ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart23c11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds Length = 3086 Score = 837 bits (422), Expect = 0.0 Identities = 429/430 (99%), Gaps = 1/430 (0%) Strand = Plus / Minus Query: 1 atcacacggtaaaagaaagatactataaaaa-cttaatactatgcctttgattgcacaca 59 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 2522 atcacacggtaaaagaaagatactataaaaaacttaatactatgcctttgattgcacaca 2463 Query: 60 cggcggttcctcgagtctttattcttcactactctacccgaggccgccgaggcaagtcag 119 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2462 cggcggttcctcgagtctttattcttcactactctacccgaggccgccgaggcaagtcag 2403 Query: 120 gctcagttcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttct 179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2402 gctcagttcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttct 2343 Query: 180 tctcgtgggtgccctcagtagcgccgtacgtccccccggtaccggtggtgccagctccgt 239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2342 tctcgtgggtgccctcagtagcgccgtacgtccccccggtaccggtggtgccagctccgt 2283 Query: 240 agccgccggtgccagtggtgccagctccgtagccgccggtcgtcgccgtggtgtgcggcg 299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2282 agccgccggtgccagtggtgccagctccgtagccgccggtcgtcgccgtggtgtgcggcg 2223 Query: 300 ggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttct 359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2222 ggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttct 2163 Query: 360 cgtgcgtcccctcggtggctccgtgggccccgccggtgccggtggtccccgtgtaccctg 419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2162 cgtgcgtcccctcggtggctccgtgggccccgccggtgccggtggtccccgtgtaccctg 2103 Query: 420 gcccgtagcc 429 |||||||||| Sbjct: 2102 gcccgtagcc 2093 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 137 ccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||| | ||||||| |||||| Sbjct: 2064 ccgccggggagcttctccttgatcttctgcttcatgcctttcttc 2020 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 305 tccttgtgcccgccagggagcttctccttgatcttct 341 ||||||| ||||| |||||||||||||||||||||| Sbjct: 2073 tccttgttaccgccggggagcttctccttgatcttct 2037
>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds Length = 1637 Score = 821 bits (414), Expect = 0.0 Identities = 427/430 (99%), Gaps = 1/430 (0%) Strand = Plus / Minus Query: 1 atcacacggtaaaagaaagatactataaaaa-cttaatactatgcctttgattgcacaca 59 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1607 atcacacggtaaaagaaagatactataaaaaacttaatactatgcctttgattgcacaca 1548 Query: 60 cggcggttcctcgagtctttattcttcactactctacccgaggccgccgaggcaagtcag 119 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1547 cggtggttcctcgagtctttattcttcactactctacccgaggccgccgaggcaagtcag 1488 Query: 120 gctcagttcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttct 179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1487 gctcagttcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttct 1428 Query: 180 tctcgtgggtgccctcagtagcgccgtacgtccccccggtaccggtggtgccagctccgt 239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1427 tctcgtgggtgccctcagtagcgccgtacgtccccccggtaccggtggtgccagctccgt 1368 Query: 240 agccgccggtgccagtggtgccagctccgtagccgccggtcgtcgccgtggtgtgcggcg 299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1367 agccgccggtgccagtggtgccagctccgtagccgccggtcgtcgccgtggtgtgcggcg 1308 Query: 300 ggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttct 359 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1307 ggttgttcttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttct 1248 Query: 360 cgtgcgtcccctcggtggctccgtgggccccgccggtgccggtggtccccgtgtaccctg 419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1247 cgtgcgtcccctcggtggctccgtgggccccgccggtgccggtggtccccgtgtaccctg 1188 Query: 420 gcccgtagcc 429 |||||||||| Sbjct: 1187 gcccgtagcc 1178 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 137 ccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||| | ||||||| |||||| Sbjct: 1149 ccgccggggagcttctccttgatcttctgcttcatgcctttcttc 1105 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 305 tccttgtgcccgccagggagcttctccttgatcttct 341 ||||||| ||||| |||||||||||||||||||||| Sbjct: 1158 tccttgttaccgccggggagcttctccttgatcttct 1122
>gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein WCS120 (WCS120) mRNA, complete cds Length = 1504 Score = 95.6 bits (48), Expect = 1e-16 Identities = 51/52 (98%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 100 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 49 Score = 81.8 bits (41), Expect = 2e-12 Identities = 44/45 (97%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 534 ccagggagcttctccttgatgttctccatgacgcccttcttctcg 490 Score = 79.8 bits (40), Expect = 7e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| |||||||||||||||||||||||||||| ||||||||||||| Sbjct: 96 ccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 49 Score = 75.8 bits (38), Expect = 1e-10 Identities = 53/58 (91%) Strand = Plus / Minus Query: 304 gtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||| || ||||||||||| |||||||| |||||||||||||||||||||||| Sbjct: 295 gtcctggtggccaccagggagcttgtccttgatgttctccatgacgcccttcttctcg 238 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||||||||||||||||| Sbjct: 918 ccagggagcttttccttgatgttctccatgacgcccttcttctcg 874 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||||||| ||||||||| Sbjct: 726 ccagggagcttgtccttgatgttctccatgacgcctttcttctcg 682 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| | ||||||||||||| Sbjct: 541 gtggccaccagggagcttctccttgatgttctccatgacgcccttcttctcg 490 Score = 60.0 bits (30), Expect = 6e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 131 tggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||| || |||||||| |||||||| |||||||| | ||||||||||||| Sbjct: 291 tggtggccaccagggagcttgtccttgatgttctccatgacgcccttcttctcg 238 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| | ||||||||||||| Sbjct: 925 gtggccaccagggagcttttccttgatgttctccatgacgcccttcttctcg 874 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1188 ccaggcagcttatccttgatcttgtccatgaggctcttcttctcg 1144
>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2) mRNA, complete cds Length = 1518 Score = 95.6 bits (48), Expect = 1e-16 Identities = 51/52 (98%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 131 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 80 Score = 79.8 bits (40), Expect = 7e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| |||||||||||||||||||||||||||| ||||||||||||| Sbjct: 127 ccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 80 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 1072 gggagcttctccttgatgttttccatgacgcccttcttctcg 1031 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 688 gggagcttctccttgatgttctccatgacacccttcttctcg 647 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| |||||||| |||||||||||||||||||||||| Sbjct: 493 ccaggaagcttgtccttgatgttctccatgacgcccttcttctcg 449 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 1082 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 1031 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 697 tggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 647 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| |||||||||||||| ||||||||| Sbjct: 880 gggagcttgtccttgatgttctccatgacgcctttcttctcg 839 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||| |||||||| |||||||| | ||| ||||||||| Sbjct: 890 gtggccaccggggagcttgtccttgatgttctccatgacgcctttcttctcg 839 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1285 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 1241 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccat 168 |||||| ||||||||||| |||||||| |||||||| Sbjct: 302 gtggccaccggggagcttgtccttgatgttctccat 267 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| |||||||| |||||||| | ||||||||||||| Sbjct: 487 agcttgtccttgatgttctccatgacgcccttcttctcg 449
>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds Length = 3447 Score = 95.6 bits (48), Expect = 1e-16 Identities = 51/52 (98%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 676 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 625 Score = 79.8 bits (40), Expect = 7e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| |||||||||||||||||||||||||||| ||||||||||||| Sbjct: 672 ccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 625 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 1521 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 1477 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| ||||||||||||||||||| ||||||||||||| Sbjct: 867 ccagggagcttgtccttgatcttctccatgaggcccttcttctcg 823 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 1528 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 1477 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 2103 gggagcttctccttgatgttctccatgacacccttcttctcg 2062 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 1911 gggagcttctccttgatgttttccatgacgcccttcttctcg 1870 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| |||||||| |||||||||||||||||||||||| Sbjct: 1128 ccaggaagcttgtccttgatgttctccatgacgcccttcttctcg 1084 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 2113 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 2062 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 1921 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 1870 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| | ||||||||||||| Sbjct: 874 gtggccaccagggagcttgtccttgatcttctccatgaggcccttcttctcg 823 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| |||||||| || |||||||||||| Sbjct: 1326 gggagcttatccttgatgttctccattacacccttcttctcg 1285 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 2316 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 2272 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||| |||||||| |||||||| | |||||||||||| Sbjct: 1329 ccggggagcttatccttgatgttctccattacacccttcttctcg 1285 Score = 48.1 bits (24), Expect = 0.024 Identities = 45/52 (86%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || || ||||| |||||||| |||||||| | ||||||||||||| Sbjct: 1135 gtggccaccaggaagcttgtccttgatgttctccatgacgcccttcttctcg 1084 Score = 42.1 bits (21), Expect = 1.5 Identities = 39/45 (86%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| || ||||| |||||||| || |||||||||||| Sbjct: 1722 ccagagagcttttcattgatgttctccattacacccttcttctcg 1678
>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds Length = 1243 Score = 95.6 bits (48), Expect = 1e-16 Identities = 51/52 (98%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 128 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 77 Score = 79.8 bits (40), Expect = 7e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| |||||||| |||||||||||||||||||||||| Sbjct: 757 ccgccagggagcttgtccttgatgttctccatgacgcccttcttctcg 710 Score = 79.8 bits (40), Expect = 7e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| |||||||||||||||||||||||||||| ||||||||||||| Sbjct: 124 ccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 77 Score = 75.8 bits (38), Expect = 1e-10 Identities = 41/42 (97%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| |||||||||||||||||||||||| Sbjct: 943 gggagcttctccttgatgttctccatgacgcccttcttctcg 902 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 562 ccagggagcttctccttgatgttctccatgaggcccttcttctcg 518 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | ||||||||||||| Sbjct: 953 gtggccaccggggagcttctccttgatgttctccatgacgcccttcttctcg 902 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 304 gtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||| || ||||||||||| |||||||| |||||||| ||||||||||||||| Sbjct: 323 gtcctcgtggccaccagggagcttgtccttgatgttctccatcacgcccttcttctcg 266 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||| |||||||| |||||||| |||||||| | ||||||||||||| Sbjct: 761 gtggccgccagggagcttgtccttgatgttctccatgacgcccttcttctcg 710 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||||| ||||||||||||| Sbjct: 317 gtggccaccagggagcttgtccttgatgttctccatcacgcccttcttctcg 266 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| || ||||||||||||||||| |||||||| | ||||||||||||| Sbjct: 568 tggccaccagggagcttctccttgatgttctccatgaggcccttcttctcg 518 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1216 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 1172
