ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart23d01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHA... 157 3e-35
2gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase... 109 7e-21
3gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase p... 100 7e-18
4gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 44 0.34
5emb|CR762443.6| Zebrafish DNA sequence from clone DKEY-3A5 in li... 42 1.4
6emb|AL160412.14| Human DNA sequence from clone RP5-827E24 on chr... 42 1.4
7gb|AC107925.5| Homo sapiens chromosome 11, clone RP11-379A20, co... 42 1.4
8emb|BX255913.8| Zebrafish DNA sequence from clone DKEY-85N7 in l... 42 1.4
9gb|AC005932.1|AC005932 Homo sapiens chromosome 19, cosmid R31317... 42 1.4
10gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, com... 42 1.4
11dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 42 1.4
12gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 5.4
13gb|AC006770.1| Caenorhabditis elegans cosmid Y46B2A, complete se... 40 5.4
14ref|XM_366481.1| Magnaporthe grisea 70-15 chromosome VII predict... 40 5.4
15ref|XM_714685.1| Candida albicans SC5314 hypothetical protein (C... 40 5.4
16ref|XM_714802.1| Candida albicans SC5314 hypothetical protein (C... 40 5.4
17gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete s... 40 5.4
18gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 40 5.4
19emb|CR457462.13| Zebrafish DNA sequence from clone CH211-1O7 in ... 40 5.4
20emb|BX324227.16| Zebrafish DNA sequence from clone CH211-149M17 ... 40 5.4
21dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 5.4
22emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on ch... 40 5.4

>gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHAR) mRNA, complete
           cds
          Length = 956

 Score =  157 bits (79), Expect = 3e-35
 Identities = 91/95 (95%)
 Strand = Plus / Minus

                                                                       
Query: 308 ggcgggggagcttacgggttcaccttcggcgcccacccggcgatcaggttctccttggtc 367
           |||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 724 ggcgggagggcttacgggttcactttcggcgcccacccggcgatcaggttctccttggtc 665

                                              
Query: 368 ggcttggtcttgacgaacgactcgcggctgaagag 402
           | |||||||||||||||||||||||||||||||||
Sbjct: 664 gccttggtcttgacgaacgactcgcggctgaagag 630



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 198 aggctcgctcgcattattccaa 219
           ||||||||||||||||||||||
Sbjct: 806 aggctcgctcgcattattccaa 785



to top

>gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 202

 Score =  109 bits (55), Expect = 7e-21
 Identities = 76/83 (91%)
 Strand = Plus / Minus

                                                                       
Query: 317 gcttacgggttcaccttcggcgcccacccggcgatcaggttctccttggtcggcttggtc 376
           |||||||||||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 200 gcttacgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtc 141

                                  
Query: 377 ttgacgaacgactcgcggctgaa 399
           |||||||| || || ||||||||
Sbjct: 140 ttgacgaaggattcccggctgaa 118



to top

>gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 195

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 71/78 (91%)
 Strand = Plus / Minus

                                                                       
Query: 322 cgggttcaccttcggcgcccacccggcgatcaggttctccttggtcggcttggtcttgac 381
           ||||||||| || |||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 195 cgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtcttgac 136

                             
Query: 382 gaacgactcgcggctgaa 399
           ||| || || ||||||||
Sbjct: 135 gaaggattcccggctgaa 118



to top

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 364     ggtcggcttggtcttgacgaacgact 389
               ||||||| ||||||||||||||||||
Sbjct: 1119794 ggtcggcctggtcttgacgaacgact 1119769



to top

>emb|CR762443.6| Zebrafish DNA sequence from clone DKEY-3A5 in linkage group 10, complete
              sequence
          Length = 213185

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 32     cattatttatccatccatcat 52
              |||||||||||||||||||||
Sbjct: 138665 cattatttatccatccatcat 138645



to top

>emb|AL160412.14| Human DNA sequence from clone RP5-827E24 on chromosome 20 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 111824

