1| Human T-lymphotropic virus 1 isolate 5B-Marietou ... 72 6e-11
28gb|AY342300.1| Human T-lymphotropic virus 1 isolate 6A-issa 3' L... 72 6e-11
29gb|AY613998.1| Cloning vector pSRalphahygroY, complete sequence 72 6e-11
30gb|AY613997.1| Cloning vector pSRalphaneoR, complete sequence 72 6e-11
31gb|AY613996.1| Cloning vector pSRalphapuroG, complete sequence 72 6e-11
32gb|AY613995.1| Cloning vector pSRalphablastC, complete sequence 72 6e-11
33gb|AY613994.1| Cloning vector pSRalphapuro, complete sequence 72 6e-11
34gb|AY613993.1| Cloning vector pSRalphablast, complete sequence 72 6e-11
35gb|AY613992.1| Cloning vector pSRalphaneo, complete sequence 72 6e-11
36gb|AY613991.1| Cloning vector pSRalphahygro, complete sequence 72 6e-11
37gb|DQ235699.1| Human T-lymphotropic virus 1 isolate BD89517 LTR,... 72 6e-11
38gb|DQ235698.1| Human T-lymphotropic virus 1 isolate BD89112 LTR,... 72 6e-11
39gb|AY496636.1| Simian T-lymphotropic virus 1 isolate 00CM-MT265 ... 72 6e-11
40gb|AY496635.1| Simian T-lymphotropic virus 1 isolate 02CM-3157 L... 72 6e-11
41gb|AY496634.1| Simian T-lymphotropic virus 1 isolate 01CM-2474 L... 72 6e-11
42gb|AY496633.1| Simian T-lymphotropic virus 1 isolate 01CM-1272 L... 72 6e-11
43gb|AY496632.1| Simian T-lymphotropic virus 1 isolate 01CM-1141 L... 72 6e-11
44gb|AY496631.1| Simian T-lymphotropic virus 1 isolate 01CM-1183 L... 72 6e-11
45gb|AY496630.1| Simian T-lymphotropic virus 1 isolate 01CM-1122 L... 72 6e-11
46gb|AY496629.1| Simian T-lymphotropic virus 1 isolate 01CM-1106 L... 72 6e-11
47gb|AY496627.1| Simian T-lymphotropic virus 1 isolate 01CM-1312 L... 72 6e-11
48gb|AY496626.1| Simian T-lymphotropic virus 1 isolate 01CM-1038 L... 72 6e-11
49gb|AF228988.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
50gb|AF228987.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
51gb|AF228986.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
52gb|AF228985.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
53gb|AF228984.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
54gb|AF228983.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
55gb|AF228982.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
56gb|AF228981.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
57gb|AF228980.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
58gb|AF228979.1| Human T-cell lymphotropic virus type 1 isolate AT... 72 6e-11
59gb|AF228966.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
60gb|AF228965.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
61gb|AF228964.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
62gb|AF228963.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
63gb|AF228962.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
64gb|AF228961.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
65gb|AF228960.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
66gb|AF228959.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
67gb|AF228958.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
68gb|AF228957.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
69gb|AF228956.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
70gb|AF228955.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
71gb|AF228954.1| Human T-cell lymphotropic virus type 1 isolate As... 72 6e-11
72gb|AF228953.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
73gb|AF228952.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
74gb|AF228951.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
75gb|AF228949.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
76gb|AF228948.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
77gb|AF228947.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
78gb|AF228946.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
79gb|AF228945.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
80gb|AF228944.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
81gb|AF228943.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
82gb|AF228942.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
83gb|AF228940.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
84gb|AF228939.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
85gb|AF228938.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
86gb|AF228937.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
87gb|AF228936.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
88gb|AF228935.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
89gb|AF228934.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
90gb|AF228933.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
91gb|AF228932.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
92gb|AF228931.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
93gb|AF228930.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
94gb|AF228929.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
95gb|AF228928.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
96gb|AF228927.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
97gb|AF228926.1| Human T-cell lymphotropic virus type 1 isolate TS... 72 6e-11
98gb|AY333376.1| Simian T-lymphotropic virus 1 isolate STLV-wrc14/... 72 6e-11
99gb|AY267836.1| Simian T-lymphotropic virus 1 isolate Ptr-Rafiki-... 72 6e-11
100gb|AY267835.1| Simian T-lymphotropic virus 1 isolate Ptr-Loukoum... 72 6e-11
101gb|AF539747.1| Simian T-lymphotropic virus 1 isolate Ptr-Leo tax... 72 6e-11
102gb|AY324788.1| Human T-lymphotropic virus 1 isolate Br4 tax prot... 72 6e-11
103gb|AY324787.1| Human T-lymphotropic virus 1 isolate Pe491 tax pr... 72 6e-11
104gb|AY324786.1| Human T-lymphotropic virus 1 isolate Pe488 tax pr... 72 6e-11
105gb|AY324785.1| Human T-lymphotropic virus 1 isolate FrGu1 tax pr... 72 6e-11
106gb|AY324783.1| Human T-lymphotropic virus 1 isolate Ar5 tax prot... 72 6e-11
107gb|AY324782.1| Human T-lymphotropic virus 1 isolate Ar55 tax pro... 72 6e-11
108gb|AY324781.1| Human T-lymphotropic virus 1 isolate Ar49 tax pro... 72 6e-11
109gb|AY324780.1| Human T-lymphotropic virus 1 isolate Ar47 tax pro... 72 6e-11
110gb|AY324779.1| Human T-lymphotropic virus 1 isolate Ar44 tax pro... 72 6e-11
111gb|AY324778.1| Human T-lymphotropic virus 1 isolate Ar15 tax pro... 72 6e-11
112gb|AY324777.1| Human T-lymphotropic virus 1 isolate Ar11 tax pro... 72 6e-11
113gb|AF033817.1| Human T-cell lymphotropic virus 1, complete genome 72 6e-11
114gb|AF494241.1| Human T-cell lymphotropic virus 1 isolate ES-TMD ... 72 6e-11
115gb|AF494240.1| Human T-cell lymphotropic virus 1 isolate ES-TRR2... 72 6e-11
116gb|AF494239.1| Human T-cell lymphotropic virus 1 isolate ES-TRR1... 72 6e-11
117gb|AF494238.1| Human T-cell lymphotropic virus 1 isolate ES-TRH ... 72 6e-11
118gb|AY263382.1| Simian T-lymphotropic virus 1 isolate GGO-Cam12 t... 72 6e-11
119gb|AY263381.1| Simian T-lymphotropic virus 1 isolate PTR-CAM43 t... 72 6e-11
120gb|AY183908.1| Human T-lymphotropic virus 1 isolate ES02-JCP lon... 72 6e-11
121gb|AY183907.1| Human T-lymphotropic virus 1 isolate ES02-ECM lon... 72 6e-11
122gb|AF529963.1| Human T-lymphotropic virus 1 isolate GT895 tax pr... 72 6e-11
123gb|AF529962.1| Human T-lymphotropic virus 1 isolate GT551 tax pr... 72 6e-11
124gb|AF529961.1| Human T-lymphotropic virus 1 isolate GP35 tax pro... 72 6e-11
125gb|AF529960.1| Human T-lymphotropic virus 1 isolate GP299 tax pr... 72 6e-11
126gb|AF529959.1| Human T-lymphotropic virus 1 isolate GP27 tax pro... 72 6e-11
127gb|AF529958.1| Human T-lymphotropic virus 1 isolate GP219 tax pr... 72 6e-11
128gb|AF529957.1| Human T-lymphotropic virus 1 isolate GP2 tax prot... 72 6e-11
129gb|AF529956.1| Human T-lymphotropic virus 1 isolate GM778 tax pr... 72 6e-11
130gb|AF529955.1| Human T-lymphotropic virus 1 isolate GM599 tax pr... 72 6e-11
131emb|BX061706.1|CNS09JRY Single read from an extremity of a full-... 72 6e-11
132gb|DQ182415.1| Human T-lymphotropic virus 1 isolate ArJ54-2 LTR,... 72 6e-11
133gb|DQ182414.1| Human T-lymphotropic virus 1 isolate ArCBA-noju L... 72 6e-11
134gb|DQ182413.1| Human T-lymphotropic virus 1 isolate ArJ22-2 LTR,... 72 6e-11
135gb|DQ182412.1| Human T-lymphotropic virus 1 isolate ArJ22-1 LTR,... 72 6e-11
136gb|DQ182411.1| Human T-lymphotropic virus 1 isolate ArJ44-1 LTR,... 72 6e-11
137gb|DQ182410.1| Human T-lymphotropic virus 1 isolate ArJ20-1 LTR,... 72 6e-11
138gb|DQ182409.1| Human T-lymphotropic virus 1 isolate ArJ29-1 LTR,... 72 6e-11
139gb|DQ182408.1| Human T-lymphotropic virus 1 isolate ArJ1-4 LTR, ... 72 6e-11
140gb|DQ182407.1| Human T-lymphotropic virus 1 isolate ArJ33-7 LTR,... 72 6e-11
141gb|DQ182406.1| Human T-lymphotropic virus 1 isolate ArJ6-1 LTR, ... 72 6e-11
142gb|DQ182405.1| Human T-lymphotropic virus 1 isolate ArJ20-2 LTR,... 72 6e-11
143gb|DQ182404.1| Human T-lymphotropic virus 1 isolate ArJ19-3 LTR,... 72 6e-11
144gb|DQ182403.1| Human T-lymphotropic virus 1 isolate ArJ4-1 LTR, ... 72 6e-11
145gb|DQ182402.1| Human T-lymphotropic virus 1 isolate ArJ55-2 LTR,... 72 6e-11
146gb|DQ182401.1| Human T-lymphotropic virus 1 isolate ArJ48-1 LTR,... 72 6e-11
147gb|DQ182400.1| Human T-lymphotropic virus 1 isolate ArJ42-1 LTR,... 72 6e-11
148gb|DQ182399.1| Human T-lymphotropic virus 1 isolate ArJ40-2 LTR,... 72 6e-11
149gb|DQ182398.1| Human T-lymphotropic virus 1 isolate ArJ54-3 LTR,... 72 6e-11
150gb|DQ182397.1| Human T-lymphotropic virus 1 isolate ArJ34-1 LTR,... 72 6e-11