>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds Length = 2432 Score = 95.6 bits (48), Expect = 1e-16 Identities = 51/52 (98%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 669 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 618 Score = 79.8 bits (40), Expect = 7e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| |||||||||||||||||||||||||||| ||||||||||||| Sbjct: 665 ccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 618 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 1514 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 1470 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| ||||||||||||||||||| ||||||||||||| Sbjct: 860 ccagggagcttgtccttgatcttctccatgaggcccttcttctcg 816 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 1521 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 1470 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 2096 gggagcttctccttgatgttctccatgacacccttcttctcg 2055 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 1904 gggagcttctccttgatgttttccatgacgcccttcttctcg 1863 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| |||||||| |||||||||||||||||||||||| Sbjct: 1121 ccaggaagcttgtccttgatgttctccatgacgcccttcttctcg 1077 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 2106 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 2055 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 1914 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 1863 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| | ||||||||||||| Sbjct: 867 gtggccaccagggagcttgtccttgatcttctccatgaggcccttcttctcg 816 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| |||||||| || |||||||||||| Sbjct: 1319 gggagcttatccttgatgttctccattacacccttcttctcg 1278 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 2309 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 2265 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 1715 ccagagagcttttccttgatgttctccattacacccttcttctcg 1671 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||| |||||||| |||||||| | |||||||||||| Sbjct: 1322 ccggggagcttatccttgatgttctccattacacccttcttctcg 1278 Score = 48.1 bits (24), Expect = 0.024 Identities = 45/52 (86%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || || ||||| |||||||| |||||||| | ||||||||||||| Sbjct: 1128 gtggccaccaggaagcttgtccttgatgttctccatgacgcccttcttctcg 1077 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 1710 gagcttttccttgatgttctccattacacccttcttctcg 1671
>gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds Length = 1629 Score = 95.6 bits (48), Expect = 1e-16 Identities = 51/52 (98%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 154 gtggccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 103 Score = 79.8 bits (40), Expect = 7e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| |||||||||||||||||||||||||||| ||||||||||||| Sbjct: 150 ccgccggggagcttctccttgatcttctccatgatgcccttcttctcg 103 Score = 69.9 bits (35), Expect = 6e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 300 ggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||| |||| || ||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 1031 ggttgtcactgtggccaccagggagcttgtccttgatgttctccatgacgcccttcttc 973 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| |||||||||||||||||||||||| Sbjct: 333 gggagcttgtccttgatgttctccatgacgcccttcttctcg 292 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||||| ||||||||||| Sbjct: 1206 ccagggagcttgtccttgatgttctccatgacggccttcttctcg 1162 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||| ||||||||||||| Sbjct: 822 ccagggagcttgtccttgatgttctccatgaggcccttcttctcg 778 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| || |||||||||| Sbjct: 630 ccagggagcttctccttgatgttctccatgaggctcttcttctcg 586 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| ||||||||||| |||||||| |||||||| | ||||||||||||| Sbjct: 342 tggccaccggggagcttgtccttgatgttctccatgacgcccttcttctcg 292 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| | ||||||||||||| Sbjct: 829 gtggccaccagggagcttgtccttgatgttctccatgaggcccttcttctcg 778 Score = 54.0 bits (27), Expect = 4e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| || ||||||||||||||||| |||||||| | || |||||||||| Sbjct: 636 tggccaccagggagcttctccttgatgttctccatgaggctcttcttctcg 586 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1476 ccaggtagcttgtccttgatcttgtccatgaggctcttcttctcg 1432 Score = 48.1 bits (24), Expect = 0.024 Identities = 45/52 (86%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| | | ||||||||||| Sbjct: 1213 gtggccaccagggagcttgtccttgatgttctccatgacggccttcttctcg 1162
>gb|AF181461.1|AF181461 Hordeum vulgare dehydrin (Dhn11) gene, complete cds Length = 2009 Score = 91.7 bits (46), Expect = 2e-15 Identities = 52/54 (96%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtcccc 370 ||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1629 ccagggagcttctccttgatcttctccatgatacccttcttctcgtgcgtcccc 1576 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcgtg 186 |||||||||||||||||||||||||| || |||||||||||||| Sbjct: 1626 gggagcttctccttgatcttctccatgatacccttcttctcgtg 1583 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttct 182 ||||||||||| ||||||||| | ||||||||||||| Sbjct: 1512 agcttctcctttatcttctccttgatgcccttcttct 1476 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||| ||||||||| ||| ||||||||||| Sbjct: 1512 agcttctcctttatcttctccttgatgcccttcttct 1476
>gb|AF043086.1|AF043086 Hordeum vulgare dehydrin 11 (dhn11) gene, complete cds Length = 2420 Score = 91.7 bits (46), Expect = 2e-15 Identities = 52/54 (96%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtcccc 370 ||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1637 ccagggagcttctccttgatcttctccatgatacccttcttctcgtgcgtcccc 1584 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcgtg 186 |||||||||||||||||||||||||| || |||||||||||||| Sbjct: 1634 gggagcttctccttgatcttctccatgatacccttcttctcgtg 1591 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttct 182 ||||||||||| ||||||||| | ||||||||||||| Sbjct: 1520 agcttctcctttatcttctccttgatgcccttcttct 1484 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||| ||||||||| ||| ||||||||||| Sbjct: 1520 agcttctcctttatcttctccttgatgcccttcttct 1484
>gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 818 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 770 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 837 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 778 Query: 351 ccttcttc 358 |||||||| Sbjct: 777 ccttcttc 770 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935
>gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 820 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 772 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 839 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 780 Query: 351 ccttcttc 358 |||||||| Sbjct: 779 ccttcttc 772 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937
>gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 818 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 770 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 837 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 778 Query: 351 ccttcttc 358 |||||||| Sbjct: 777 ccttcttc 770 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935
>gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 818 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 770 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 837 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 778 Query: 351 ccttcttc 358 |||||||| Sbjct: 777 ccttcttc 770 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935
>gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 9 (Dhn9) gene, complete cds Length = 992 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 805 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 757 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 824 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 765 Query: 351 ccttcttc 358 |||||||| Sbjct: 764 ccttcttc 757 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 960 agcttctccttgatcttgtccatgatccccttcttctcg 922 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 960 agcttctccttgatcttgtccatgatccccttcttctcg 922
>gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 9 (Dhn9) gene, complete cds Length = 994 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 807 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 759 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 826 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 767 Query: 351 ccttcttc 358 |||||||| Sbjct: 766 ccttcttc 759 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 962 agcttctccttgatcttgtccatgatccccttcttctcg 924 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 962 agcttctccttgatcttgtccatgatccccttcttctcg 924
>gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 818 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 770 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 837 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 778 Query: 351 ccttcttc 358 |||||||| Sbjct: 777 ccttcttc 770 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935
>gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 9 (Dhn9) gene, complete cds Length = 1000 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 813 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 765 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 832 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 773 Query: 351 ccttcttc 358 |||||||| Sbjct: 772 ccttcttc 765 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 968 agcttctccttgatcttgtccatgatccccttcttctcg 930 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 968 agcttctccttgatcttgtccatgatccccttcttctcg 930
>gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 818 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 770 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 837 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 778 Query: 351 ccttcttc 358 |||||||| Sbjct: 777 ccttcttc 770 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 973 agcttctccttgatcttgtccatgatccccttcttctcg 935
>gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 820 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 772 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 839 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 780 Query: 351 ccttcttc 358 |||||||| Sbjct: 779 ccttcttc 772 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937
>gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 820 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 772 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 839 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 780 Query: 351 ccttcttc 358 |||||||| Sbjct: 779 ccttcttc 772 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937
>gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 9 (Dhn9) gene, complete cds Length = 1004 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 817 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 769 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 836 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 777 Query: 351 ccttcttc 358 |||||||| Sbjct: 776 ccttcttc 769 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 972 agcttctccttgatcttgtccatgatccccttcttctcg 934 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 972 agcttctccttgatcttgtccatgatccccttcttctcg 934
>gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 820 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 772 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 839 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 780 Query: 351 ccttcttc 358 |||||||| Sbjct: 779 ccttcttc 772 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937
>gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 814 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 766 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 833 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 774 Query: 351 ccttcttc 358 |||||||| Sbjct: 773 ccttcttc 766 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 969 agcttctccttgatcttgtccatgatccccttcttctcg 931
>gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 820 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 772 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 839 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 780 Query: 351 ccttcttc 358 |||||||| Sbjct: 779 ccttcttc 772 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 975 agcttctccttgatcttgtccatgatccccttcttctcg 937
>gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, complete cds Length = 1791 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 985 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 937 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 1004 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 945 Query: 351 ccttcttc 358 |||||||| Sbjct: 944 ccttcttc 937 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 1140 agcttctccttgatcttgtccatgatccccttcttctcg 1102 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 1140 agcttctccttgatcttgtccatgatccccttcttctcg 1102
>gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, complete cds Length = 1630 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1045 gtggccgccggggagcttctccttgatcttctccttcatgcccttcttc 997 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgc 350 ||||| || ||||||||||||| ||||| |||||||||||||||||||||||| | | || Sbjct: 1064 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctccttcatgc 1005 Query: 351 ccttcttc 358 |||||||| Sbjct: 1004 ccttcttc 997 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 1200 agcttctccttgatcttgtccatgatccccttcttctcg 1162 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 1200 agcttctccttgatcttgtccatgatccccttcttctcg 1162
>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds Length = 2814 Score = 87.7 bits (44), Expect = 3e-14 Identities = 50/52 (96%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 674 gtggccgccggggagtttctccttgatcttctccatgatgcccttcttctcg 623 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 1519 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 1475 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| ||||||||||||||||||| ||||||||||||| Sbjct: 865 ccagggagcttgtccttgatcttctccatgaggcccttcttctcg 821 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 1526 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 1475 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| |||||||||||||||||||||| ||||||||||||| Sbjct: 670 ccgccggggagtttctccttgatcttctccatgatgcccttcttctcg 623 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 2101 gggagcttctccttgatgttctccatgacacccttcttctcg 2060 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 1909 gggagcttctccttgatgttttccatgacgcccttcttctcg 1868 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| |||||||| |||||||||||||||||||||||| Sbjct: 1126 ccaggaagcttgtccttgatgttctccatgacgcccttcttctcg 1082 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 2111 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 2060 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 1919 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 1868 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| | ||||||||||||| Sbjct: 872 gtggccaccagggagcttgtccttgatcttctccatgaggcccttcttctcg 821 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||| || |||||||||||| Sbjct: 1720 ccagggagcttttccttgatgttctccattacacccttcttctcg 1676 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| |||||||| || |||||||||||| Sbjct: 1324 gggagcttatccttgatgttctccattacacccttcttctcg 1283 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 2314 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 2270 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||| |||||||| |||||||| | |||||||||||| Sbjct: 1327 ccggggagcttatccttgatgttctccattacacccttcttctcg 1283 Score = 48.1 bits (24), Expect = 0.024 Identities = 45/52 (86%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || || ||||| |||||||| |||||||| | ||||||||||||| Sbjct: 1133 gtggccaccaggaagcttgtccttgatgttctccatgacgcccttcttctcg 1082 Score = 46.1 bits (23), Expect = 0.093 Identities = 44/51 (86%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| || |||||||| |||||||| |||||||| | |||||||||||| Sbjct: 1726 tggccaccagggagcttttccttgatgttctccattacacccttcttctcg 1676
>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0037B06 map near 50283S, complete sequence Length = 149398 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtg 186 |||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 89070 ccggggagcttctccttgatcttctccatcatacccttcttctcgtg 89024 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtc 367 |||||||||||||||||||||||||| | |||||||||||||||||| Sbjct: 89067 gggagcttctccttgatcttctccatcatacccttcttctcgtgcgtc 89020 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 88888 gccgccggggagcttctccttgatcttctccttgattcccttcttc 88843 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 88887 ccgccggggagcttctccttgatcttctccttgattcccttcttc 88843
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Plus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtg 186 |||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 14645646 ccggggagcttctccttgatcttctccatcatacccttcttctcgtg 14645692 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtc 367 |||||||||||||||||||||||||| | |||||||||||||||||| Sbjct: 14645649 gggagcttctccttgatcttctccatcatacccttcttctcgtgcgtc 14645696 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 14766723 gccgccggggagcttctccttgatcttctccttgatccccttcttc 14766768 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 14766555 gccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 14766600 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 14751751 gccgccggggagcttctccttgatcttctccttgattcccttcttc 14751796 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 14744345 gccgccggggagcttctccttgatcttctccttgatccccttcttc 14744390 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||| |||| ||||||||||||||| Sbjct: 14744159 gccggggagcttctccttgatcttgtccacgatgcccttcttctcg 14744204 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 14645828 gccgccggggagcttctccttgatcttctccttgattcccttcttc 14645873 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Plus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 14766562 agcttctccttgatcttgtccatgatgcccttcttctcg 14766600 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||| ||||||||||||||||||||| | || ||||||||| Sbjct: 14760188 gccgccgggcagcttctccttgatcttctccttgattcccttcttc 14760233 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 14751739 gttgcccttgttgccgccggggagcttctccttgatcttctccttgattcccttcttc 14751796 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 14744333 gttgcccttgttgccgccggggagcttctccttgatcttctccttgatccccttcttc 14744390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||| || ||||||||||||| Sbjct: 14744163 gggagcttctccttgatcttgtccacgatgcccttcttctcg 14744204 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 14766724 ccgccggggagcttctccttgatcttctccttgatccccttcttc 14766768 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 14645829 ccgccggggagcttctccttgatcttctccttgattcccttcttc 14645873 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 14760021 agcttctccttgatcttgtccatgaatcccttcttctcg 14760059 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||||||||| ||||||| ||||||||||||| Sbjct: 14751578 agcttttccttgatcttgtccatgaagcccttcttctcg 14751616 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Plus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| || ||||||||||||||||||||| ||| ||||||||| Sbjct: 14760176 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttc 14760233 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| | |||||||||||| Sbjct: 14760014 gccgggcagcttctccttgatcttgtccatgaatcccttcttctcg 14760059 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| ||||||||||| ||||| | ||||||||||||| Sbjct: 14751571 gccgggaagcttttccttgatcttgtccatgaagcccttcttctcg 14751616 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 ccttgatcttctccatcatgc 173 ||||||||||||||||||||| Sbjct: 18624718 ccttgatcttctccatcatgc 18624698
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 85.7 bits (43), Expect = 1e-13 Identities = 46/47 (97%) Strand = Plus / Plus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtg 186 |||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 14727647 ccggggagcttctccttgatcttctccatcatacccttcttctcgtg 14727693 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtc 367 |||||||||||||||||||||||||| | |||||||||||||||||| Sbjct: 14727650 gggagcttctccttgatcttctccatcatacccttcttctcgtgcgtc 14727697 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 14847160 gccgccggggagcttctccttgatcttctccttgatccccttcttc 14847205 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 14846992 gccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 14847037 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 14832188 gccgccggggagcttctccttgatcttctccttgattcccttcttc 14832233 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 14824782 gccgccggggagcttctccttgatcttctccttgatccccttcttc 14824827 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||| |||| ||||||||||||||| Sbjct: 14824596 gccggggagcttctccttgatcttgtccacgatgcccttcttctcg 14824641 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 14727829 gccgccggggagcttctccttgatcttctccttgattcccttcttc 14727874 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Plus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 14846999 agcttctccttgatcttgtccatgatgcccttcttctcg 14847037 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||| ||||||||||||||||||||| | || ||||||||| Sbjct: 14840625 gccgccgggcagcttctccttgatcttctccttgattcccttcttc 14840670 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 14832176 gttgcccttgttgccgccggggagcttctccttgatcttctccttgattcccttcttc 14832233 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 14824770 gttgcccttgttgccgccggggagcttctccttgatcttctccttgatccccttcttc 14824827 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||| || ||||||||||||| Sbjct: 14824600 gggagcttctccttgatcttgtccacgatgcccttcttctcg 14824641 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 14847161 ccgccggggagcttctccttgatcttctccttgatccccttcttc 14847205 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 14727830 ccgccggggagcttctccttgatcttctccttgattcccttcttc 14727874 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 14840458 agcttctccttgatcttgtccatgaatcccttcttctcg 14840496 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||||||||| ||||||| ||||||||||||| Sbjct: 14832015 agcttttccttgatcttgtccatgaagcccttcttctcg 14832053 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Plus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| || ||||||||||||||||||||| ||| ||||||||| Sbjct: 14840613 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttc 14840670 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| | |||||||||||| Sbjct: 14840451 gccgggcagcttctccttgatcttgtccatgaatcccttcttctcg 14840496 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| ||||||||||| ||||| | ||||||||||||| Sbjct: 14832008 gccgggaagcttttccttgatcttgtccatgaagcccttcttctcg 14832053 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 153 ccttgatcttctccatcatgc 173 ||||||||||||||||||||| Sbjct: 18784119 ccttgatcttctccatcatgc 18784099