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 30    tccattatttatccatccatc 50
             |||||||||||||||||||||
Sbjct: 11317 tccattatttatccatccatc 11297



to top

>gb|AC107925.5| Homo sapiens chromosome 11, clone RP11-379A20, complete sequence
          Length = 170801

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 34    ttatttatccatccatcatac 54
             |||||||||||||||||||||
Sbjct: 66638 ttatttatccatccatcatac 66618



to top

>emb|BX255913.8| Zebrafish DNA sequence from clone DKEY-85N7 in linkage group 20, complete
              sequence
          Length = 248581

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 30     tccattatttatccatccatc 50
              |||||||||||||||||||||
Sbjct: 126747 tccattatttatccatccatc 126767



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 30     tccattatttatccatccatc 50
              |||||||||||||||||||||
Sbjct: 126483 tccattatttatccatccatc 126503



to top

>gb|AC005932.1|AC005932 Homo sapiens chromosome 19, cosmid R31317, complete sequence
          Length = 41696

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 30    tccattatttatccatccatc 50
             |||||||||||||||||||||
Sbjct: 12239 tccattatttatccatccatc 12259



to top

>gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, complete sequence
          Length = 195657

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 132   agccaggcagggggcagacag 152
             |||||||||||||||||||||
Sbjct: 71257 agccaggcagggggcagacag 71277



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 321    acgggttcaccttcggcgccc 341
              |||||||||||||||||||||
Sbjct: 209716 acgggttcaccttcggcgccc 209736



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 360    ccttggtcggcttggtcttg 379
              ||||||||||||||||||||
Sbjct: 505341 ccttggtcggcttggtcttg 505322



to top

>gb|AC006770.1| Caenorhabditis elegans cosmid Y46B2A, complete sequence
          Length = 22382

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 9    aaattctgaattttattcag 28
            ||||||||||||||||||||
Sbjct: 9248 aaattctgaattttattcag 9267



to top

>ref|XM_366481.1| Magnaporthe grisea 70-15 chromosome VII predicted protein
           (MG02557.4) partial mRNA
          Length = 966

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 367 cggcttggtcttgacgaacg 386
           ||||||||||||||||||||
Sbjct: 216 cggcttggtcttgacgaacg 197



to top

>ref|XM_714685.1| Candida albicans SC5314 hypothetical protein (CaO19_14092), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 259  tactactgccatcactactggcac 282
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340



to top

>ref|XM_714802.1| Candida albicans SC5314 hypothetical protein (CaO19_6800), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 259  tactactgccatcactactggcac 282
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340



to top

>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence
          Length = 161430

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 179    caggcagagcacacagcaga 198
              ||||||||||||||||||||
Sbjct: 111810 caggcagagcacacagcaga 111829



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 345     cggcgatcaggttctccttg 364
               ||||||||||||||||||||
Sbjct: 3304928 cggcgatcaggttctccttg 3304947



to top

>emb|CR457462.13| Zebrafish DNA sequence from clone CH211-1O7 in linkage group 13,
             complete sequence
          Length = 166823

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 31    ccattatttatccatccatc 50
             ||||||||||||||||||||
Sbjct: 90368 ccattatttatccatccatc 90349



to top

>emb|BX324227.16| Zebrafish DNA sequence from clone CH211-149M17 in linkage group 15,
             complete sequence
          Length = 129726

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    aattttattcagctccatta 36
             ||||||||||||||||||||
Sbjct: 28373 aattttattcagctccatta 28392



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 349     gatcaggttctccttggtcg 368
               ||||||||||||||||||||
Sbjct: 3814314 gatcaggttctccttggtcg 3814295



to top

>emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on chromosome 3, complete
             sequence
          Length = 16950

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   agccaggcagggggcagaca 151
             ||||||||||||||||||||
Sbjct: 12882 agccaggcagggggcagaca 12863


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,537,471
Number of Sequences: 3902068
Number of extensions: 2537471
Number of successful extensions: 53259
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53099
Number of HSP's gapped (non-prelim): 160
length of query: 402
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 380
effective length of database: 17,147,199,772
effective search space: 6515935913360
effective search space used: 6515935913360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top