151gb|DQ182396.1| Human T-lymphotropic virus 1 isolate ArJ29-3 LTR,... 72 6e-11
152gb|DQ182395.1| Human T-lymphotropic virus 1 isolate ArJ30-2 LTR,... 72 6e-11
153gb|DQ182394.1| Human T-lymphotropic virus 1 isolate ArJ30-1 LTR,... 72 6e-11
154gb|DQ182393.1| Human T-lymphotropic virus 1 isolate ArJ35-2 LTR,... 72 6e-11
155gb|DQ182392.1| Human T-lymphotropic virus 1 isolate ArJ65-2 LTR,... 72 6e-11
156gb|DQ182391.1| Human T-lymphotropic virus 1 isolate ArJ47-2 LTR,... 72 6e-11
157gb|DQ182390.1| Human T-lymphotropic virus 1 isolate ArJ47-1 LTR,... 72 6e-11
158gb|DQ182389.1| Human T-lymphotropic virus 1 isolate ArJ19-1 LTR,... 72 6e-11
159gb|DQ182388.1| Human T-lymphotropic virus 1 isolate ArJ11-3 LTR,... 72 6e-11
160gb|DQ182387.1| Human T-lymphotropic virus 1 isolate ArJ11-4 LTR,... 72 6e-11
161gb|DQ182386.1| Human T-lymphotropic virus 1 isolate ArJ11-2 LTR,... 72 6e-11
162gb|DQ182385.1| Human T-lymphotropic virus 1 isolate ArJ15-1 LTR,... 72 6e-11
163gb|DQ182384.1| Human T-lymphotropic virus 1 isolate ArJ14-2 LTR,... 72 6e-11
164gb|DQ182383.1| Human T-lymphotropic virus 1 isolate ArJ14-1 LTR,... 72 6e-11
165gb|DQ182382.1| Human T-lymphotropic virus 1 isolate ArJ16-3 LTR,... 72 6e-11
166gb|DQ182381.1| Human T-lymphotropic virus 1 isolate ArJ16-1 LTR,... 72 6e-11
167gb|DQ182380.1| Human T-lymphotropic virus 1 isolate ArJ28-3 LTR,... 72 6e-11
168gb|DQ182379.1| Human T-lymphotropic virus 1 isolate ArJ1-2 LTR, ... 72 6e-11
169gb|DQ182378.1| Human T-lymphotropic virus 1 isolate ArJ1-1 LTR, ... 72 6e-11
170gb|DQ182377.1| Human T-lymphotropic virus 1 isolate ArJ32-1 LTR,... 72 6e-11
171gb|DQ182376.1| Human T-lymphotropic virus 1 isolate ArJ3-4 LTR, ... 72 6e-11
172gb|DQ182375.1| Human T-lymphotropic virus 1 isolate ArJ3-3 LTR, ... 72 6e-11
173gb|DQ182374.1| Human T-lymphotropic virus 1 isolate ArJ3-1 LTR, ... 72 6e-11
174gb|DQ182373.1| Human T-lymphotropic virus 1 isolate ArCBA-sego L... 72 6e-11
175gb|DQ182372.1| Human T-lymphotropic virus 1 isolate ArJ25-2 LTR,... 72 6e-11
176gb|DQ182371.1| Human T-lymphotropic virus 1 isolate ArJ25-1 LTR,... 72 6e-11
177gb|DQ182370.1| Human T-lymphotropic virus 1 isolate ArJ54-1 LTR,... 72 6e-11
178gb|DQ182369.1| Human T-lymphotropic virus 1 isolate ArJ11-5 LTR,... 72 6e-11
179gb|DQ182368.1| Human T-lymphotropic virus 1 isolate ArJ11-1 LTR,... 72 6e-11
180gb|DQ182367.1| Human T-lymphotropic virus 1 isolate ArJ65-1 LTR,... 72 6e-11
181gb|DQ182366.1| Human T-lymphotropic virus 1 isolate ArJ1-3 LTR, ... 72 6e-11
182gb|DQ182365.1| Human T-lymphotropic virus 1 isolate ArJ35-3 LTR,... 72 6e-11
183gb|DQ182364.1| Human T-lymphotropic virus 1 isolate ArJ2-2 LTR, ... 72 6e-11
184gb|DQ182363.1| Human T-lymphotropic virus 1 isolate ArJ2-1 LTR, ... 72 6e-11
185gb|DQ182362.1| Human T-lymphotropic virus 1 isolate ArJ29-2 LTR,... 72 6e-11
186gb|DQ182361.1| Human T-lymphotropic virus 1 isolate ArJ13-1 LTR,... 72 6e-11
187gb|DQ182360.1| Human T-lymphotropic virus 1 isolate ArJ3-2 LTR, ... 72 6e-11
188gb|DQ182356.1| Human T-lymphotropic virus 1 isolate ArJ43-2 LTR,... 72 6e-11
189gb|DQ182355.1| Human T-lymphotropic virus 1 isolate ArJ43-1 LTR,... 72 6e-11
190gb|AY040796.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
191gb|AY040795.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
192gb|AY040794.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
193gb|AY040793.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
194gb|AY040792.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
195gb|AY040791.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
196gb|AY040790.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
197gb|AY040789.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
198gb|AY040788.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
199gb|AY040787.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
200gb|AY040786.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
201dbj|D82951.1|HIVSIB220F Human T-lymphotropic virus 1 genomic RNA... 72 6e-11
202dbj|D82950.1|HIVSIB190E Human T-lymphotropic virus 1 genomic RNA... 72 6e-11
203dbj|D82949.1|HIVCOL443D Human T-lymphotropic virus 1 genomic RNA... 72 6e-11
204dbj|D82947.1|HIVCOL013B Human T-lymphotropic virus 1 genomic RNA... 72 6e-11
205dbj|D82946.1|HIVCOL001A Human T-lymphotropic virus 1 genomic RNA... 72 6e-11
206dbj|AB219938.1| Human T-lymphotropic virus 1 HBZ-SI mRNA for bZI... 72 6e-11
207gb|AF384872.1| Simian T-cell lymphotropic virus type 1 isolate C... 72 6e-11
208gb|AF384871.1| Simian T-cell lymphotropic virus type 1 isolate P... 72 6e-11
209gb|AY269836.1| Human T-lymphotropic virus 1 isolate 9HU-Col long... 72 6e-11
210gb|AY269835.1| Human T-lymphotropic virus 1 isolate 5HU-Col long... 72 6e-11
211gb|AY269834.1| Human T-lymphotropic virus 1 isolate 3HU-Col long... 72 6e-11
212gb|AY269832.1| Human T-lymphotropic virus 1 isolate 2189-Col lon... 72 6e-11
213gb|AY269831.1| Human T-lymphotropic virus 1 isolate 962-Col long... 72 6e-11
214gb|AY269829.1| Human T-lymphotropic virus 1 isolate 233-Col long... 72 6e-11
215gb|AY269828.1| Human T-lymphotropic virus 1 isolate 220-Col long... 72 6e-11
216gb|AY269827.1| Human T-lymphotropic virus 1 isolate 108-Col long... 72 6e-11
217dbj|AB036354.1| Human T-lymphotropic virus 1 DNA, LTR region, is... 72 6e-11
218dbj|AB036353.1| Human T-lymphotropic virus 1 DNA, LTR region, is... 72 6e-11
219dbj|AB036351.1| Human T-lymphotropic virus 1 DNA, LTR region, is... 72 6e-11
220dbj|AB036349.1| Human T-lymphotropic virus 1 DNA, LTR region, is... 72 6e-11
221dbj|AB036348.1| Human T-lymphotropic virus 1 DNA, LTR region, is... 72 6e-11
222dbj|AB030745.1| Human T-lymphotropic virus 1 proviral LTR sequen... 72 6e-11
223dbj|AB030744.1| Human T-lymphotropic virus 1 proviral LTR sequen... 72 6e-11
224dbj|AB030743.1| Human T-lymphotropic virus 1 proviral LTR sequen... 72 6e-11
225gb|AF438766.1| Human T-cell lymphotropic virus type 1 seroconver... 72 6e-11
226gb|AF438765.1| Human T-cell lymphotropic virus type 1 seroconver... 72 6e-11
227gb|AF485383.1| Human T-cell lymphotropic virus type 1 from Spain... 72 6e-11
228gb|AF485382.1| Human T-cell lymphotropic virus type 1 from Spain... 72 6e-11
229gb|AY920503.1| Human T-lymphotropic virus 1 strain Bel10564 5' L... 72 6e-11
230gb|AY920498.1| Human T-lymphotropic virus 1 strain Bel10420 5' L... 72 6e-11
231gb|L60024.1|STLLTRB Simian T-cell lymphotropic virus 1 (isolate ... 72 6e-11
232gb|J02030.1|HTVPRO1 Integrated human T-cell lymphotropic virus t... 72 6e-11
233gb|AY026855.1| Simian T-cell lymphotropic virus type 1 CTO-601 t... 72 6e-11
234gb|AY026854.1| Simian T-cell lymphotropic virus type 1 CNI-1001 ... 72 6e-11
235gb|AY026853.1| Simian T-cell lymphotropic virus type 1 CMO-1401 ... 72 6e-11
236gb|AY026852.1| Simian T-cell lymphotropic virus type 1 CAE-1301 ... 72 6e-11
237gb|AY026848.1| Simian T-cell lymphotropic virus type 1 CAE-AGM03... 72 6e-11
238gb|AY026847.1| Simian T-cell lymphotropic virus type 1 CAE-AGM51... 72 6e-11
239gb|AY026846.1| Simian T-cell lymphotropic virus type 1 CAE-AGM53... 72 6e-11
240gb|AY026845.1| Simian T-cell lymphotropic virus type 1 CMI-MIT t... 72 6e-11
241gb|AY026844.1| Simian T-cell lymphotropic virus type 1 PAN-614 t... 72 6e-11
242gb|AY026843.1| Simian T-cell lymphotropic virus type 1 PAN-622 t... 72 6e-11
243gb|AY026842.1| Simian T-cell lymphotropic virus type 1 PAN-623 t... 72 6e-11
244gb|AF222019.1|AF222019 Human T-cell lymphotropic virus type 1 U8... 72 6e-11
245gb|S81555.1| HTLV-I R-IL-15 fusion gene {junction region} [human... 72 6e-11
246gb|S74562.1| gag=Gag...pol [human T-lymphotropic virus type 1 HT... 72 6e-11
247gb|AY349146.1| Human T-lymphotropic virus 1 isolate ARGF4 LTR, p... 72 6e-11
248gb|AY349145.1| Human T-lymphotropic virus 1 isolate ARGF3 LTR, p... 72 6e-11
249gb|AY349144.1| Human T-lymphotropic virus 1 isolate ARGF2 LTR, p... 72 6e-11
250gb|AY349143.1| Human T-lymphotropic virus 1 isolate ARGF1 LTR, p... 72 6e-11
251gb|AF230485.1|AF230485 Simian T-cell lymphotropic virus type 1 c... 72 6e-11
252gb|AF117292.1|AF117292 Simian T-cell lymphotropic virus type 1 s... 72 6e-11
253gb|AF117291.1|AF117291 Simian T-cell lymphotropic virus type 1 s... 72 6e-11
254gb|AF117285.1|AF117285 Simian T-cell lymphotropic virus type 1 s... 72 6e-11
255gb|AF117284.1|AF117284 Simian T-cell lymphotropic virus type 1 s... 72 6e-11
256gb|AF117283.1|AF117283 Simian T-cell lymphotropic virus type 1 s... 72 6e-11
257gb|AF117282.1|AF117282 Simian T-cell lymphotropic virus type 1 s... 72 6e-11
258gb|AF097528.1|AF097528 Human T-cell lymphotropic virus type 1 st... 72 6e-11
259gb|AF097527.1|AF097527 Human T-cell lymphotropic virus type 1 st... 72 6e-11
260gb|AF097526.1|AF097526 Human T-cell lymphotropic virus type 1 st... 72 6e-11
261gb|AF097525.1|AF097525 Human T-cell lymphotropic virus type 1 st... 72 6e-11
262gb|AF097524.1|AF097524 Human T-cell lymphotropic virus type 1 st... 72 6e-11
263gb|AY035392.1| Human T-cell lymphotropic virus type 1 tax protei... 72 6e-11
264gb|AY607582.1| Human T-lymphotropic virus 1 isolate AP15 LTR, pa... 72 6e-11
265gb|AY607581.1| Human T-lymphotropic virus 1 isolate IN2 LTR, par... 72 6e-11
266gb|AY607580.1| Human T-lymphotropic virus 1 isolate IN3 LTR, par... 72 6e-11
267gb|AY607579.1| Human T-lymphotropic virus 1 isolate IND001 LTR, ... 72 6e-11
268gb|AY607578.1| Human T-lymphotropic virus 1 isolate IND002 LTR, ... 72 6e-11