>ref|NM_192219.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 687 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 127 tcagtggtggccg---ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 687 tcagtggtggccgtggccggggagcttctccttgatcttctccacgatgcccttcttctc 628 Query: 184 gtg 186 ||| Sbjct: 627 gtg 625 Score = 77.8 bits (39), Expect = 3e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtcccc 370 ||||||||||||||||||||||||| || |||||||||||||||| ||||| Sbjct: 668 gggagcttctccttgatcttctccacgatgcccttcttctcgtgcttcccc 618 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttct 182 ||||| |||||| ||||||||||| ||||||||| | |||| |||||||| Sbjct: 540 gtggctgccgggaagcttctcctttatcttctccttgatgctcttcttct 491 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||| ||||||||| ||| || |||||||| Sbjct: 527 agcttctcctttatcttctccttgatgctcttcttct 491
>gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-resistant protein mRNA, complete cds Length = 1021 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 127 tcagtggtggccg---ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 776 tcagtggtggccgtggccggggagcttctccttgatcttctccacgatgcccttcttctc 717 Query: 184 gtg 186 ||| Sbjct: 716 gtg 714 Score = 77.8 bits (39), Expect = 3e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtcccc 370 ||||||||||||||||||||||||| || |||||||||||||||| ||||| Sbjct: 757 gggagcttctccttgatcttctccacgatgcccttcttctcgtgcttcccc 707 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttct 182 ||||| |||||| ||||||||||| ||||||||| | |||| |||||||| Sbjct: 629 gtggctgccgggaagcttctcctttatcttctccttgatgctcttcttct 580 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||| ||||||||| ||| || |||||||| Sbjct: 616 agcttctcctttatcttctccttgatgctcttcttct 580
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 127 tcagtggtggccg---ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 29117654 tcagtggtggccgtggccggggagcttctccttgatcttctccacgatgcccttcttctc 29117595 Query: 184 gtg 186 ||| Sbjct: 29117594 gtg 29117592 Score = 77.8 bits (39), Expect = 3e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtcccc 370 ||||||||||||||||||||||||| || |||||||||||||||| ||||| Sbjct: 29117635 gggagcttctccttgatcttctccacgatgcccttcttctcgtgcttcccc 29117585 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttct 182 ||||| |||||| ||||||||||| ||||||||| | |||| |||||||| Sbjct: 29117507 gtggctgccgggaagcttctcctttatcttctccttgatgctcttcttct 29117458 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||| ||||||||| ||| || |||||||| Sbjct: 29117494 agcttctcctttatcttctccttgatgctcttcttct 29117458 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 264 ctccgtagccgccggtcgtcgccg 287 ||||| |||||||||||||||||| Sbjct: 38095492 ctccgcagccgccggtcgtcgccg 38095469
>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0421H07 Length = 158126 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 127 tcagtggtggccg---ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 78020 tcagtggtggccgtggccggggagcttctccttgatcttctccacgatgcccttcttctc 77961 Query: 184 gtg 186 ||| Sbjct: 77960 gtg 77958 Score = 77.8 bits (39), Expect = 3e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtcccc 370 ||||||||||||||||||||||||| || |||||||||||||||| ||||| Sbjct: 78001 gggagcttctccttgatcttctccacgatgcccttcttctcgtgcttcccc 77951 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttct 182 ||||| |||||| ||||||||||| ||||||||| | |||| |||||||| Sbjct: 77873 gtggctgccgggaagcttctcctttatcttctccttgatgctcttcttct 77824 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||| ||||||||| ||| || |||||||| Sbjct: 77860 agcttctcctttatcttctccttgatgctcttcttct 77824
>emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd27e Length = 751 Score = 81.8 bits (41), Expect = 2e-12 Identities = 47/49 (95%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 322 gtggccgccggggagcttctccttgatcttctctttcatgcccttcttc 274 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 291 tgtgcggcgggttgtccttgtgcccgccagggagcttctccttgatcttctc 342 ||||| || ||||||||||||| ||||| ||||||||||||||||||||||| Sbjct: 341 tgtgctgctggttgtccttgtggccgccggggagcttctccttgatcttctc 290 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| ||||| ||||||| |||||||||||| Sbjct: 489 agcttctccttaatcttgtccatgatccccttcttctcg 451 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||| ||||| ||||| || |||||||||||| Sbjct: 489 agcttctccttaatcttgtccatgatccccttcttctcg 451
>emb|X57327.1|OSRAB25 Rice rab25 mRNA Length = 920 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 127 tcagtggtggccg---ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 747 tcagtggtggccgtggccggggagcttctccttgatcttctccacgatgcccttcttctc 688 Query: 184 gtg 186 ||| Sbjct: 687 gtg 685 Score = 77.8 bits (39), Expect = 3e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtcccc 370 ||||||||||||||||||||||||| || |||||||||||||||| ||||| Sbjct: 728 gggagcttctccttgatcttctccacgatgcccttcttctcgtgcttcccc 678 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttct 182 ||||| |||||| ||||||||||| ||||||||| | |||| |||||||| Sbjct: 600 gtggctgccgggaagcttctcctttatcttctccttgatgctcttcttct 551 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||| ||||||||| ||| || |||||||| Sbjct: 587 agcttctcctttatcttctccttgatgctcttcttct 551
>dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-F09, full insert sequence Length = 761 Score = 81.8 bits (41), Expect = 2e-12 Identities = 58/63 (92%), Gaps = 3/63 (4%) Strand = Plus / Minus Query: 127 tcagtggtggccg---ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 568 tcagtggtggccgtggccggggagcttctccttgatcttctccacgatgcccttcttctc 509 Query: 184 gtg 186 ||| Sbjct: 508 gtg 506 Score = 77.8 bits (39), Expect = 3e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcgtgcgtcccc 370 ||||||||||||||||||||||||| || |||||||||||||||| ||||| Sbjct: 549 gggagcttctccttgatcttctccacgatgcccttcttctcgtgcttcccc 499 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttct 182 ||||| |||||| ||||||||||| ||||||||| | |||| |||||||| Sbjct: 421 gtggctgccgggaagcttctcctttatcttctccttgatgctcttcttct 372 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||| ||||||||| ||| || |||||||| Sbjct: 408 agcttctcctttatcttctccttgatgctcttcttct 372
>gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, complete cds Length = 1124 Score = 79.8 bits (40), Expect = 7e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttctt 180 |||||| ||||||||||||||||||||||||||| ||||||||||||| Sbjct: 366 gtggccaccggggagcttctccttgatcttctccttcatgcccttctt 319 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 767 gggagcttctccttgatcttgtccatgatgcccttcttctcg 726 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 767 gggagcttctccttgatcttgtccatgatgcccttcttctcg 726 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttctt 357 |||||||||||||||||||||||| | | ||||||||| Sbjct: 356 gggagcttctccttgatcttctccttcatgcccttctt 319
>emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene, rab Length = 781 Score = 79.8 bits (40), Expect = 7e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttctt 180 |||||| ||||||||||||||||||||||||||| ||||||||||||| Sbjct: 291 gtggccaccggggagcttctccttgatcttctccttcatgcccttctt 244 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 300 ggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttctt 357 ||||||||||||| || || |||||||||||||||||||||||| | | ||||||||| Sbjct: 301 ggttgtccttgtggccaccggggagcttctccttgatcttctccttcatgcccttctt 244 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 458 agcttctccttgatcttgtccatgatccccttcttctcg 420 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||| ||||| || |||||||||||| Sbjct: 458 agcttctccttgatcttgtccatgatccccttcttctcg 420
>emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd38 Length = 555 Score = 77.8 bits (39), Expect = 3e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| |||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 140 tggccaccggggagcttctccttgatgttctccatgatgcccttcttctcg 90 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 131 gggagcttctccttgatgttctccatgatgcccttcttctcg 90 Score = 40.1 bits (20), Expect = 5.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||||||||| | ||| ||||||| || ||||||||| Sbjct: 335 ccaggcagcttctccttcaccttgtccatgaggctcttcttctc 292
>emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd25a Length = 565 Score = 77.8 bits (39), Expect = 3e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| |||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 146 tggccaccggggagcttctccttgatgttctccatgatgcccttcttctcg 96 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 137 gggagcttctccttgatgttctccatgatgcccttcttctcg 96 Score = 40.1 bits (20), Expect = 5.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||||||||| | ||| ||||||| || ||||||||| Sbjct: 341 ccaggcagcttctccttcaccttgtccatgaggctcttcttctc 298
>gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, complete cds Length = 2440 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 1546 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 1501 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 1542 gggagcttctccttgatcttgtccatgatgcccttcttctcg 1501 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 1209 ccagggagcttctccttgatcttctccttgatgcccttcttc 1168 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 1216 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 1168
>gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 773 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 773 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 4-like (Dhn4) gene, partial sequence Length = 422 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 348 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 303 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 344 gggagcttctccttgatcttgtccatgatgcccttcttctcg 303
>gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 4 (Dhn4) gene, complete cds Length = 920 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 771 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 726 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 767 gggagcttctccttgatcttgtccatgatgcccttcttctcg 726 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 374 ccagggagcttctccttgatcttctccttgatgcccttcttc 333 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 381 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 333
>gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 4 (Dhn4) gene, complete cds Length = 924 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 773 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 773 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 772 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 727 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 768 gggagcttctccttgatcttgtccatgatgcccttcttctcg 727 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 375 ccagggagcttctccttgatcttctccttgatgcccttcttc 334 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 334
>gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 4 (Dhn4) gene, complete cds Length = 919 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 770 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 725 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 766 gggagcttctccttgatcttgtccatgatgcccttcttctcg 725 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 373 ccagggagcttctccttgatcttctccttgatgcccttcttc 332 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 380 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 332
>gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 4 (Dhn4) gene, complete cds Length = 910 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 761 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 716 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 757 gggagcttctccttgatcttgtccatgatgcccttcttctcg 716 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 379 ccagggagcttctccttgatcttctccttgatgcccttcttc 338 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 386 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 338
>gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 772 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 727 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 768 gggagcttctccttgatcttgtccatgatgcccttcttctcg 727 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 375 ccagggagcttctccttgatcttctccttgatgcccttcttc 334 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 334
>gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 773 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 773 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 758 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 773 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 758 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 772 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 727 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 768 gggagcttctccttgatcttgtccatgatgcccttcttctcg 727 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 375 ccagggagcttctccttgatcttctccttgatgcccttcttc 334 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 334
>gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 4 (Dhn4) gene, complete cds Length = 980 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 831 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 786 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 827 gggagcttctccttgatcttgtccatgatgcccttcttctcg 786 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 374 ccagggagcttctccttgatcttctccttgatgcccttcttc 333 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 381 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 333
>gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 758 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 4 (Dhn4) gene, complete cds Length = 904 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 755 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 710 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 751 gggagcttctccttgatcttgtccatgatgcccttcttctcg 710 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 373 ccagggagcttctccttgatcttctccttgatgcccttcttc 332 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 380 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 332
>gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 773 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 4 (Dhn4) gene, complete cds Length = 916 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 767 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 722 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 763 gggagcttctccttgatcttgtccatgatgcccttcttctcg 722 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 370 ccagggagcttctccttgatcttctccttgatgcccttcttc 329 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 377 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 329
>gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 4 (Dhn4) gene, complete cds Length = 906 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 757 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 712 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 753 gggagcttctccttgatcttgtccatgatgcccttcttctcg 712 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 375 ccagggagcttctccttgatcttctccttgatgcccttcttc 334 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 382 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 334
>gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 4 (Dhn4) gene, complete cds Length = 908 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 758 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 758 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 754 gggagcttctccttgatcttgtccatgatgcccttcttctcg 713 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 773 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 769 gggagcttctccttgatcttgtccatgatgcccttcttctcg 728 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 383 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 335
>gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, complete cds Length = 2790 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 2194 gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 2149 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 2190 gggagcttctccttgatcttgtccatgatgcccttcttctcg 2149 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 1737 ccagggagcttctccttgatcttctccttgatgcccttcttc 1696 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 1744 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 1696
>gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein WCOR80 (Wcor80) mRNA, complete cds Length = 465 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 131 tggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||| |||||||||||||||||||| |||||||| ||||| ||||||||| Sbjct: 127 tggtggccaccggggagcttctccttgatgttctccatgatgcctttcttctcg 74 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| |||||||||| ||| ||||||||| Sbjct: 115 gggagcttctccttgatgttctccatgatgcctttcttctcg 74 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||||||||||| ||| ||||||| || |||||||||| Sbjct: 319 ccaggcagcttctccttgaccttgtccatgaggctcttcttctcg 275
>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||| |||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||| |||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctc 360 |||||||||||||| ||||||||| | ||||||||||| Sbjct: 778 agcttctccttgatgttctccatggcacccttcttctc 741 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccat 168 |||||| ||||| |||||||||||||| |||||||| Sbjct: 791 gtggccaccgggaagcttctccttgatgttctccat 756 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| ||||||||||| |||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcg 740 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| |||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccgggaagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||| |||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1000 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 956 Score = 42.1 bits (21), Expect = 1.5 Identities = 39/45 (86%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||| | || |||||||||||| Sbjct: 400 ccagagagcttatccttgatgttctccgttacacccttcttctcg 356
>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1000 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 956 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5) gene, partial cds Length = 1061 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| ||||||||||| |||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcg 740 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| |||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccgggaagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||| |||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1006 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 962 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| ||||||||||| |||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcg 740 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| |||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccgggaagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||| |||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1000 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 956 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 73.8 bits (37), Expect = 4e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttctccttgatgttctccatgatgcccttcttctcg 155 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| ||||||||||| |||||||||||| Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcg 740 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| |||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccgggaagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||| |||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 54.0 bits (27), Expect = 4e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| ||||||||||| |||||||| |||||||| | |||||||||||| Sbjct: 406 tggccaccggggagcttttccttgatgttctccattacacccttcttctcg 356 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| |||||||| || |||||||||||| Sbjct: 397 gggagcttttccttgatgttctccattacacccttcttctcg 356 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1000 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 956
>emb|X62476.1|TARAB15B T.aestivum rab15B mRNA Length = 1068 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||||||||||||||||||||||||| | |||||||||||| Sbjct: 351 gtggccaccggggagcttctccttgatcttctccttgatgcccttcttc 303 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 752 gggagcttctccttgatcttgtccatgatgcccttcttctcg 711 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 752 gggagcttctccttgatcttgtccatgatgcccttcttctcg 711 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttc 358 |||||||||||||||||||||||| ||| |||||||||| Sbjct: 341 gggagcttctccttgatcttctccttgatgcccttcttc 303
>emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7 Length = 2138 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 1510 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 1463 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 1520 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 1463 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 1375 ccggggagcttctccttgatcttctccttcatccccttcttc 1334 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 1372 gggagcttctccttgatcttctcc 1349
>emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8) Length = 683 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 483 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 436 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 493 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 436 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 348 ccggggagcttctccttgatcttctccttcatccccttcttc 307 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 345 gggagcttctccttgatcttctcc 322
>emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin Length = 671 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 472 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 425 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 482 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 425 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 334 ccggggagcttctccttgatcttctccttcatccccttcttc 293 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 331 gggagcttctccttgatcttctcc 308
>gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, complete cds Length = 512 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 437 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 390 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 447 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 390 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 302 ccggggagcttctccttgatcttctccttcatccccttcttc 261 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 299 gggagcttctccttgatcttctcc 276
>gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 1 (Dhn1) gene, partial cds Length = 1446 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 1 (Dhn1) gene, partial cds Length = 1291 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 1 (Dhn1) gene, partial cds Length = 1202 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 1 (Dhn1) gene, partial cds Length = 1268 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 1 (Dhn1) gene, partial cds Length = 1330 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 438 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 495 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 438 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 350 ccggggagcttctccttgatcttctccttcatccccttcttc 309 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 347 gggagcttctccttgatcttctcc 324
>gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 1 (Dhn1) gene, partial cds Length = 1417 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 438 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 495 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 438 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 350 ccggggagcttctccttgatcttctccttcatccccttcttc 309 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 347 gggagcttctccttgatcttctcc 324
>gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 1 (Dhn1) gene, partial cds Length = 1428 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 485 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 438 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 495 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 438 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 350 ccggggagcttctccttgatcttctccttcatccccttcttc 309 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 347 gggagcttctccttgatcttctcc 324
>gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 1 (Dhn1) gene, partial cds Length = 1230 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 137 ccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 448 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 505 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 448 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 360 ccggggagcttctccttgatcttctccttcatccccttcttc 319 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 357 gggagcttctccttgatcttctcc 334
>gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 1 (Dhn1) gene, partial cds Length = 1243 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 495 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 448 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 505 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 448 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 360 ccggggagcttctccttgatcttctccttcatccccttcttc 319 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 357 gggagcttctccttgatcttctcc 334
>gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 1 (Dhn1) gene, partial cds Length = 1269 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 1 (Dhn1) gene, partial cds Length = 1249 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 501 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 356 ccggggagcttctccttgatcttctccttcatccccttcttc 315 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 353 gggagcttctccttgatcttctcc 330
>gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, complete cds Length = 2717 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| ||||||||||||||||||||| Sbjct: 1767 ccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 1720 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | ||||||||||||| Sbjct: 1777 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacgcccttcttctcg 1720 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| ||||||||| Sbjct: 1632 ccggggagcttctccttgatcttctccttcatccccttcttc 1591 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 1629 gggagcttctccttgatcttctcc 1606
>gb|AY425975.1| Streptocarpus primulifolius microsatellite B22 sequence Length = 646 Score = 69.9 bits (35), Expect = 6e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 126 ttcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||| |||||||| || | |||||||||||||| ||||||||||||||||||||| Sbjct: 422 ttcagtgctggccgcctggcaatttctccttgatcttatccatcatgcccttcttctcg 364 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Minus Query: 326 ttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| ||||| | ||||||||||||| Sbjct: 399 ttctccttgatcttatccatcatgcccttcttctcg 364 Score = 46.1 bits (23), Expect = 0.093 Identities = 41/47 (87%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttctt 180 |||||||| || || |||||||||||||| ||| |||| |||||||| Sbjct: 246 tggccgcctggtagtttctccttgatcttatccttcatccccttctt 200
>ref|NM_114958.2| Arabidopsis thaliana unknown protein AT3G50980 mRNA, complete cds Length = 589 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgg 187 |||||||| |||||||||||||||||||| |||||||||||| Sbjct: 426 agcttctctttgatcttctccatcatgcctttcttctcgtgg 385 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 |||||||| |||||||||||||| | ||| ||||||||||| Sbjct: 426 agcttctctttgatcttctccatcatgcctttcttctcgtg 386
>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0034E03 map near 50283S, complete sequence Length = 134074 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||| |||| ||||||||||||||| Sbjct: 82901 gccggggagcttctccttgatcttgtccacgatgcccttcttctcg 82856 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 82715 gccgccggggagcttctccttgatcttctccttgatccccttcttc 82670 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 75309 gccgccggggagcttctccttgatcttctccttgattcccttcttc 75264 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 60505 gccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 60460 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 60337 gccgccggggagcttctccttgatcttctccttgatccccttcttc 60292 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 60498 agcttctccttgatcttgtccatgatgcccttcttctcg 60460 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||| || ||||||||||||| Sbjct: 82897 gggagcttctccttgatcttgtccacgatgcccttcttctcg 82856 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 82727 gttgcccttgttgccgccggggagcttctccttgatcttctccttgatccccttcttc 82670 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 75321 gttgcccttgttgccgccggggagcttctccttgatcttctccttgattcccttcttc 75264 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||| ||||||||||||||||||||| | || ||||||||| Sbjct: 66872 gccgccgggcagcttctccttgatcttctccttgattcccttcttc 66827 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 60336 ccgccggggagcttctccttgatcttctccttgatccccttcttc 60292 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||||||||| ||||||| ||||||||||||| Sbjct: 75482 agcttttccttgatcttgtccatgaagcccttcttctcg 75444 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 67039 agcttctccttgatcttgtccatgaatcccttcttctcg 67001 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| ||||||||||| ||||| | ||||||||||||| Sbjct: 75489 gccgggaagcttttccttgatcttgtccatgaagcccttcttctcg 75444 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| | |||||||||||| Sbjct: 67046 gccgggcagcttctccttgatcttgtccatgaatcccttcttctcg 67001 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| || ||||||||||||||||||||| ||| ||||||||| Sbjct: 66884 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttc 66827
>emb|X64199.1|ATXERO A.thaliana XERO gene for dehydrin Length = 920 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgg 187 |||||||| |||||||||||||||||||| |||||||||||| Sbjct: 825 agcttctctttgatcttctccatcatgcctttcttctcgtgg 784 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 |||||||| |||||||||||||| | ||| ||||||||||| Sbjct: 825 agcttctctttgatcttctccatcatgcctttcttctcgtg 785
>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||| |||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||| |||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttatccttgatgttttccatgacgcccttcttctcg 548 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5) gene, partial cds Length = 1055 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 1000 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 956 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5) gene, partial cds Length = 1049 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| || ||||||||||||||||||||| Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||| |||||||| |||||||||| ||||||||||||| Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 791 gtggccaccggggagcttctccttgatgttctccatgacacccttcttctcg 740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| || ||||| | ||||||||||||| Sbjct: 599 gtggccaccggggagcttctccttgatgttttccatgacgcccttcttctcg 548 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| |||||||| |||||||| ||||||||||||||| Sbjct: 206 gtggccaccagggagcttgtccttgatgttctccatgatgcccttcttctcg 155 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 994 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 950 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| |||||| |||||||| |||||||| || |||||||||||| Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcg 356 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 145 gagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||| |||||||| | |||||||||||| Sbjct: 395 gagcttttccttgatgttctccattacacccttcttctcg 356
>emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F24M12 Length = 129516 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgg 187 |||||||| |||||||||||||||||||| |||||||||||| Sbjct: 2029 agcttctctttgatcttctccatcatgcctttcttctcgtgg 1988 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 |||||||| |||||||||||||| | ||| ||||||||||| Sbjct: 2029 agcttctctttgatcttctccatcatgcctttcttctcgtg 1989
>dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K14, full insert sequence Length = 709 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 434 gccgccggggagcttctccttgatcttctccttgatccccttcttc 389 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttct 182 |||||| ||||||||||||||||| ||||| ||||||||||||| Sbjct: 602 gccgggcagcttctccttgatcttgtccatgatgcccttcttct 559 Score = 58.0 bits (29), Expect = 2e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||||||||| ||||||| ||||||||||| Sbjct: 595 agcttctccttgatcttgtccatgatgcccttcttct 559 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 433 ccgccggggagcttctccttgatcttctccttgatccccttcttc 389
>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21 Length = 2537 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 2164 gccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 2119 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 1966 gccgccggggagcttctccttgatcttctccttgatccccttcttc 1921 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 2157 agcttctccttgatcttgtccatgatgcccttcttctcg 2119 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 1965 ccgccggggagcttctccttgatcttctccttgatccccttcttc 1921
>emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin Length = 1016 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||| ||||||||||||||||||| ||||||| ||||||||||||| Sbjct: 696 gccaaggagcttctccttgatcttgtccatgatgcccttcttctcg 651 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 359 ccagggagcttctccttgatcttctccttgatgcccttcttc 318 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 144 ggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 691 ggagcttctccttgatcttgtccatgatgcccttcttctcg 651 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 366 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 318
>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) Length = 1049 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||||||| ||| |||||||||| Sbjct: 346 ccagggagcttctccttgatcttctccttgatgcccttcttc 305 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 742 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 698 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||||||| | |||||||||||| Sbjct: 353 gtggccaccagggagcttctccttgatcttctccttgatgcccttcttc 305 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 736 agcttctccttgatcttgtccatgatgcccttcttctcg 698
>emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene) Length = 852 Score = 67.9 bits (34), Expect = 3e-08 Identities = 75/88 (85%), Gaps = 3/88 (3%) Strand = Plus / Minus Query: 271 gccgccggtcgtcgccgtggtgtgcggcgggttgtccttgtgcccgccagggagcttctc 330 |||||||||||||||||||| |||| | || ||||||||| || || || |||||||| Sbjct: 455 gccgccggtcgtcgccgtggcgtgctg---gtcgtccttgtggcctccgggcagcttctc 399 Query: 331 cttgatcttctccatgacgcccttcttc 358 ||||||||||||| ||| ||||||||| Sbjct: 398 cttgatcttctccttgattcccttcttc 371 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||| ||||||||||||||||||||| | || ||||||||| Sbjct: 419 gtggcctccgggcagcttctccttgatcttctccttgattcccttcttc 371
>emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene Length = 2459 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||| |||| ||||||||||||||| Sbjct: 1518 gccggggagcttctccttgatcttgtccacgatgcccttcttctcg 1473 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 1332 gccgccggggagcttctccttgatcttctccttgatccccttcttc 1287 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||| || ||||||||||||| Sbjct: 1514 gggagcttctccttgatcttgtccacgatgcccttcttctcg 1473 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 1344 gttgcccttgttgccgccggggagcttctccttgatcttctccttgatccccttcttc 1287
>emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene Length = 2493 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 1867 gccgccggggagcttctccttgatcttctccttgattcccttcttc 1822 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 1879 gttggccttgttgccgccggggagcttctccttgatcttctccttgattcccttcttc 1822 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||||||||| ||||||| ||||||||||||| Sbjct: 2040 agcttttccttgatcttgtccatgaagcccttcttctcg 2002 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| ||||||||||| ||||| | ||||||||||||| Sbjct: 2047 gccgggaagcttttccttgatcttgtccatgaagcccttcttctcg 2002
>dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-A09, full insert sequence Length = 852 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||||||| |||| ||||||||||||||| Sbjct: 552 gccggggagcttctccttgatcttgtccacgatgcccttcttctcg 507 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||||||||| |||| || ||||||||||||| Sbjct: 548 gggagcttctccttgatcttgtccacgatgcccttcttctcg 507 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 378 gttgcccttgttgccgcctgggagcttctccttgatcttctccttgatccccttcttc 321 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| |||||||||||||||||||||||| | || ||||||||| Sbjct: 366 gccgcctgggagcttctccttgatcttctccttgatccccttcttc 321
>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds Length = 864 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 573 gccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 528 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 566 agcttctccttgatcttgtccatgatgcccttcttctcg 528
>dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096D05, full insert sequence Length = 795 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||||||| | || ||||||||| Sbjct: 384 gccgccggggagcttctccttgatcttctccttgattcccttcttc 339 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| |||||||||||||||||||||||| ||| ||||||||| Sbjct: 396 gttgcccttgttgccgccggggagcttctccttgatcttctccttgattcccttcttc 339 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||||||||| ||||||| ||||||||||||| Sbjct: 557 agcttttccttgatcttgtccatgaagcccttcttctcg 519 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| ||||||||||| ||||| | ||||||||||||| Sbjct: 564 gccgggaagcttttccttgatcttgtccatgaagcccttcttctcg 519
>gb|U73213.1|TAU73213 Triticum aestivum cold acclimation protein WCOR726 (Wcor726) mRNA, complete cds Length = 667 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||| |||||||||||||||||| Sbjct: 263 gggagcttctccttgatgttctcgatgacgcccttcttctcg 222 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| ||||| || | ||||||||||||| Sbjct: 273 gtggccaccggggagcttctccttgatgttctcgatgacgcccttcttctcg 222 Score = 44.1 bits (22), Expect = 0.37 Identities = 37/42 (88%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||| |||| |||||| ||||||||| |||||| Sbjct: 128 gggagcttctccgtgatgctctccacgacgcccttgttctcg 87 Score = 40.1 bits (20), Expect = 5.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||| ||||||||||| ||||||| || ||| ||||| Sbjct: 428 ccaggcagcttgtccttgatcttgtccatgatgctcttgttctc 385 Score = 40.1 bits (20), Expect = 5.8 Identities = 44/52 (84%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||| |||| |||||| | |||||| |||||| Sbjct: 138 gtggccaccggggagcttctccgtgatgctctccacgacgcccttgttctcg 87
>gb|U19537.1|ATU19537 Arabidopsis thaliana dehydrin (Xero 1) gene, complete cds Length = 1698 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgg 187 |||||||| |||||||||||||||||||| |||||||||||| Sbjct: 1142 agcttctctttgatcttctccatcatgcctttcttctcgtgg 1101 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 |||||||| |||||||||||||| | ||| ||||||||||| Sbjct: 1142 agcttctctttgatcttctccatcatgcctttcttctcgtg 1102
>gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 634 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctc 183 |||||||||||||||||||||||||||||||| || |||||||| Sbjct: 406 gccggggagcttctccttgatcttctccatcacccctttcttctc 362 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctc 360 |||||||||||||||||||||||||| || || |||||||| Sbjct: 402 gggagcttctccttgatcttctccatcacccctttcttctc 362
>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) Length = 812 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 535 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 491 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 529 agcttctccttgatcttgtccatgatgcccttcttctcg 491 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||||||||||||||||||||| ||| | | |||||||||| Sbjct: 332 gtggccaccggggagcttctccttgatcttgtccttgaggcccttcttc 284 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttc 358 |||||||||||||||||||| ||| ||| |||||||||| Sbjct: 322 gggagcttctccttgatcttgtccttgaggcccttcttc 284
>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds Length = 1575 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 1350 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 1306 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 1344 agcttctccttgatcttgtccatgatgcccttcttctcg 1306 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||||||||||||||||||||| ||| | | |||||||||| Sbjct: 1147 gtggccaccggggagcttctccttgatcttgtccttgaggcccttcttc 1099 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttc 358 |||||||||||||||||||| ||| ||| |||||||||| Sbjct: 1137 gggagcttctccttgatcttgtccttgaggcccttcttc 1099
>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds Length = 1560 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| ||||||||||||||||| ||||| ||||||||||||||| Sbjct: 1313 ccgggcagcttctccttgatcttgtccatgatgcccttcttctcg 1269 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||||||||||||| Sbjct: 1307 agcttctccttgatcttgtccatgatgcccttcttctcg 1269 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||||||||||||||||||||| ||| | | |||||||||| Sbjct: 1110 gtggccaccggggagcttctccttgatcttgtccttgaggcccttcttc 1062 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttc 358 |||||||||||||||||||| ||| ||| |||||||||| Sbjct: 1100 gggagcttctccttgatcttgtccttgaggcccttcttc 1062
>emb|AJ622891.1| Triticum durum partial mRNA for DRP4 protein (drg4 gene) Length = 221 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 142 ggggagcttctccttgatcttctccatcatgcccttcttct 182 ||||||||||||||||||||||||| |||| |||||||||| Sbjct: 221 ggggagcttctccttgatcttctccttcattcccttcttct 181 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 220 gggagcttctccttgatcttctcc 197
>ref|NM_126038.2| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18) transcript variant AT5G66400.1 mRNA, complete cds Length = 864 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 ||||| ||||| ||||||||||| |||||||| ||||||||||||||| Sbjct: 637 ccgggaagcttttccttgatcttgtccatcatccccttcttctcgtgg 590 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| ||||||||||| ||||| | |||||||||||||| Sbjct: 631 agcttttccttgatcttgtccatcatccccttcttctcgtg 591
>ref|NM_001037085.1| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18) transcript variant AT5G66400.2 mRNA, complete cds Length = 881 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 ||||| ||||| ||||||||||| |||||||| ||||||||||||||| Sbjct: 634 ccgggaagcttttccttgatcttgtccatcatccccttcttctcgtgg 587 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| ||||||||||| ||||| | |||||||||||||| Sbjct: 628 agcttttccttgatcttgtccatcatccccttcttctcgtg 588
>gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB17-like gene, partial sequence Length = 4636 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgggtgccctc 195 ||||| ||||||||||||||||| ||||| ||||| ||||||||| ||||||||| Sbjct: 1501 ccgggcagcttctccttgatcttgtccatgatgcctttcttctcgccggtgccctc 1446 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 300 ggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||| || || || ||||||||||||||||||||| ||| ||||||||| Sbjct: 1368 ggttgtccttgtggcctccgggcagcttctccttgatcttctccttgattcccttcttc 1310 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||| ||||||||||||||||||||| | || ||||||||| Sbjct: 1358 gtggcctccgggcagcttctccttgatcttctccttgattcccttcttc 1310 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||| ||||||||| Sbjct: 1495 agcttctccttgatcttgtccatgatgcctttcttctcg 1457
>gb|AY607706.1| Quercus robur dehydrin 2 (Dhn2) mRNA, partial cds Length = 860 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 624 ccaggaagcttctccttgatcttctccatcactcccttcttctc 581 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||||||||||||||||| ||||||||||| Sbjct: 618 agcttctccttgatcttctccatcactcccttcttctc 581
>gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds Length = 853 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||| |||||||||||||||||||||||||| || |||||||| Sbjct: 536 ccgggcagcttctccttgatcttctccatcattcctttcttctc 493 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccat 345 ||||||||||||||||||||||| Sbjct: 530 agcttctccttgatcttctccat 508
>gb|DQ160121.1| Taraxacum officinale TO101-3 (To101-3) mRNA, partial cds Length = 322 Score = 63.9 bits (32), Expect = 4e-07 Identities = 35/36 (97%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccat 168 |||||||||||| ||||||||||||||||||||||| Sbjct: 219 gtggccgccgggaagcttctccttgatcttctccat 184 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 305 tccttgtgcccgccagggagcttctccttgatcttctccat 345 |||||||| ||||| || ||||||||||||||||||||||| Sbjct: 224 tccttgtggccgccgggaagcttctccttgatcttctccat 184
