Clone Name | rbart23h05 |
---|---|
Clone Library Name | barley_pub |
>gb|AY857762.1| Triticum monococcum peroxidase 8 (POX8) mRNA, complete cds Length = 1282 Score = 61.9 bits (31), Expect = 3e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 38 agtataggggcgaacggacaccgactagccagcacgcccgggcattggaattcaa 92 |||||| | |||||||||||||||| |||||||||||||| ||||| | |||||| Sbjct: 1201 agtatacgtgcgaacggacaccgaccagccagcacgcccgtgcattcgcattcaa 1147
>gb|AC167969.2| Mus musculus BAC clone RP24-446H24 from chromosome 17, complete sequence Length = 178774 Score = 38.2 bits (19), Expect = 4.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 54 gacaccgactagccagcac 72 ||||||||||||||||||| Sbjct: 78613 gacaccgactagccagcac 78595
>gb|AC125154.3| Mus musculus BAC clone RP24-380C2 from chromosome 3, complete sequence Length = 186277 Score = 38.2 bits (19), Expect = 4.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 25 tttattattcataagtata 43 ||||||||||||||||||| Sbjct: 130272 tttattattcataagtata 130290
>gb|AC164576.4| Mus musculus 10 BAC RP23-50F14 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 205209 Score = 38.2 bits (19), Expect = 4.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 26 ttattattcataagtatag 44 ||||||||||||||||||| Sbjct: 463 ttattattcataagtatag 481
>gb|AC122406.5| Mus musculus BAC clone RP24-126L14 from chromosome 17, complete sequence Length = 161377 Score = 38.2 bits (19), Expect = 4.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 54 gacaccgactagccagcac 72 ||||||||||||||||||| Sbjct: 147767 gacaccgactagccagcac 147749
>gb|AC153485.9| Mus musculus 10 BAC RP23-319B13 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 213412 Score = 38.2 bits (19), Expect = 4.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 26 ttattattcataagtatag 44 ||||||||||||||||||| Sbjct: 94993 ttattattcataagtatag 95011
>emb|BX950866.15| Zebrafish DNA sequence from clone DKEY-3J24 in linkage group 19, complete sequence Length = 96656 Score = 38.2 bits (19), Expect = 4.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 20 caacgtttattattcataa 38 ||||||||||||||||||| Sbjct: 5967 caacgtttattattcataa 5985
>gb|AC007751.3|AC007751 Homo sapiens, clone 5_A_11, complete sequence Length = 158963 Score = 38.2 bits (19), Expect = 4.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 26 ttattattcataagtatag 44 ||||||||||||||||||| Sbjct: 73591 ttattattcataagtatag 73609
>dbj|AP006544.1| Homo sapiens genomic DNA, chromosome 8q22.3, clone: KB1575F09, complete sequence Length = 126600 Score = 38.2 bits (19), Expect = 4.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 26 ttattattcataagtatag 44 ||||||||||||||||||| Sbjct: 22766 ttattattcataagtatag 22748 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 501,296 Number of Sequences: 3902068 Number of extensions: 501296 Number of successful extensions: 45746 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 45736 Number of HSP's gapped (non-prelim): 10 length of query: 92 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 71 effective length of database: 17,151,101,840 effective search space: 1217728230640 effective search space used: 1217728230640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)