269gb|AY607577.1| Human T-lymphotropic virus 1 isolate Ma1 LTR, par... 72 6e-11
270gb|AY607576.1| Human T-lymphotropic virus 1 isolate TNA LTR, par... 72 6e-11
271gb|DQ028628.1| Human T-lymphotropic virus 1 isolate BRPA3 LTR, p... 72 6e-11
272gb|DQ028627.1| Human T-lymphotropic virus 1 isolate BRPA2 LTR, p... 72 6e-11
273gb|DQ028626.1| Human T-lymphotropic virus 1 isolate BRPA10 LTR, ... 72 6e-11
274gb|DQ028625.1| Human T-lymphotropic virus 1 isolate BRPA8 LTR, p... 72 6e-11
275gb|DQ028624.1| Human T-lymphotropic virus 1 isolate BRPA13 LTR, ... 72 6e-11
276gb|DQ028623.1| Human T-lymphotropic virus 1 isolate BRPA12 LTR, ... 72 6e-11
277gb|DQ028622.1| Human T-lymphotropic virus 1 isolate BRPA11 LTR, ... 72 6e-11
278gb|DQ028621.1| Human T-lymphotropic virus 1 isolate BRPA9 LTR, p... 72 6e-11
279gb|DQ028620.1| Human T-lymphotropic virus 1 isolate BRPA4 LTR, p... 72 6e-11
280gb|DQ028619.1| Human T-lymphotropic virus 1 isolate BRPA7 LTR, p... 72 6e-11
281gb|DQ028618.1| Human T-lymphotropic virus 1 isolate BRPA6 LTR, p... 72 6e-11
282gb|DQ028617.1| Human T-lymphotropic virus 1 isolate BRPA5 LTR, p... 72 6e-11
283gb|AY818431.1| Human T-lymphotropic virus 1 strain 2656ND LTR, p... 72 6e-11
284gb|AY818430.1| Human T-lymphotropic virus 1 strain 2472LE LTR, p... 72 6e-11
285gb|AY818428.1| Human T-lymphotropic virus 1 strain 1537MV LTR, p... 72 6e-11
286gb|AY818427.1| Human T-lymphotropic virus 1 strain 1503MV LTR, p... 72 6e-11
287gb|AY818426.1| Human T-lymphotropic virus 1 strain 1443MV LTR, p... 72 6e-11
288gb|AY818425.1| Human T-lymphotropic virus 1 strain 1380MV LTR, p... 72 6e-11
289gb|AY818423.1| Human T-lymphotropic virus 1 strain 979MO LTR, pa... 72 6e-11
290gb|DQ005573.1| Human T-lymphotropic virus 1 isolate HTLV436 LTR,... 72 6e-11
291gb|DQ005572.1| Human T-lymphotropic virus 1 isolate HTLV200 LTR,... 72 6e-11
292gb|DQ005570.1| Human T-lymphotropic virus 1 isolate HTLV63 LTR, ... 72 6e-11
293gb|DQ005569.1| Human T-lymphotropic virus 1 isolate HTLV60 LTR, ... 72 6e-11
294gb|DQ005568.1| Human T-lymphotropic virus 1 isolate HTLV33 LTR, ... 72 6e-11
295gb|DQ005567.1| Human T-lymphotropic virus 1 isolate HTLV30 LTR, ... 72 6e-11
296gb|DQ005566.1| Human T-lymphotropic virus 1 isolate HTLV25 LTR, ... 72 6e-11
297gb|DQ005565.1| Human T-lymphotropic virus 1 isolate HTLV24 LTR, ... 72 6e-11
298gb|DQ005564.1| Human T-lymphotropic virus 1 isolate HTLV20 LTR, ... 72 6e-11
299gb|DQ005563.1| Human T-lymphotropic virus 1 isolate HTLV18 LTR, ... 72 6e-11
300gb|DQ005562.1| Human T-lymphotropic virus 1 isolate HTLV15 LTR, ... 72 6e-11
301gb|DQ005561.1| Human T-lymphotropic virus 1 isolate HTLV9 LTR, c... 72 6e-11
302gb|DQ005560.1| Human T-lymphotropic virus 1 isolate HTLV8 LTR, c... 72 6e-11
303gb|DQ005559.1| Human T-lymphotropic virus 1 isolate HTLV07 LTR, ... 72 6e-11
304gb|DQ005558.1| Human T-lymphotropic virus 1 isolate HTLV06 LTR, ... 72 6e-11
305gb|DQ005557.1| Human T-lymphotropic virus 1 isolate HTLV04 LTR, ... 72 6e-11
306gb|DQ005556.1| Human T-lymphotropic virus 1 isolate HTLV01 LTR, ... 72 6e-11
307gb|DQ005555.1| Human T-lymphotropic virus 1 isolate IDUSSA LTR, ... 72 6e-11
308gb|DQ005554.1| Human T-lymphotropic virus 1 isolate FNN159 LTR, ... 72 6e-11
309gb|DQ005553.1| Human T-lymphotropic virus 1 isolate FNN158 LTR, ... 72 6e-11
310gb|DQ005552.1| Human T-lymphotropic virus 1 isolate FNN156 LTR, ... 72 6e-11
311gb|DQ005551.1| Human T-lymphotropic virus 1 isolate FNN155 LTR, ... 72 6e-11
312gb|DQ005550.1| Human T-lymphotropic virus 1 isolate FNN153 LTR, ... 72 6e-11
313gb|DQ005549.1| Human T-lymphotropic virus 1 isolate FNN149 LTR, ... 72 6e-11
314gb|DQ005548.1| Human T-lymphotropic virus 1 isolate FNN148 LTR, ... 72 6e-11
315gb|DQ005547.1| Human T-lymphotropic virus 1 isolate FNN100 LTR, ... 72 6e-11
316gb|AF121869.1|AF121869 Human T-cell lymphotropic virus type 1 is... 72 6e-11
317gb|AF121868.1|AF121868 Human T-cell lymphotropic virus type 1 is... 72 6e-11
318gb|AF121867.1|AF121867 Human T-cell lymphotropic virus type 1 is... 72 6e-11
319gb|AF121866.1|AF121866 Human T-cell lymphotropic virus type 1 is... 72 6e-11
320dbj|AB009864.2| Expression vector pME18S-FL3-3 DNA, complete seq... 72 6e-11
321dbj|AB211220.1| Human T-lymphotropic virus 1 proviral DNA, LTR, ... 72 6e-11
322dbj|AB211218.1| Human T-lymphotropic virus 1 proviral DNA, LTR, ... 72 6e-11
323dbj|AB211217.1| Human T-lymphotropic virus 1 proviral DNA, LTR, ... 72 6e-11
324dbj|AB211216.1| Human T-lymphotropic virus 1 proviral DNA, LTR, ... 72 6e-11
325dbj|AB211215.1| Human T-lymphotropic virus 1 proviral DNA, LTR, ... 72 6e-11
326dbj|AB211214.1| Human T-lymphotropic virus 1 proviral DNA, LTR, ... 72 6e-11
327gb|AF285183.1|AF285183 Cloning vector pSGHV0, complete sequence 72 6e-11
328gb|AF286077.1|AF286077 Expression vector AF286077, complete sequ... 72 6e-11
329gb|AF074966.1| Simian T-cell lymphotropic virus type 1 isolate T... 72 6e-11
330gb|AF274482.1|AF274482 Human T-cell lymphotropic virus type 1 is... 72 6e-11
331gb|AF274481.1|AF274481 Human T-cell lymphotropic virus type 1 is... 72 6e-11
332gb|AF259264.1|AF259264 Human T-cell lymphotropic virus type 1 is... 72 6e-11
333dbj|AB114416.1| Homo sapiens mRNA, HTLV-1-PCDH9 fusion transcrip... 72 6e-11
334dbj|AB114415.1| Homo sapiens mRNA, HTLV-1-NGLY1 fusion transcrip... 72 6e-11
335dbj|AB114414.1| Homo sapiens mRNA, HTLV-1-NGLY1 fusion transcrip... 72 6e-11
336emb|Z31662.1|HTLVLTR4 Human T-cell lymphotropic virus type I (MW... 72 6e-11
337emb|Z31661.1|HTLVLTR3 Human T-cell lymphotropic virus type I (MT... 72 6e-11
338emb|Z31660.1|HTLVLTR2 Human T-cell lymphotropic virus type I (MT... 72 6e-11
339emb|Z31659.1|HTLVLTR1 Human T-cell lymphotropic virus type I (MO... 72 6e-11
340emb|X88876.1|HTLVILTRM Human T-lymphotropic virus long terminal ... 72 6e-11
341emb|X88875.1|HTLVILTRJ Human T-lymphotropic virus long terminal ... 72 6e-11
342emb|X88874.1|HTLVILTRH Human T-lymphotropic virus long terminal ... 72 6e-11
343emb|X88873.1|HTLVILTRF Human T-lymphotropic virus long terminal ... 72 6e-11
344emb|X88872.1|HTLVILTRC Human T-lymphotropic virus long terminal ... 72 6e-11
345emb|X88871.1|HTLVILTRA Human T-lymphotropic virus long terminal ... 72 6e-11
346emb|Z32527.1|HTLVLTRD Human T-cell lymphotropic virus type I DNA... 72 6e-11
347emb|Y16485.1|HTY16485 Human T-cell lymphotropic virus type I LTR... 72 6e-11
348emb|Y16484.1|HTY16484 Human T-cell lymphotropic virus type I LTR... 72 6e-11
349emb|Y16483.1|HTY16483 Human T-cell lymphotropic virus type I LTR... 72 6e-11
350emb|Y16482.2|HTY16482 Human T-cell lymphotropic virus type I LTR... 72 6e-11
351emb|Y16481.1|HTY16481 Human T-cell lymphotropic virus type I LTR... 72 6e-11
352emb|Y16480.1|HTY16480 Human T-cell lymphotropic virus type I LTR... 72 6e-11
353emb|Y16479.2|HTY16479 Human T-cell lymphotropic virus type I LTR... 72 6e-11
354emb|Y16478.1|HTY16478 Human T-cell lymphotropic virus type I LTR... 72 6e-11
355emb|Y16477.1|HTY16477 Human T-cell lymphotropic virus type I LTR... 72 6e-11
356emb|Y16476.1|HTY16476 Human T-cell lymphotropic virus type I LTR... 72 6e-11
357emb|Y16475.1|HTY16475 Human T-cell lymphotropic virus type I LTR... 72 6e-11
358emb|Y17019.1|HTY17019 Human T-cell lymphotropic virus type 1 DNA... 72 6e-11
359emb|Y17018.1|HTY17018 Human T-cell lymphotropic virus type 1 DNA... 72 6e-11
360emb|Y17017.1|HTY17017 Human T-cell lymphotropic virus type 1 DNA... 72 6e-11
361emb|Y17016.1|HTY17016 Human T-cell lymphotropic virus type 1 DNA... 72 6e-11
362emb|Y17015.1|HTY17015 Human T-cell lymphotropic virus type 1 DNA... 72 6e-11
363emb|Y13347.1|STLVILTR Simian T-cell lymphotropic virus type I pr... 72 6e-11
364gb|U48258.1|HSU48258 Human/HTLV-1 interleukin-9 receptor chimeri... 72 6e-11
365gb|U48257.1|HSU48257 Human/HTLV-1 interleukin-9 receptor chimeri... 72 6e-11
366gb|U48256.1|HSU48256 Human interleukin-9 receptor gene, 5'UTR 72 6e-11
367dbj|AK026847.1| Homo sapiens cDNA: FLJ23194 fis, clone REC00490 72 6e-11
368gb|AF063821.1|AF063821 Human T-cell lymphotropic virus type 1 NM... 72 6e-11
369gb|AF063820.1|AF063820 Human T-cell lymphotropic virus type 1 Na... 72 6e-11
370gb|L03562.2|HL1RHK34X Human T cell lymphotrophic virus type I (H... 72 6e-11
371gb|L03561.2|HL1RHK30X Human T Cell Lymphotropic Virus I complete... 72 6e-11
372gb|DQ273132.1| Human T-lymphotropic virus 1 bZIP factor (HBZ) mR... 72 6e-11
373gb|AF013219.1|AF013219 Human T-cell lymphotropic virus type 1 st... 72 6e-11
374gb|AF013218.1|AF013218 Human T-cell lymphotropic virus type 1 st... 72 6e-11
375gb|AF013217.1|AF013217 Human T-cell lymphotropic virus type 1 st... 72 6e-11
376gb|J02029.1|HL1PROP Human T-cell lymphotropic virus type I (prov... 72 6e-11
377gb|AY739064.1| Human T-lymphotropic virus 1 isolate PtAd LTR, pa... 72 6e-11
378gb|AY739063.1| Human T-lymphotropic virus 1 isolate PtDj LTR, pa... 72 6e-11
379gb|AY739062.1| Human T-lymphotropic virus 1 isolate PtOs LTR, pa... 72 6e-11
380gb|AY739061.1| Human T-lymphotropic virus 1 isolate PtLc LTR, pa... 72 6e-11
381gb|AY739060.1| Human T-lymphotropic virus 1 isolate PtFd LTR, pa... 72 6e-11
382gb|AY739059.1| Human T-lymphotropic virus 1 isolate PtOf LTR, pa... 72 6e-11
383gb|AY739058.1| Human T-lymphotropic virus 1 isolate PtEm LTR, pa... 72 6e-11
384gb|AY739057.1| Human T-lymphotropic virus 1 isolate PtMm LTR, pa... 72 6e-11
385gb|AY739056.1| Human T-lymphotropic virus 1 isolate PtPd LTR, pa... 72 6e-11
