>gb|AC007170.6| Arabidopsis thaliana chromosome 2 clone T3P4 map mi310, complete
             sequence
          Length = 78568

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 136   ctgctagaaagtagaaacccta 157
             ||||||||||||||||||||||
Sbjct: 17718 ctgctagaaagtagaaacccta 17697

>gb|AC140485.3| Homo sapiens BAC clone RP11-682G22 from 2, complete sequence
          Length = 170502

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 162  agccaggaggaggagcaccactagctcccagcaa 195
            ||||||||||  ||||||||||||||| ||||||
Sbjct: 8906 agccaggagggtgagcaccactagctctcagcaa 8939

>gb|AC019013.2|AC019013 Genomic Sequence For Arabidopsis thaliana, Clone T5E15, Chromosome V,
            complete sequence
          Length = 114056

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 136  ctgctagaaagtagaaacccta 157
            ||||||||||||||||||||||
Sbjct: 7802 ctgctagaaagtagaaacccta 7781

>gb|AC018660.1|AC018660 Genomic Sequence For Arabidopsis thaliana Clone F11P10, Chromosome V,
             complete sequence
          Length = 105589

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 136   ctgctagaaagtagaaacccta 157
             ||||||||||||||||||||||
Sbjct: 98477 ctgctagaaagtagaaacccta 98456

>gb|AC168274.5| Mus musculus  BAC RP23-229B1 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 177020

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 194    aagaaatgtagccaaaagggtgaa 217
              |||||||||||||||| |||||||
Sbjct: 159696 aagaaatgtagccaaatgggtgaa 159673

>gb|AC156952.22| Mus musculus 10 BAC RP24-385D2 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 179140

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 194   aagaaatgtagccaaaagggtgaa 217
             |||||||||||||||| |||||||
Sbjct: 74318 aagaaatgtagccaaatgggtgaa 74295

>ref|XM_388832.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08656.1)
            partial mRNA
          Length = 1836

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 166  aggaggaggagcaccactag 185
            ||||||||||||||||||||
Sbjct: 1476 aggaggaggagcaccactag 1457

>gb|AC144792.3| Mus musculus BAC clone RP24-501M24 from chromosome 19, complete
             sequence
          Length = 164766

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 159   agtagccaggaggaggagca 178
             ||||||||||||||||||||
Sbjct: 75112 agtagccaggaggaggagca 75093

>gb|AC158235.3| Mus musculus BAC clone RP23-185P17 from chromosome 16, complete
             sequence
          Length = 198822

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 95    attatttctgcatacacaaa 114
             ||||||||||||||||||||
Sbjct: 72705 attatttctgcatacacaaa 72724

>emb|AL133418.4| Human DNA sequence from clone RP5-835G14 on chromosome 1q42.1-43
             Contains the 3' end of a novel gene (KIAA0117), the 3' end
             of the ARID4B gene for AT rich interactive domain 4B
             (RBP1- like), a novel gene and a CpG island, complete
             sequence
          Length = 77585

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 45    acattctagcagtggaaatcccct 68
             ||||||| ||||||||||||||||
Sbjct: 45212 acattctggcagtggaaatcccct 45189

>gb|AC089982.15| Homo sapiens 12 BAC RP11-25I15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 173877

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 86     cttggattaattatttctgc 105
              ||||||||||||||||||||
Sbjct: 145425 cttggattaattatttctgc 145406

>gb|AC067719.12| Homo sapiens 3 BAC RP11-183L23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 172945

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 99     tttctgcatacacaaatcaa 118
              ||||||||||||||||||||
Sbjct: 111039 tttctgcatacacaaatcaa 111020

>emb|BX649319.8| Zebrafish DNA sequence from clone DKEYP-88E3 in linkage group 20,
             complete sequence
          Length = 108164

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 89    ggattaattatttctgcata 108
             ||||||||||||||||||||
Sbjct: 30459 ggattaattatttctgcata 30440


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,977,752
Number of Sequences: 3902068
Number of extensions: 2977752
Number of successful extensions: 50698
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50674
Number of HSP's gapped (non-prelim): 24
length of query: 260
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 238
effective length of database: 17,147,199,772
effective search space: 4081033545736
effective search space used: 4081033545736
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)