>gb|AY968589.1| Triticum aestivum ice recrystallization inhibition protein 2
            precursor, mRNA, complete cds
          Length = 1596

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 189  ctcccagatacaacatttttgctcccagatacgatatttttgctccc 235
            ||||||||||||||||| |||||||||| ||||| ||| || |||||
Sbjct: 1205 ctcccagatacaacattattgctcccagttacgacattgttcctccc 1159

>emb|AJ277399.1|LPE277399 Lolium perenne partial mRNA for ice recrystallisation inhibition
           protein
          Length = 357

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 192 ccagatacaacatttttgctcccagatacgatatttttgctccc 235
           ||||||||||| |  ||||||||||||||| |||| ||||||||
Sbjct: 329 ccagatacaacgtggttgctcccagatacggtattgttgctccc 286

>gb|AY968588.1| Triticum aestivum ice recrystallization inhibition protein 1
           precursor, mRNA, complete cds
          Length = 1079

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 188 gctcccagatacaacatttttgctcccagatac 220
           |||||||||||| ||||  ||||||||||||||
Sbjct: 918 gctcccagatacgacatggttgctcccagatac 886

>gb|AF547983.1| Schizosaccharomyces japonicus mitochondrial DNA, complete genome
          Length = 80059

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    atgagtctctttatttattct 32
             |||||||||||||||||||||
Sbjct: 24145 atgagtctctttatttattct 24165

>gb|AC154460.2| Mus musculus BAC clone RP24-163G22 from chromosome 13, complete sequence
          Length = 197149

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     tctctttatttattctttaat 37
              |||||||||||||||||||||
Sbjct: 186122 tctctttatttattctttaat 186102

>gb|AC164981.2| Mus musculus BAC clone RP23-121F5 from chromosome 17, complete sequence
          Length = 243701

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 24     atttattctttaattatcat 43
              ||||||||||||||||||||
Sbjct: 169169 atttattctttaattatcat 169150

>gb|AC096082.6| Rattus norvegicus 13 BAC CH230-11O17 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 209228

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 21    tttatttattctttaattat 40
             ||||||||||||||||||||
Sbjct: 20278 tttatttattctttaattat 20259

>ref|XM_818269.1| Trypanosoma brucei TREU927 hypothetical protein (Tb10.26.0360)
           partial mRNA
          Length = 2229

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 203 atttttgctcccagatacga 222
           ||||||||||||||||||||
Sbjct: 195 atttttgctcccagatacga 176

>gb|AC129313.4| Mus musculus BAC clone RP23-342K4 from chromosome 8, complete sequence
          Length = 215576

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     tatgagtctctttatttatt 30
              ||||||||||||||||||||
Sbjct: 169582 tatgagtctctttatttatt 169563

>emb|AL672045.11| Human DNA sequence from clone RP11-577O19 on chromosome 1 ras-related
             C3 botulinum toxin substrate 1 (rho family, small GTP
             binding protein Rac1) (RAC1) pseudogene, complete sequence
          Length = 180303

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    tctttatttattctttaatt 38
             ||||||||||||||||||||
Sbjct: 50796 tctttatttattctttaatt 50777

>emb|AL354992.7| Human DNA sequence from clone RP11-293A1 on chromosome 9, complete
             sequence
          Length = 173911

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    tctctttatttattctttaa 36
             ||||||||||||||||||||
Sbjct: 31203 tctctttatttattctttaa 31222

>gb|AF396997.1| Saccharomyces sp. NRRL409-1B small subunit ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 552

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 21  tttatttattctttaattat 40
           ||||||||||||||||||||
Sbjct: 445 tttatttattctttaattat 426

>gb|AF442292.1| Saccharomyces martiniae small subunit ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 598

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 21  tttatttattctttaattat 40
           ||||||||||||||||||||
Sbjct: 140 tttatttattctttaattat 121

>emb|CR759927.12| Zebrafish DNA sequence from clone CH211-196C10 in linkage group 8,
             complete sequence
          Length = 205716

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    tttatttattctttaattat 40
             ||||||||||||||||||||
Sbjct: 17971 tttatttattctttaattat 17990

>emb|BX088718.7| Zebrafish DNA sequence from clone DKEY-185E18, complete sequence
          Length = 192836

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 20     ctttatttattctttaatta 39
              ||||||||||||||||||||
Sbjct: 142499 ctttatttattctttaatta 142480

>dbj|AB016873.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K22F20
          Length = 64827

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     atatatgagtctctttattt 27
             ||||||||||||||||||||
Sbjct: 15418 atatatgagtctctttattt 15399

>emb|CT806423.2| Pan troglodytes chromosome X clone CH251-25B01 map Xq28, complete
             sequence
          Length = 220032

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 91    gcacacacttataccatgatgtgc 114
             ||||||||||||||||||| ||||
Sbjct: 42276 gcacacacttataccatgaggtgc 42253

>emb|AL935030.9| Zebrafish DNA sequence from clone CH211-57O7, complete sequence
          Length = 173478

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 21    tttatttattctttaattat 40
             ||||||||||||||||||||
Sbjct: 38449 tttatttattctttaattat 38430

>dbj|AB015879.1| Porphyromonas gingivalis dnaK operon genes, complete cds
          Length = 9878

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 60   tccgtcaacgtgaagggacggatg 83
            ||||||||||| ||||||||||||
Sbjct: 9346 tccgtcaacgtaaagggacggatg 9369


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,421,112
Number of Sequences: 3902068
Number of extensions: 2421112
Number of successful extensions: 47694
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47657
Number of HSP's gapped (non-prelim): 37
length of query: 322
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 300
effective length of database: 17,147,199,772
effective search space: 5144159931600
effective search space used: 5144159931600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)