386gb|AY739055.1| Human T-lymphotropic virus 1 isolate PtIs LTR, pa... 72 6e-11
387gb|AY739054.1| Human T-lymphotropic virus 1 isolate PtDk1 LTR, p... 72 6e-11
388gb|AY739053.1| Human T-lymphotropic virus 1 isolate PtJq LTR, pa... 72 6e-11
389gb|AY739052.1| Human T-lymphotropic virus 1 isolate PtGr LTR, pa... 72 6e-11
390gb|AY739051.1| Human T-lymphotropic virus 1 isolate PtDk2 LTR, p... 72 6e-11
391gb|AF014670.1|AF014670 Human T-cell lymphotropic virus type 1 is... 72 6e-11
392gb|AF014669.1|AF014669 Human T-cell lymphotropic virus type 1 is... 72 6e-11
393gb|AF014668.1|AF014668 Human T-cell lymphotropic virus type 1 is... 72 6e-11
394gb|AF014666.1|AF014666 Human T-cell lymphotropic virus type 1 is... 72 6e-11
395gb|AF014665.1|AF014665 Human T-cell lymphotropic virus type 1 is... 72 6e-11
396gb|AF014664.1|AF014664 Human T-cell lymphotropic virus type 1 is... 72 6e-11
397gb|AF014663.1|AF014663 Human T-cell lymphotropic virus type 1 is... 72 6e-11
398gb|AF014662.1|AF014662 Human T-cell lymphotropic virus type 1 is... 72 6e-11
399gb|AF014661.1|AF014661 Human T-cell lymphotropic virus type 1 is... 72 6e-11
400gb|AF014659.1|AF014659 Human T-cell lymphotropic virus type 1 is... 72 6e-11
401gb|AF014651.1|AF014651 Human T-cell lymphotropic virus type 1 is... 72 6e-11
402gb|AF014650.1|AF014650 Human T-cell lymphotropic virus type 1 is... 72 6e-11
403gb|AF014649.1|AF014649 Human T-cell lymphotropic virus type 1 is... 72 6e-11
404gb|AF014648.1|AF014648 Human T-cell lymphotropic virus type 1 is... 72 6e-11
405gb|AF014646.1|AF014646 Human T-cell lymphotropic virus type 1 is... 72 6e-11
406gb|AF014645.1|AF014645 Human T-cell lymphotropic virus type 1 is... 72 6e-11
407gb|AF014644.1|AF014644 Human T-cell lymphotropic virus type 1 is... 72 6e-11
408gb|AF014658.1|AF014658 Human T-cell lymphotropic virus type 1 is... 72 6e-11
409gb|AF014657.1|AF014657 Human T-cell lymphotropic virus type 1 is... 72 6e-11
410gb|AF014656.1|AF014656 Human T-cell lymphotropic virus type 1 is... 72 6e-11
411gb|AF014654.1|AF014654 Human T-cell lymphotropic virus type 1 is... 72 6e-11
412gb|AF124043.1|AF124043 Human T-cell lymphotropic virus type 1 is... 72 6e-11
413gb|AF139170.1|AF139170 Human T-cell lymphotropic virus type 1, c... 72 6e-11
414gb|AF013221.1|AF013221 Human T-cell lymphotropic virus type I st... 72 6e-11
415gb|U50458.1|HTU50458 Human T-cell lymphotropic virus type I isol... 72 6e-11
416gb|U50457.1|HTU50457 Human T-cell lymphotropic virus type I isol... 72 6e-11
417gb|U50456.1|HTU50456 Human T-cell lymphotropic virus type I isol... 72 6e-11
418gb|U50454.1|HTU50454 Human T-cell lymphotropic virus type I isol... 72 6e-11
419gb|AY876043.1| Simian T-lymphotropic virus 1 isolate STLVsm_93_T... 72 6e-11
420gb|AY876042.1| Simian T-lymphotropic virus 1 isolate STLVsm_93_T... 72 6e-11
421gb|AY876040.1| Simian T-lymphotropic virus 1 isolate STLVsm_93_T... 72 6e-11
422gb|AY876039.1| Simian T-lymphotropic virus 1 isolate STLVsm_93_T... 72 6e-11
423gb|AY876038.1| Simian T-lymphotropic virus 1 isolate STLVsm_93_T... 72 6e-11
424gb|AY876037.1| Simian T-lymphotropic virus 1 isolate STLVsm_93_S... 72 6e-11
425gb|AY876036.1| Simian T-lymphotropic virus 1 isolate STLVsm_93_S... 72 6e-11
426gb|AF045932.1|AF045932 Simian T cell lymphotropic virus type 1 m... 72 6e-11
427gb|AY499187.1| Human T-lymphotropic virus 1 isolate JPNBr177 5' ... 72 6e-11
428gb|AY499186.1| Human T-lymphotropic virus 1 isolate JPNBr81 5' L... 72 6e-11
429gb|AY499185.1| Human T-lymphotropic virus 1 isolate JPNBr41 5' L... 72 6e-11
430gb|AF035541.1| Simian T cell lymphotropic virus type 1 strain 53... 72 6e-11
431gb|AF035540.1| Simian T cell lymphotropic virus type 1 strain 52... 72 6e-11
432gb|AF035538.1| Simian T cell lymphotropic virus type 1 strain 54... 72 6e-11
433dbj|D38403.1|HTVL003V Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
434dbj|D38402.1|HTVL118U Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
435dbj|D38401.1|HTVL302T Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
436dbj|D38394.1|HTVL004M Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
437dbj|D38391.1|HTVL113J Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
438dbj|D38390.1|HTVL005I Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
439dbj|D38389.1|HTVL113H Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
440dbj|D38388.1|HTVL005G Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
441dbj|D38386.1|HTVL003E Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
442dbj|D38385.1|HTVL002D Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
443dbj|D38382.1|HTVL001A Human T-lymphotropic virus 1 gene, clone:p... 72 6e-11
444dbj|D38399.1|HTVMW2R Human T-lymphotropic virus 1 gene, clone:MW2#2 72 6e-11
445dbj|D38398.1|HTVMW2Q Human T-lymphotropic virus 1 gene, clone:MW2#1 72 6e-11
446dbj|D14828.1|HUMTHP2 Homo sapiens THP2 mRNA for Tax helper prote... 72 6e-11
447dbj|D14827.1|HUMTHP1 Homo sapiens THP1 mRNA for Tax helper prote... 72 6e-11
448dbj|D23692.1|HTVGB233C Human T-lymphotropic virus 1 proviral DNA... 72 6e-11
449dbj|D23694.1|HTVAINUE Human T-lymphotropic virus 1 proviral DNA,... 72 6e-11
450dbj|D23693.1|HTVGH78D Human T-lymphotropic virus 1 proviral DNA,... 72 6e-11
451dbj|D23690.1|HTVCH26A Human T-lymphotropic virus 1 proviral DNA,... 72 6e-11
452gb|U86376.1|STU86376 Simian T-cell lymphotropic virus type 1 pro... 72 6e-11
453gb|U88723.1|HTU88723 Human T-cell lymphotropic virus type I stra... 72 6e-11
454gb|U88722.1|HTU88722 Human T-cell lymphotropic virus type I stra... 72 6e-11
455gb|U88721.1|HTU88721 Human T-cell lymphotropic virus type I stra... 72 6e-11
456gb|U88720.1|HTU88720 Human T-cell lymphotropic virus type I stra... 72 6e-11
457gb|U88718.1|HTU88718 Human T-cell lymphotropic virus type I stra... 72 6e-11
458gb|AF003012.1|AF003012 Human T-cell lymphotropic virus type 1 re... 72 6e-11
459gb|AF003010.1|AF003010 Human T-cell lymphotropic virus type 1 re... 72 6e-11
460gb|U25140.1|HTU25140 Human T-cell lymphotropic virus type I, iso... 72 6e-11
461gb|U25139.1|HTU25139 Human T-cell lymphotropic virus type I, iso... 72 6e-11
462gb|U25063.1|HTU25063 Human T-cell lymphotropic virus type I, iso... 72 6e-11
463gb|U25062.1|HTU25062 Human T-cell lymphotropic virus type I, iso... 72 6e-11
464gb|L42253.1|HL1LTRB Human T-cell lymphotropic virus type 1 (isol... 72 6e-11
465gb|L42225.1|HL1LTRAA Human T-cell lymphotropic virus type 1 (iso... 72 6e-11
466gb|L42255.1|HL1LTRA Human T-cell lymphotropic virus type 1 (isol... 72 6e-11
467gb|L75787.1|STLFRH Simian T-cell lymphotropic virus type I RNA f... 72 6e-11
468gb|AF054627.1|AF054627 Human T-cell lymphotropic virus type 1 RK... 72 6e-11
469gb|AF007755.1|AF007755 Human T-cell lymphotropic virus type 1 is... 72 6e-11
470gb|AF007754.1|AF007754 Human T-cell lymphotropic virus type 1 is... 72 6e-11
471gb|AF007753.1|AF007753 Human T-cell lymphotropic virus type 1 is... 72 6e-11
472gb|AF007752.1|AF007752 Human T-cell lymphotropic virus type 1 is... 72 6e-11
473gb|AF061849.1|AF061849 Simian T-cell lymphotropic virus type 1 i... 72 6e-11
474gb|AF061848.1|AF061848 Simian T-cell lymphotropic virus type 1 i... 72 6e-11
475gb|AF061440.1|AF061440 Simian T-cell lymphotropic virus type 1 i... 72 6e-11
476gb|AF061439.1|AF061439 Simian T-cell lymphotropic virus type 1 i... 72 6e-11
477gb|AF061437.1|AF061437 Simian T-cell lymphotropic virus type 1 i... 72 6e-11
478gb|M81248.1|HL1LV1A Human T-cell lymphotropic virus type I DNA s... 72 6e-11
479gb|AF012730.1|AF012730 Simian T-cell lymphotropic virus type 1 s... 72 6e-11
480gb|AF012729.1|AF012729 Simian T-cell lymphotropic virus type 1 s... 72 6e-11
481gb|AF012728.1|AF012728 Simian T-cell lymphotropic virus type 1 s... 72 6e-11
482gb|AF032470.1|AF032470 Human T-cell lymphotropic virus type 1 LT... 72 6e-11
483gb|U87263.1|HTU87263 Human T-cell lymphotropic virus type 1 stra... 72 6e-11
484gb|U87262.1|HTU87262 Human T-cell lymphotropic virus type 1 stra... 72 6e-11
485gb|U87261.1|HTU87261 Human T-cell lymphotropic virus type 1 stra... 72 6e-11
486gb|U87260.1|HTU87260 Human T-cell lymphotropic virus type 1 stra... 72 6e-11
487gb|L76305.1|HL1T49A Human T-cell lymphotropic virus type 1 isola... 72 6e-11
488gb|L76306.1|HL1STDA Human T-cell lymphotropic virus type 1 isola... 72 6e-11
489gb|L76307.1|HL1PH236A Human T-cell lymphotropic virus type 1 iso... 72 6e-11
490gb|L76308.1|HL1H24A Human T-cell lymphotropic virus type 1 isola... 72 6e-11
491gb|L77212.1|HL1LTRAB Human T-lymphotropic virus 1 (clone afs911)... 72 6e-11
492gb|S76263.1|S76263 {LTR region} [human T-cell leukemia virus typ... 72 6e-11
493gb|U53080.1|HTU53080 Human T-cell lymphotropic virus type 1 isol... 72 6e-11
494gb|U53079.1|HTU53079 Human T-cell lymphotropic virus type 1 isol... 72 6e-11
495gb|U53078.1|HTU53078 Human T-cell lymphotropic virus type 1 isol... 72 6e-11
496gb|U53077.1|HTU53077 Human T-cell lymphotropic virus type 1 isol... 72 6e-11
497gb|U53076.1|HTU53076 Human T-cell lymphotropic virus type 1 isol... 72 6e-11
498gb|U53075.1|HTU53075 Human T-cell lymphotropic virus type 1 isol... 72 6e-11
499gb|U53074.1|HTU53074 Human T-cell lymphotropic virus type 1 isol... 72 6e-11
500gb|U53073.1|HTU53073 Human T-cell lymphotropic virus type 1 isol... 72 6e-11 
>gb|AY854249.1| Human T-lymphotropic virus 1 LTR, partial sequence; and gag protein
           gene, partial cds
          Length = 879

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 384 gaggccgccatccacgccggttgagtcgcgttctgc 419
to top
>gb|AY563954.1| Human T-lymphotropic virus 1 strain BRRP438, complete genome
          Length = 8883

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 8554 gaggccgccatccacgccggttgagtcgcgttctgc 8589



 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 275 gaggccgccatccacgccggttgagtcgcgttctgc 310
to top
>gb|AY563953.1| Human T-lymphotropic virus 1, complete genome
          Length = 8383

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 379 gaggccgccatccacgccggttgagtcgcgttctgc 414
to top
>gb|AY786219.1| Human T-lymphotropic virus 1 isolate ID3053 LTR, partial sequence
          Length = 506

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 270 gaggccgccatccacgccggttgagtcgcgttctgc 305
to top
>gb|AY786218.1| Human T-lymphotropic virus 1 isolate ID3050 LTR, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786217.1| Human T-lymphotropic virus 1 isolate ID3048 LTR, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786216.1| Human T-lymphotropic virus 1 isolate ID3046 LTR, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786215.1| Human T-lymphotropic virus 1 isolate CRM41 LTR, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786214.1| Human T-lymphotropic virus 1 isolate CHI444 LTR, partial sequence
          Length = 508

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786213.1| Human T-lymphotropic virus 1 isolate CHI431 LTR, partial sequence
          Length = 508

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 272 gaggccgccatccacgccggttgagtcgcgttctgc 307
to top
>gb|AY786211.1| Human T-lymphotropic virus 1 isolate CHI408 LTR, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786210.1| Human T-lymphotropic virus 1 isolate CHI399 LTR, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786209.1| Human T-lymphotropic virus 1 isolate CHI384 LTR, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786208.1| Human T-lymphotropic virus 1 isolate BOL010 LTR, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786207.1| Human T-lymphotropic virus 1 isolate BOL011 LTR, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>gb|AY786206.1| Human T-lymphotropic virus 1 isolate ARG009 LTR, partial sequence
          Length = 508

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 272 gaggccgccatccacgccggttgagtcgcgttctgc 307
to top
>gb|AY660719.1| Mammalian expression vector pBGSA, partial sequence
          Length = 1412

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 418 gaggccgccatccacgccggttgagtcgcgttctgc 453
to top
>gb|AY611015.1| Human T-lymphotropic virus 1 isolate PE5ra 3' long terminal repeat,
           partial sequence
          Length = 484

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 289 gaggccgccatccacgccggttgagtcgcgttctgc 324
to top
>gb|AY611014.1| Human T-lymphotropic virus 1 isolate PE3pe 3' long terminal repeat,
           partial sequence
          Length = 484

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 289 gaggccgccatccacgccggttgagtcgcgttctgc 324
to top
>gb|AY611012.1| Human T-lymphotropic virus 1 isolate PE1ga 3' long terminal repeat,
           partial sequence
          Length = 484

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 289 gaggccgccatccacgccggttgagtcgcgttctgc 324
to top
>gb|AY611011.1| Human T-lymphotropic virus 1 isolate CH1va 3' long terminal repeat,
           partial sequence
          Length = 484

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 290 gaggccgccatccacgccggttgagtcgcgttctgc 325
to top
>gb|AY611010.1| Human T-lymphotropic virus 1 isolate PE4cu 3' long terminal repeat,
           partial sequence
          Length = 485

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 290 gaggccgccatccacgccggttgagtcgcgttctgc 325
to top
>gb|AY611009.1| Human T-lymphotropic virus 1 isolate HT1IC1ta 3' long terminal
           repeat, partial sequence
          Length = 485

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 290 gaggccgccatccacgccggttgagtcgcgttctgc 325
to top
>gb|AY342304.1| Human T-lymphotropic virus 1 isolate PH907 3' LTR, partial sequence
          Length = 758

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 393 gaggccgccatccacgccggttgagtcgcgttctgc 428
to top
>gb|AY342303.1| Human T-lymphotropic virus 1 isolate PH906 3' LTR, partial sequence
          Length = 758

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 393 gaggccgccatccacgccggttgagtcgcgttctgc 428
to top
>gb|AY342302.1| Human T-lymphotropic virus 1 isolate 2B-Abdou 3' LTR, partial
           sequence
          Length = 758

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 393 gaggccgccatccacgccggttgagtcgcgttctgc 428
to top
>gb|AY342301.1| Human T-lymphotropic virus 1 isolate 5B-Marietou 3' LTR, partial
           sequence
          Length = 758

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 393 gaggccgccatccacgccggttgagtcgcgttctgc 428
to top
>gb|AY342300.1| Human T-lymphotropic virus 1 isolate 6A-issa 3' LTR, partial
           sequence
          Length = 758

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 393 gaggccgccatccacgccggttgagtcgcgttctgc 428
to top
>gb|AY613998.1| Cloning vector pSRalphahygroY, complete sequence
          Length = 6588

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 6345 gaggccgccatccacgccggttgagtcgcgttctgc 6380
to top
>gb|AY613997.1| Cloning vector pSRalphaneoR, complete sequence
          Length = 6423

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 6180 gaggccgccatccacgccggttgagtcgcgttctgc 6215
to top
>gb|AY613996.1| Cloning vector pSRalphapuroG, complete sequence
          Length = 5936

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 5693 gaggccgccatccacgccggttgagtcgcgttctgc 5728
to top
>gb|AY613995.1| Cloning vector pSRalphablastC, complete sequence
          Length = 5800

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 5557 gaggccgccatccacgccggttgagtcgcgttctgc 5592
to top
>gb|AY613994.1| Cloning vector pSRalphapuro, complete sequence
          Length = 4040

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 3797 gaggccgccatccacgccggttgagtcgcgttctgc 3832
to top
>gb|AY613993.1| Cloning vector pSRalphablast, complete sequence
          Length = 3875

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 3632 gaggccgccatccacgccggttgagtcgcgttctgc 3667
to top
>gb|AY613992.1| Cloning vector pSRalphaneo, complete sequence
          Length = 4542

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 4299 gaggccgccatccacgccggttgagtcgcgttctgc 4334
to top
>gb|AY613991.1| Cloning vector pSRalphahygro, complete sequence
          Length = 4663

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 4420 gaggccgccatccacgccggttgagtcgcgttctgc 4455
to top
>gb|DQ235699.1| Human T-lymphotropic virus 1 isolate BD89517 LTR, complete
           sequence; and tax protein gene, partial cds
          Length = 758

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 393 gaggccgccatccacgccggttgagtcgcgttctgc 428
to top
>gb|DQ235698.1| Human T-lymphotropic virus 1 isolate BD89112 LTR, complete
           sequence; and tax protein gene, partial cds
          Length = 758

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 393 gaggccgccatccacgccggttgagtcgcgttctgc 428
to top
>gb|AY496636.1| Simian T-lymphotropic virus 1 isolate 00CM-MT265 LTR, partial
           sequence
          Length = 650

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 382 gaggccgccatccacgccggttgagtcgcgttctgc 417
to top
>gb|AY496635.1| Simian T-lymphotropic virus 1 isolate 02CM-3157 LTR, partial
           sequence
          Length = 648

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 381 gaggccgccatccacgccggttgagtcgcgttctgc 416
to top
>gb|AY496634.1| Simian T-lymphotropic virus 1 isolate 01CM-2474 LTR, partial
           sequence
          Length = 649

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 382 gaggccgccatccacgccggttgagtcgcgttctgc 417
to top
>gb|AY496633.1| Simian T-lymphotropic virus 1 isolate 01CM-1272 LTR, partial
           sequence
          Length = 648

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 381 gaggccgccatccacgccggttgagtcgcgttctgc 416
to top
>gb|AY496632.1| Simian T-lymphotropic virus 1 isolate 01CM-1141 LTR, partial
           sequence
          Length = 648

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 381 gaggccgccatccacgccggttgagtcgcgttctgc 416
to top
>gb|AY496631.1| Simian T-lymphotropic virus 1 isolate 01CM-1183 LTR, partial
           sequence
          Length = 648

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 381 gaggccgccatccacgccggttgagtcgcgttctgc 416
to top
>gb|AY496630.1| Simian T-lymphotropic virus 1 isolate 01CM-1122 LTR, partial
           sequence
          Length = 648

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 381 gaggccgccatccacgccggttgagtcgcgttctgc 416
to top
>gb|AY496629.1| Simian T-lymphotropic virus 1 isolate 01CM-1106 LTR, partial
           sequence
          Length = 648

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 381 gaggccgccatccacgccggttgagtcgcgttctgc 416
to top
>gb|AY496627.1| Simian T-lymphotropic virus 1 isolate 01CM-1312 LTR, partial
           sequence
          Length = 648

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 381 gaggccgccatccacgccggttgagtcgcgttctgc 416
to top
>gb|AY496626.1| Simian T-lymphotropic virus 1 isolate 01CM-1038 LTR, partial
           sequence
          Length = 648

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 381 gaggccgccatccacgccggttgagtcgcgttctgc 416
to top
>gb|AF228988.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 555

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228987.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 555

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 35 gaggccgccatccacgccggttgagtcgcgttctgc 70
to top
>gb|AF228986.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 556

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228985.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 655

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228984.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 656

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228983.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 414

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228982.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 413

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228981.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 415

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228980.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 415

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228979.1| Human T-cell lymphotropic virus type 1 isolate ATLL long terminal
          repeat, partial sequence
          Length = 563

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228966.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 640

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228965.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 527

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228964.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 454

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228963.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 454

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228962.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 441

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228961.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 441

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228960.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 441

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228959.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 421

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228958.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 675

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228957.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 469

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228956.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 469

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228955.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 469

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228954.1| Human T-cell lymphotropic virus type 1 isolate Asymptomatic
          carrier long terminal repeat, partial sequence
          Length = 413

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228953.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 542

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228952.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 542

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228951.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228949.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228948.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 659

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228947.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 659

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228946.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 659

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228945.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 539

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228944.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 471

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228943.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 407

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228942.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 407

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228940.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 407

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228939.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 762

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228938.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 409

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228937.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 461

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228936.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 461

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228935.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 577

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228934.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 577

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228933.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 617

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228932.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 459

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228931.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 459

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228930.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 459

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228929.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 461

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228928.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 460

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228927.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 461

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AF228926.1| Human T-cell lymphotropic virus type 1 isolate TSP/HAM long
          terminal repeat, partial sequence
          Length = 461

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 36 gaggccgccatccacgccggttgagtcgcgttctgc 71
to top
>gb|AY333376.1| Simian T-lymphotropic virus 1 isolate STLV-wrc14/97 3' LTR, partial
           sequence; and tax protein gene, partial cds
          Length = 547

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 376 gaggccgccatccacgccggttgagtcgcgttctgc 411
to top
>gb|AY267836.1| Simian T-lymphotropic virus 1 isolate Ptr-Rafiki-I tax protein
           (tax) gene, partial cds; and 3' long terminal repeat,
           partial sequence
          Length = 470

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 432 gaggccgccatccacgccggttgagtcgcgttctgc 467
to top
>gb|AY267835.1| Simian T-lymphotropic virus 1 isolate Ptr-Loukoum tax protein (tax)
           gene, partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 929

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 728 gaggccgccatccacgccggttgagtcgcgttctgc 763
to top
>gb|AF539747.1| Simian T-lymphotropic virus 1 isolate Ptr-Leo tax protein gene,
            partial cds; and long terminal repeat, partial sequence
          Length = 1630

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 1314 gaggccgccatccacgccggttgagtcgcgttctgc 1349
to top
>gb|AY324788.1| Human T-lymphotropic virus 1 isolate Br4 tax protein gene, partial
           cds; and 3' long terminal repeat, complete sequence
          Length = 748

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 384 gaggccgccatccacgccggttgagtcgcgttctgc 419
to top
>gb|AY324787.1| Human T-lymphotropic virus 1 isolate Pe491 tax protein gene,
           partial cds; and 3' long terminal repeat, complete
           sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY324786.1| Human T-lymphotropic virus 1 isolate Pe488 tax protein gene,
           partial cds; and 3' long terminal repeat, complete
           sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY324785.1| Human T-lymphotropic virus 1 isolate FrGu1 tax protein gene,
           partial cds; and 3' long terminal repeat, complete
           sequence
          Length = 757

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 393 gaggccgccatccacgccggttgagtcgcgttctgc 428
to top
>gb|AY324783.1| Human T-lymphotropic virus 1 isolate Ar5 tax protein gene, partial
           cds; and 3' long terminal repeat, complete sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY324782.1| Human T-lymphotropic virus 1 isolate Ar55 tax protein gene, partial
           cds; and 3' long terminal repeat, complete sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY324781.1| Human T-lymphotropic virus 1 isolate Ar49 tax protein gene, partial
           cds; and 3' long terminal repeat, complete sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY324780.1| Human T-lymphotropic virus 1 isolate Ar47 tax protein gene, partial
           cds; and 3' long terminal repeat, complete sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY324779.1| Human T-lymphotropic virus 1 isolate Ar44 tax protein gene, partial
           cds; and 3' long terminal repeat, complete sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY324778.1| Human T-lymphotropic virus 1 isolate Ar15 tax protein gene, partial
           cds; and 3' long terminal repeat, complete sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY324777.1| Human T-lymphotropic virus 1 isolate Ar11 tax protein gene, partial
           cds; and 3' long terminal repeat, complete sequence
          Length = 753

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AF033817.1| Human T-cell lymphotropic virus 1, complete genome
          Length = 8507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                                
Query: 1    gaggccgccatccacgccggttgagtcgcgttctgc 36
            ||||||||||||||||||||||||||||||||||||
Sbjct: 8318 gaggccgccatccacgccggttgagtcgcgttctgc 8353



 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 39 gaggccgccatccacgccggttgagtcgcgttctgc 74
to top
>gb|AF494241.1| Human T-cell lymphotropic virus 1 isolate ES-TMD tax protein (tax)
           gene, partial cds; and long terminal repeat, partial
           sequence
          Length = 740

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 375 gaggccgccatccacgccggttgagtcgcgttctgc 410
to top
>gb|AF494240.1| Human T-cell lymphotropic virus 1 isolate ES-TRR2 tax protein (tax)
           gene, partial cds; and long terminal repeat, partial
           sequence
          Length = 740

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 375 gaggccgccatccacgccggttgagtcgcgttctgc 410
to top
>gb|AF494239.1| Human T-cell lymphotropic virus 1 isolate ES-TRR1 tax protein (tax)
           gene, partial cds; and long terminal repeat, partial
           sequence
          Length = 740

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 375 gaggccgccatccacgccggttgagtcgcgttctgc 410
to top
>gb|AF494238.1| Human T-cell lymphotropic virus 1 isolate ES-TRH tax protein (tax)
           gene, partial cds; and long terminal repeat, partial
           sequence
          Length = 740

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 375 gaggccgccatccacgccggttgagtcgcgttctgc 410
to top
>gb|AY263382.1| Simian T-lymphotropic virus 1 isolate GGO-Cam12 tax protein gene,
           partial cds; and long terminal repeat, complete sequence
          Length = 757

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 393 gaggccgccatccacgccggttgagtcgcgttctgc 428
to top
>gb|AY263381.1| Simian T-lymphotropic virus 1 isolate PTR-CAM43 tax protein gene,
           partial cds; and long terminal repeat, complete sequence
          Length = 757

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY183908.1| Human T-lymphotropic virus 1 isolate ES02-JCP long terminal repeat,
           partial sequence
          Length = 563

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 304 gaggccgccatccacgccggttgagtcgcgttctgc 339
to top
>gb|AY183907.1| Human T-lymphotropic virus 1 isolate ES02-ECM long terminal repeat,
           partial sequence
          Length = 536

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 284 gaggccgccatccacgccggttgagtcgcgttctgc 319
to top
>gb|AF529963.1| Human T-lymphotropic virus 1 isolate GT895 tax protein gene,
           partial cds; and long terminal repeat, partial sequence
          Length = 749

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 384 gaggccgccatccacgccggttgagtcgcgttctgc 419
to top
>gb|AF529962.1| Human T-lymphotropic virus 1 isolate GT551 tax protein gene,
           partial cds; and long terminal repeat, partial sequence
          Length = 730

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 365 gaggccgccatccacgccggttgagtcgcgttctgc 400
to top
>gb|AF529961.1| Human T-lymphotropic virus 1 isolate GP35 tax protein gene, partial
           cds; and long terminal repeat, partial sequence
          Length = 750

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 385 gaggccgccatccacgccggttgagtcgcgttctgc 420
to top
>gb|AF529960.1| Human T-lymphotropic virus 1 isolate GP299 tax protein gene,
           partial cds; and long terminal repeat, partial sequence
          Length = 750

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 385 gaggccgccatccacgccggttgagtcgcgttctgc 420
to top
>gb|AF529959.1| Human T-lymphotropic virus 1 isolate GP27 tax protein gene, partial
           cds; and long terminal repeat, partial sequence
          Length = 740

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 375 gaggccgccatccacgccggttgagtcgcgttctgc 410
to top
>gb|AF529958.1| Human T-lymphotropic virus 1 isolate GP219 tax protein gene,
           partial cds; and long terminal repeat, partial sequence
          Length = 748

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 383 gaggccgccatccacgccggttgagtcgcgttctgc 418
to top
>gb|AF529957.1| Human T-lymphotropic virus 1 isolate GP2 tax protein gene, partial
           cds; and long terminal repeat, partial sequence
          Length = 740

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 375 gaggccgccatccacgccggttgagtcgcgttctgc 410
to top
>gb|AF529956.1| Human T-lymphotropic virus 1 isolate GM778 tax protein gene,
           partial cds; and long terminal repeat, partial sequence
          Length = 741

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 376 gaggccgccatccacgccggttgagtcgcgttctgc 411
to top
>gb|AF529955.1| Human T-lymphotropic virus 1 isolate GM599 tax protein gene,
           partial cds; and long terminal repeat, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 369 gaggccgccatccacgccggttgagtcgcgttctgc 404
to top
>emb|BX061706.1|CNS09JRY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 270

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Minus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 218
to top
>gb|DQ182415.1| Human T-lymphotropic virus 1 isolate ArJ54-2 LTR, partial sequence
          Length = 593

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 243 gaggccgccatccacgccggttgagtcgcgttctgc 278
to top
>gb|DQ182414.1| Human T-lymphotropic virus 1 isolate ArCBA-noju LTR, partial
           sequence
          Length = 642

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 292 gaggccgccatccacgccggttgagtcgcgttctgc 327
to top
>gb|DQ182413.1| Human T-lymphotropic virus 1 isolate ArJ22-2 LTR, partial sequence
          Length = 643

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 293 gaggccgccatccacgccggttgagtcgcgttctgc 328
to top
>gb|DQ182412.1| Human T-lymphotropic virus 1 isolate ArJ22-1 LTR, partial sequence
          Length = 593

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 257 gaggccgccatccacgccggttgagtcgcgttctgc 292
to top
>gb|DQ182411.1| Human T-lymphotropic virus 1 isolate ArJ44-1 LTR, partial sequence
          Length = 599

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 247 gaggccgccatccacgccggttgagtcgcgttctgc 282
to top
>gb|DQ182410.1| Human T-lymphotropic virus 1 isolate ArJ20-1 LTR, partial sequence
          Length = 627

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 288
to top
>gb|DQ182409.1| Human T-lymphotropic virus 1 isolate ArJ29-1 LTR, partial sequence
          Length = 582

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 246 gaggccgccatccacgccggttgagtcgcgttctgc 281
to top
>gb|DQ182408.1| Human T-lymphotropic virus 1 isolate ArJ1-4 LTR, partial sequence
          Length = 624

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 251 gaggccgccatccacgccggttgagtcgcgttctgc 286
to top
>gb|DQ182407.1| Human T-lymphotropic virus 1 isolate ArJ33-7 LTR, partial sequence
          Length = 664

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 292 gaggccgccatccacgccggttgagtcgcgttctgc 327
to top
>gb|DQ182406.1| Human T-lymphotropic virus 1 isolate ArJ6-1 LTR, partial sequence
          Length = 607

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 258 gaggccgccatccacgccggttgagtcgcgttctgc 293
to top
>gb|DQ182405.1| Human T-lymphotropic virus 1 isolate ArJ20-2 LTR, partial sequence
          Length = 631

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 266 gaggccgccatccacgccggttgagtcgcgttctgc 301
to top
>gb|DQ182404.1| Human T-lymphotropic virus 1 isolate ArJ19-3 LTR, partial sequence
          Length = 604

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 256 gaggccgccatccacgccggttgagtcgcgttctgc 291
to top
>gb|DQ182403.1| Human T-lymphotropic virus 1 isolate ArJ4-1 LTR, partial sequence
          Length = 603

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 255 gaggccgccatccacgccggttgagtcgcgttctgc 290
to top
>gb|DQ182402.1| Human T-lymphotropic virus 1 isolate ArJ55-2 LTR, partial sequence
          Length = 607

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 257 gaggccgccatccacgccggttgagtcgcgttctgc 292
to top
>gb|DQ182401.1| Human T-lymphotropic virus 1 isolate ArJ48-1 LTR, partial sequence
          Length = 602

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182400.1| Human T-lymphotropic virus 1 isolate ArJ42-1 LTR, partial sequence
          Length = 631

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 256 gaggccgccatccacgccggttgagtcgcgttctgc 291
to top
>gb|DQ182399.1| Human T-lymphotropic virus 1 isolate ArJ40-2 LTR, partial sequence
          Length = 622

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 255 gaggccgccatccacgccggttgagtcgcgttctgc 290
to top
>gb|DQ182398.1| Human T-lymphotropic virus 1 isolate ArJ54-3 LTR, partial sequence
          Length = 644

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 269 gaggccgccatccacgccggttgagtcgcgttctgc 304
to top
>gb|DQ182397.1| Human T-lymphotropic virus 1 isolate ArJ34-1 LTR, partial sequence
          Length = 608

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182396.1| Human T-lymphotropic virus 1 isolate ArJ29-3 LTR, partial sequence
          Length = 628

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 288
to top
>gb|DQ182395.1| Human T-lymphotropic virus 1 isolate ArJ30-2 LTR, partial sequence
          Length = 571

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 239 gaggccgccatccacgccggttgagtcgcgttctgc 274
to top
>gb|DQ182394.1| Human T-lymphotropic virus 1 isolate ArJ30-1 LTR, partial sequence
          Length = 602

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182393.1| Human T-lymphotropic virus 1 isolate ArJ35-2 LTR, partial sequence
          Length = 602

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182392.1| Human T-lymphotropic virus 1 isolate ArJ65-2 LTR, partial sequence
          Length = 630

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 258 gaggccgccatccacgccggttgagtcgcgttctgc 293
to top
>gb|DQ182391.1| Human T-lymphotropic virus 1 isolate ArJ47-2 LTR, partial sequence
          Length = 603

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 288
to top
>gb|DQ182390.1| Human T-lymphotropic virus 1 isolate ArJ47-1 LTR, partial sequence
          Length = 609

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 288
to top
>gb|DQ182389.1| Human T-lymphotropic virus 1 isolate ArJ19-1 LTR, partial sequence
          Length = 609

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 288
to top
>gb|DQ182388.1| Human T-lymphotropic virus 1 isolate ArJ11-3 LTR, partial sequence
          Length = 593

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182387.1| Human T-lymphotropic virus 1 isolate ArJ11-4 LTR, partial sequence
          Length = 619

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 256 gaggccgccatccacgccggttgagtcgcgttctgc 291
to top
>gb|DQ182386.1| Human T-lymphotropic virus 1 isolate ArJ11-2 LTR, partial sequence
          Length = 604

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182385.1| Human T-lymphotropic virus 1 isolate ArJ15-1 LTR, partial sequence
          Length = 601

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 288
to top
>gb|DQ182384.1| Human T-lymphotropic virus 1 isolate ArJ14-2 LTR, partial sequence
          Length = 588

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 254 gaggccgccatccacgccggttgagtcgcgttctgc 289
to top
>gb|DQ182383.1| Human T-lymphotropic virus 1 isolate ArJ14-1 LTR, partial sequence
          Length = 604

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 254 gaggccgccatccacgccggttgagtcgcgttctgc 289
to top
>gb|DQ182382.1| Human T-lymphotropic virus 1 isolate ArJ16-3 LTR, partial sequence
          Length = 595

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182381.1| Human T-lymphotropic virus 1 isolate ArJ16-1 LTR, partial sequence
          Length = 608

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182380.1| Human T-lymphotropic virus 1 isolate ArJ28-3 LTR, partial sequence
          Length = 593

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182379.1| Human T-lymphotropic virus 1 isolate ArJ1-2 LTR, partial sequence
          Length = 554

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 221 gaggccgccatccacgccggttgagtcgcgttctgc 256
to top
>gb|DQ182378.1| Human T-lymphotropic virus 1 isolate ArJ1-1 LTR, partial sequence
          Length = 628

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 255 gaggccgccatccacgccggttgagtcgcgttctgc 290
to top
>gb|DQ182377.1| Human T-lymphotropic virus 1 isolate ArJ32-1 LTR, partial sequence
          Length = 604

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 254 gaggccgccatccacgccggttgagtcgcgttctgc 289
to top
>gb|DQ182376.1| Human T-lymphotropic virus 1 isolate ArJ3-4 LTR, partial sequence
          Length = 582

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182375.1| Human T-lymphotropic virus 1 isolate ArJ3-3 LTR, partial sequence
          Length = 591

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 254 gaggccgccatccacgccggttgagtcgcgttctgc 289
to top
>gb|DQ182374.1| Human T-lymphotropic virus 1 isolate ArJ3-1 LTR, partial sequence
          Length = 606

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 256 gaggccgccatccacgccggttgagtcgcgttctgc 291
to top
>gb|DQ182373.1| Human T-lymphotropic virus 1 isolate ArCBA-sego LTR, partial
           sequence
          Length = 643

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 281 gaggccgccatccacgccggttgagtcgcgttctgc 316
to top
>gb|DQ182372.1| Human T-lymphotropic virus 1 isolate ArJ25-2 LTR, partial sequence
          Length = 604

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 288
to top
>gb|DQ182371.1| Human T-lymphotropic virus 1 isolate ArJ25-1 LTR, partial sequence
          Length = 631

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 279 gaggccgccatccacgccggttgagtcgcgttctgc 314
to top
>gb|DQ182370.1| Human T-lymphotropic virus 1 isolate ArJ54-1 LTR, partial sequence
          Length = 603

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 256 gaggccgccatccacgccggttgagtcgcgttctgc 291
to top
>gb|DQ182369.1| Human T-lymphotropic virus 1 isolate ArJ11-5 LTR, partial sequence
          Length = 618

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 266 gaggccgccatccacgccggttgagtcgcgttctgc 301
to top
>gb|DQ182368.1| Human T-lymphotropic virus 1 isolate ArJ11-1 LTR, partial sequence
          Length = 614

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 266 gaggccgccatccacgccggttgagtcgcgttctgc 301
to top
>gb|DQ182367.1| Human T-lymphotropic virus 1 isolate ArJ65-1 LTR, partial sequence
          Length = 643

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 292 gaggccgccatccacgccggttgagtcgcgttctgc 327
to top
>gb|DQ182366.1| Human T-lymphotropic virus 1 isolate ArJ1-3 LTR, partial sequence
          Length = 590

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 256 gaggccgccatccacgccggttgagtcgcgttctgc 291
to top
>gb|DQ182365.1| Human T-lymphotropic virus 1 isolate ArJ35-3 LTR, partial sequence
          Length = 589

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 288
to top
>gb|DQ182364.1| Human T-lymphotropic virus 1 isolate ArJ2-2 LTR, partial sequence
          Length = 616

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 266 gaggccgccatccacgccggttgagtcgcgttctgc 301
to top
>gb|DQ182363.1| Human T-lymphotropic virus 1 isolate ArJ2-1 LTR, partial sequence
          Length = 604

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 255 gaggccgccatccacgccggttgagtcgcgttctgc 290
to top
>gb|DQ182362.1| Human T-lymphotropic virus 1 isolate ArJ29-2 LTR, partial sequence
          Length = 602

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 252 gaggccgccatccacgccggttgagtcgcgttctgc 287
to top
>gb|DQ182361.1| Human T-lymphotropic virus 1 isolate ArJ13-1 LTR, partial sequence
          Length = 616

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gaggccgccatccacgccggttgagtcgcgttctgc 288
to top
>gb|DQ182360.1| Human T-lymphotropic virus 1 isolate ArJ3-2 LTR, partial sequence
          Length = 580

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 251 gaggccgccatccacgccggttgagtcgcgttctgc 286
to top
>gb|DQ182356.1| Human T-lymphotropic virus 1 isolate ArJ43-2 LTR, partial sequence
          Length = 654

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 284 gaggccgccatccacgccggttgagtcgcgttctgc 319
to top
>gb|DQ182355.1| Human T-lymphotropic virus 1 isolate ArJ43-1 LTR, partial sequence
          Length = 624

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 254 gaggccgccatccacgccggttgagtcgcgttctgc 289
to top
>gb|AY040796.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 693

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 361 gaggccgccatccacgccggttgagtcgcgttctgc 396
to top
>gb|AY040795.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 693

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 361 gaggccgccatccacgccggttgagtcgcgttctgc 396
to top
>gb|AY040794.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 693

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 361 gaggccgccatccacgccggttgagtcgcgttctgc 396
to top
>gb|AY040793.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 695

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 363 gaggccgccatccacgccggttgagtcgcgttctgc 398
to top
>gb|AY040792.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 694

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 362 gaggccgccatccacgccggttgagtcgcgttctgc 397
to top
>gb|AY040791.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 693

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 361 gaggccgccatccacgccggttgagtcgcgttctgc 396
to top
>gb|AY040790.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 693

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 361 gaggccgccatccacgccggttgagtcgcgttctgc 396
to top
>gb|AY040789.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 693

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 361 gaggccgccatccacgccggttgagtcgcgttctgc 396
to top
>gb|AY040788.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 693

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 361 gaggccgccatccacgccggttgagtcgcgttctgc 396
to top
>gb|AY040787.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 695

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 363 gaggccgccatccacgccggttgagtcgcgttctgc 398
to top
>gb|AY040786.1| Human T-cell lymphotropic virus type 1 tax protein (tax) gene,
           partial cds; and 3' long terminal repeat, partial
           sequence
          Length = 695

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 363 gaggccgccatccacgccggttgagtcgcgttctgc 398
to top
>dbj|D82951.1|HIVSIB220F Human T-lymphotropic virus 1 genomic RNA, LTR region, clone:SIB220
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>dbj|D82950.1|HIVSIB190E Human T-lymphotropic virus 1 genomic RNA, LTR region, clone:SIB190
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>dbj|D82949.1|HIVCOL443D Human T-lymphotropic virus 1 genomic RNA, LTR region, clone:COL443
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>dbj|D82947.1|HIVCOL013B Human T-lymphotropic virus 1 genomic RNA, LTR region, clone:COL013
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>dbj|D82946.1|HIVCOL001A Human T-lymphotropic virus 1 genomic RNA, LTR region, clone:COL001
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>dbj|AB219938.1| Human T-lymphotropic virus 1 HBZ-SI mRNA for bZIP factor splicing
           isoform, complete cds
          Length = 1088

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Minus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 197 gaggccgccatccacgccggttgagtcgcgttctgc 162
to top
>gb|AF384872.1| Simian T-cell lymphotropic virus type 1 isolate CAG-DJA.853 tax
           protein gene, partial sequence and long terminal repeat,
           complete sequence
          Length = 755

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AF384871.1| Simian T-cell lymphotropic virus type 1 isolate PTR-CAR.875 tax
           protein gene, partial sequence and long terminal repeat,
           complete sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY269836.1| Human T-lymphotropic virus 1 isolate 9HU-Col long terminal repeat,
           partial sequence
          Length = 624

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 257 gaggccgccatccacgccggttgagtcgcgttctgc 292
to top
>gb|AY269835.1| Human T-lymphotropic virus 1 isolate 5HU-Col long terminal repeat,
           partial sequence
          Length = 617

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 257 gaggccgccatccacgccggttgagtcgcgttctgc 292
to top
>gb|AY269834.1| Human T-lymphotropic virus 1 isolate 3HU-Col long terminal repeat,
           partial sequence
          Length = 616

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 256 gaggccgccatccacgccggttgagtcgcgttctgc 291
to top
>gb|AY269832.1| Human T-lymphotropic virus 1 isolate 2189-Col long terminal repeat,
           partial sequence
          Length = 616

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 256 gaggccgccatccacgccggttgagtcgcgttctgc 291
to top
>gb|AY269831.1| Human T-lymphotropic virus 1 isolate 962-Col long terminal repeat,
           partial sequence
          Length = 617

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 257 gaggccgccatccacgccggttgagtcgcgttctgc 292
to top
>gb|AY269829.1| Human T-lymphotropic virus 1 isolate 233-Col long terminal repeat,
           partial sequence
          Length = 624

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 257 gaggccgccatccacgccggttgagtcgcgttctgc 292
to top
>gb|AY269828.1| Human T-lymphotropic virus 1 isolate 220-Col long terminal repeat,
           partial sequence
          Length = 624

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 257 gaggccgccatccacgccggttgagtcgcgttctgc 292
to top
>gb|AY269827.1| Human T-lymphotropic virus 1 isolate 108-Col long terminal repeat,
           partial sequence
          Length = 624

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 257 gaggccgccatccacgccggttgagtcgcgttctgc 292
to top
>dbj|AB036354.1| Human T-lymphotropic virus 1 DNA, LTR region, isolate:HC7B
          Length = 603

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 274 gaggccgccatccacgccggttgagtcgcgttctgc 309
to top
>dbj|AB036353.1| Human T-lymphotropic virus 1 DNA, LTR region, isolate:HC5B
          Length = 593

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 265 gaggccgccatccacgccggttgagtcgcgttctgc 300
to top
>dbj|AB036351.1| Human T-lymphotropic virus 1 DNA, LTR region, isolate:HC66A
          Length = 601

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 273 gaggccgccatccacgccggttgagtcgcgttctgc 308
to top
>dbj|AB036349.1| Human T-lymphotropic virus 1 DNA, LTR region, isolate:HAM284A
          Length = 601

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 273 gaggccgccatccacgccggttgagtcgcgttctgc 308
to top
>dbj|AB036348.1| Human T-lymphotropic virus 1 DNA, LTR region, isolate:HC1020A
          Length = 601

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 273 gaggccgccatccacgccggttgagtcgcgttctgc 308
to top
>dbj|AB030745.1| Human T-lymphotropic virus 1 proviral LTR sequence, clone:CHI430
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>dbj|AB030744.1| Human T-lymphotropic virus 1 proviral LTR sequence, clone:CHI383
          Length = 507

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 271 gaggccgccatccacgccggttgagtcgcgttctgc 306
to top
>dbj|AB030743.1| Human T-lymphotropic virus 1 proviral LTR sequence, clone:KAG130
          Length = 506

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 270 gaggccgccatccacgccggttgagtcgcgttctgc 305
to top
>gb|AF438766.1| Human T-cell lymphotropic virus type 1 seroconverter case 3 long
           terminal repeat, partial sequence
          Length = 501

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 263 gaggccgccatccacgccggttgagtcgcgttctgc 298
to top
>gb|AF438765.1| Human T-cell lymphotropic virus type 1 seroconverter case 2 long
           terminal repeat, partial sequence
          Length = 501

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 263 gaggccgccatccacgccggttgagtcgcgttctgc 298
to top
>gb|AF485383.1| Human T-cell lymphotropic virus type 1 from Spain long terminal
           repeat, partial sequence
          Length = 598

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 272 gaggccgccatccacgccggttgagtcgcgttctgc 307
to top
>gb|AF485382.1| Human T-cell lymphotropic virus type 1 from Spain long terminal
           repeat, partial sequence
          Length = 608

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 274 gaggccgccatccacgccggttgagtcgcgttctgc 309
to top
>gb|AY920503.1| Human T-lymphotropic virus 1 strain Bel10564 5' LTR, partial
           sequence
          Length = 522

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 290 gaggccgccatccacgccggttgagtcgcgttctgc 325
to top
>gb|AY920498.1| Human T-lymphotropic virus 1 strain Bel10420 5' LTR, partial
           sequence
          Length = 522

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 290 gaggccgccatccacgccggttgagtcgcgttctgc 325
to top
>gb|L60024.1|STLLTRB Simian T-cell lymphotropic virus 1 (isolate Pcy2304) long terminal
           repeat
          Length = 705

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 363 gaggccgccatccacgccggttgagtcgcgttctgc 398
to top
>gb|J02030.1|HTVPRO1 Integrated human T-cell lymphotropic virus type I, proviral 5' LTR
          Length = 805

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 412 gaggccgccatccacgccggttgagtcgcgttctgc 447
to top
>gb|AY026855.1| Simian T-cell lymphotropic virus type 1 CTO-601 tax protein (tax)
           gene, partial cds; and long terminal repeat, complete
           sequence
          Length = 755

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY026854.1| Simian T-cell lymphotropic virus type 1 CNI-1001 tax protein (tax)
           gene, partial cds; and long terminal repeat, complete
           sequence
          Length = 755

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY026853.1| Simian T-cell lymphotropic virus type 1 CMO-1401 tax protein (tax)
           gene, partial cds; and long terminal repeat, complete
           sequence
          Length = 756

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY026852.1| Simian T-cell lymphotropic virus type 1 CAE-1301 tax protein (tax)
           gene, partial cds; and long terminal repeat, complete
           sequence
          Length = 755

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY026848.1| Simian T-cell lymphotropic virus type 1 CAE-AGM03 tax protein (tax)
           gene, partial cds; and long terminal repeat, complete
           sequence
          Length = 754

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 391 gaggccgccatccacgccggttgagtcgcgttctgc 426
to top
>gb|AY026847.1| Simian T-cell lymphotropic virus type 1 CAE-AGM511 tax protein
           (tax) gene, partial cds; and long terminal repeat,
           complete sequence
          Length = 754

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 391 gaggccgccatccacgccggttgagtcgcgttctgc 426
to top
>gb|AY026846.1| Simian T-cell lymphotropic virus type 1 CAE-AGM535 tax protein
           (tax) gene, partial cds; and long terminal repeat,
           complete sequence
          Length = 754

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 391 gaggccgccatccacgccggttgagtcgcgttctgc 426
to top
>gb|AY026845.1| Simian T-cell lymphotropic virus type 1 CMI-MIT tax protein (tax)
           gene, partial cds; and long terminal repeat, complete
           sequence
          Length = 747

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 384 gaggccgccatccacgccggttgagtcgcgttctgc 419
to top
>gb|AY026844.1| Simian T-cell lymphotropic virus type 1 PAN-614 tax protein (tax)
           gene, partial cds; and long terminal repeat, complete
           sequence
          Length = 759

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 396 gaggccgccatccacgccggttgagtcgcgttctgc 431
to top
>gb|AY026843.1| Simian T-cell lymphotropic virus type 1 PAN-622 tax protein (tax)
           gene, partial cds; and long terminal repeat, complete
           sequence
          Length = 757

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 394 gaggccgccatccacgccggttgagtcgcgttctgc 429
to top
>gb|AY026842.1| Simian T-cell lymphotropic virus type 1 PAN-623 tax protein (tax)
           gene, partial cds; and long terminal repeat, complete
           sequence
          Length = 759

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 395 gaggccgccatccacgccggttgagtcgcgttctgc 430
to top
>gb|AF222019.1|AF222019 Human T-cell lymphotropic virus type 1 U8306 5' long terminal
           repeat, partial sequence
          Length = 508

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 272 gaggccgccatccacgccggttgagtcgcgttctgc 307
to top
>gb|S81555.1| HTLV-I R-IL-15 fusion gene {junction region} [human, adult T-cell
          leukemia cell line HuT-102, mRNA Partial Mutant, 204
          nt]
          Length = 204

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                              
Query: 1  gaggccgccatccacgccggttgagtcgcgttctgc 36
          ||||||||||||||||||||||||||||||||||||
Sbjct: 22 gaggccgccatccacgccggttgagtcgcgttctgc 57
to top
>gb|S74562.1| gag=Gag...pol [human T-lymphotropic virus type 1 HTLV-1, Zairian
           isolate, HTLV-1EL, Genomic, 3 genes, 5186 nt]
          Length = 5186

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 392 gaggccgccatccacgccggttgagtcgcgttctgc 427
to top
>gb|AY349146.1| Human T-lymphotropic virus 1 isolate ARGF4 LTR, partial sequence
          Length = 496

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 175 gaggccgccatccacgccggttgagtcgcgttctgc 210
to top
>gb|AY349145.1| Human T-lymphotropic virus 1 isolate ARGF3 LTR, partial sequence
          Length = 496

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 175 gaggccgccatccacgccggttgagtcgcgttctgc 210
to top
>gb|AY349144.1| Human T-lymphotropic virus 1 isolate ARGF2 LTR, partial sequence
          Length = 496

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 175 gaggccgccatccacgccggttgagtcgcgttctgc 210
to top
>gb|AY349143.1| Human T-lymphotropic virus 1 isolate ARGF1 LTR, partial sequence
          Length = 496

 Score = 71.9 bits (36), Expect = 6e-11
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   gaggccgccatccacgccggttgagtcgcgttctgc 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 175 gaggccgccatccacgccggttgagtcgcgttctgc 210


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 82,532
Number of Sequences: 3902068
Number of extensions: 82532
Number of successful extensions: 23500
Number of sequences better than 10.0: 909
Number of HSP's better than 10.0 without gapping: 908
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 22430
Number of HSP's gapped (non-prelim): 1070
length of query: 36
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 16
effective length of database: 17,155,003,908
effective search space: 274480062528
effective search space used: 274480062528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top