>gb|L04173.1|ATH18RAB Arabidopsis thaliana glycine rich protein (RAB18) gene, complete cds Length = 1676 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 ||||| ||||| ||||||||||| |||||||| ||||||||||||||| Sbjct: 1387 ccgggaagcttttccttgatcttgtccatcatccccttcttctcgtgg 1340 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| ||||||||||| ||||| | |||||||||||||| Sbjct: 1381 agcttttccttgatcttgtccatcatccccttcttctcgtg 1341
>emb|X83597.1|STDHN1 S.tuberosum dhn1 gene Length = 494 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 141 cggggagcttctccttgatcttctccatcatgcccttcttctcgtgggtgcc 192 ||||||||||||| |||||||||||||| || ||||||||||| || ||||| Sbjct: 494 cggggagcttctctttgatcttctccataattcccttcttctcatgagtgcc 443 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||||||||| |||||||||||||| | ||||||||||| Sbjct: 492 gggagcttctctttgatcttctccataattcccttcttctc 452
>gb|AY093779.1| Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds Length = 798 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 ||||| ||||| ||||||||||| |||||||| ||||||||||||||| Sbjct: 630 ccgggaagcttttccttgatcttgtccatcatccccttcttctcgtgg 583 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| ||||||||||| ||||| | |||||||||||||| Sbjct: 624 agcttttccttgatcttgtccatcatccccttcttctcgtg 584
>gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod60) mRNA, complete cds Length = 1921 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| |||||||||||||||||||||||||| || |||||||| Sbjct: 1745 ccaggaagcttctccttgatcttctccatgactcctttcttctc 1702 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccat 168 ||||||||||||||||||||||| Sbjct: 1739 agcttctccttgatcttctccat 1717
>gb|AF428458.1|AF428458 Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds Length = 861 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 ||||| ||||| ||||||||||| |||||||| ||||||||||||||| Sbjct: 637 ccgggaagcttttccttgatcttgtccatcatccccttcttctcgtgg 590 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| ||||||||||| ||||| | |||||||||||||| Sbjct: 631 agcttttccttgatcttgtccatcatccccttcttctcgtg 591
>gb|AY050416.1| Arabidopsis thaliana At1g11360/T23J18_35 mRNA, complete cds Length = 1018 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Plus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 ||||| ||||| ||||||||||| |||||||| ||||||||||||||| Sbjct: 229 ccgggaagcttttccttgatcttgtccatcatccccttcttctcgtgg 276 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Plus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| ||||||||||| ||||| | |||||||||||||| Sbjct: 235 agcttttccttgatcttgtccatcatccccttcttctcgtg 275
>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3) mRNA, complete cds Length = 793 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 473 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 430 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctc 360 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 467 agcttctccttgatcttgtccatgatgcccttcttctc 430 Score = 42.1 bits (21), Expect = 1.5 Identities = 42/49 (85%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || || ||||||||||||||||| ||| | || ||||||||| Sbjct: 309 gtggccacccggaagcttctccttgatcttatccttgattcccttcttc 261 Score = 40.1 bits (20), Expect = 5.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||| ||| ||| ||||||||| Sbjct: 296 agcttctccttgatcttatccttgattcccttcttc 261
>dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13 Length = 83511 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Plus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 ||||| ||||| ||||||||||| |||||||| ||||||||||||||| Sbjct: 7440 ccgggaagcttttccttgatcttgtccatcatccccttcttctcgtgg 7487 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Plus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| ||||||||||| ||||| | |||||||||||||| Sbjct: 7446 agcttttccttgatcttgtccatcatccccttcttctcgtg 7486
>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16 Length = 814 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 505 ccgggcagcttctccttgatcttgtccatgatgcccttcttctc 462 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctc 360 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 499 agcttctccttgatcttgtccatgatgcccttcttctc 462 Score = 44.1 bits (22), Expect = 0.37 Identities = 43/50 (86%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttct 182 |||||| || || |||||||| |||||||| ||| | ||||||||||||| Sbjct: 341 gtggccacccggaagcttctctttgatcttatccttgatgcccttcttct 292 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 |||||||| |||||||| ||| ||| ||||||||||| Sbjct: 328 agcttctctttgatcttatccttgatgcccttcttct 292
>emb|X15994.1|ZMRAB17G Maize RAB-17 gene Length = 1986 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgggtgccctc 195 ||||| ||||||||||||||||| ||||| ||||| ||||||||| ||||||||| Sbjct: 1287 ccgggcagcttctccttgatcttgtccataatgcctttcttctcgccggtgccctc 1232 Score = 60.0 bits (30), Expect = 6e-06 Identities = 74/88 (84%), Gaps = 3/88 (3%) Strand = Plus / Minus Query: 271 gccgccggtcgtcgccgtggtgtgcggcgggttgtccttgtgcccgccagggagcttctc 330 |||||||||||||||||||| |||| | || ||||||||| || || || |||||||| Sbjct: 1153 gccgccggtcgtcgccgtggcgtgctg---gtcgtccttgtggcctccgggcagcttctc 1097 Query: 331 cttgatcttctccatgacgcccttcttc 358 |||||||||||| ||| ||||||||| Sbjct: 1096 tttgatcttctccttgattcccttcttc 1069 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||| |||||||| |||||||||||| | || ||||||||| Sbjct: 1117 gtggcctccgggcagcttctctttgatcttctccttgattcccttcttc 1069 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||| | ||| ||||||||| Sbjct: 1281 agcttctccttgatcttgtccataatgcctttcttctcg 1243
>emb|X68042.1|ATRAB18A A.thaliana rab18 gene Length = 1528 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 ||||| ||||| ||||||||||| |||||||| ||||||||||||||| Sbjct: 1243 ccgggaagcttttccttgatcttgtccatcatccccttcttctcgtgg 1196 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| ||||||||||| ||||| | |||||||||||||| Sbjct: 1237 agcttttccttgatcttgtccatcatccccttcttctcgtg 1197
>emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9) Length = 683 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| |||||||| |||||||||||| Sbjct: 477 ccgccgggaagcttctccttgatcttgtccatgacacccttcttctcg 430 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | |||||||||||| Sbjct: 487 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacacccttcttctcg 430 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| || |||||| Sbjct: 339 ccggggagcttctccttgatcttctccttcatccctttcttc 298 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 336 gggagcttctccttgatcttctcc 313
>gb|BT002226.1| Arabidopsis thaliana At5g66400/K1F13_5 mRNA, complete cds Length = 561 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 ||||| ||||| ||||||||||| |||||||| ||||||||||||||| Sbjct: 548 ccgggaagcttttccttgatcttgtccatcatccccttcttctcgtgg 501 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| ||||||||||| ||||| | |||||||||||||| Sbjct: 542 agcttttccttgatcttgtccatcatccccttcttctcgtg 502
>gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, complete cds Length = 1294 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| |||||||| |||||||||||| Sbjct: 1170 ccgccgggaagcttctccttgatcttgtccatgacacccttcttctcg 1123 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | |||||||||||| Sbjct: 1180 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacacccttcttctcg 1123 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| || |||||| Sbjct: 1032 ccggggagcttctccttgatcttctccttcatccctttcttc 991 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 1029 gggagcttctccttgatcttctcc 1006
>gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, complete cds Length = 1849 Score = 63.9 bits (32), Expect = 4e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| || ||||||||||||||||| |||||||| |||||||||||| Sbjct: 1178 ccgccgggaagcttctccttgatcttgtccatgacacccttcttctcg 1131 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 127 tcagtggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| || |||||||| ||||||||||||||||| ||||| | |||||||||||| Sbjct: 1188 tcagtgctgtccgccgggaagcttctccttgatcttgtccatgacacccttcttctcg 1131 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| |||| || |||||| Sbjct: 1040 ccggggagcttctccttgatcttctccttcatccctttcttc 999 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcc 343 |||||||||||||||||||||||| Sbjct: 1037 gggagcttctccttgatcttctcc 1014
>gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, partial cds Length = 549 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcgtgggtgccctc 195 ||||| ||||||||||||||||| ||||| ||||| ||||||||| ||||||||| Sbjct: 312 ccgggcagcttctccttgatcttgtccatgatgcctttcttctcgccggtgccctc 257 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 300 ggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||| || || || ||||||||||||||||||||| ||| ||||||||| Sbjct: 182 ggttgtccttgtggcctccgggcagcttctccttgatcttctccttgattcccttcttc 124 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||| ||||||||||||||||||||| | || ||||||||| Sbjct: 172 gtggcctccgggcagcttctccttgatcttctccttgattcccttcttc 124 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| ||| ||||||||| Sbjct: 306 agcttctccttgatcttgtccatgatgcctttcttctcg 268
>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| ||||||||||| |||||||||||| Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcg 131 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| |||||||||||||| |||||||| | |||||||||||| Sbjct: 182 gtggccaccgggaagcttctccttgatgttctccatgacacccttcttctcg 131 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 391 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 347
>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| ||||||||||| |||||||||||| Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcg 131 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| |||||||||||||| |||||||| | |||||||||||| Sbjct: 182 gtggccaccgggaagcttctccttgatgttctccatgacacccttcttctcg 131 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 391 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 347
>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| ||||||||||| |||||||||||| Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcg 131 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| |||||||||||||| |||||||| | |||||||||||| Sbjct: 182 gtggccaccgggaagcttctccttgatgttctccatgacacccttcttctcg 131 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 391 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 347
>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5) gene, partial cds Length = 446 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||||| ||||||||||| |||||||||||| Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcg 131 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||| |||||||||||||| |||||||| | |||||||||||| Sbjct: 182 gtggccaccgggaagcttctccttgatgttctccatgacacccttcttctcg 131 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||| ||||| ||||||||||| ||||||| || |||||||||| Sbjct: 391 ccaggcagcttgtccttgatcttgtccatgaggctcttcttctcg 347
>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence Length = 1130 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctc 183 |||||||||||| ||||||||||||||||| ||||| | ||| |||||||| Sbjct: 637 gtggccgccgggcagcttctccttgatcttttccatgaagcctttcttctc 587 Score = 60.0 bits (30), Expect = 6e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 307 cttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctc 360 |||||| ||||| || ||||||||||||||||| ||||||| ||| |||||||| Sbjct: 640 cttgtggccgccgggcagcttctccttgatcttttccatgaagcctttcttctc 587
>gb|AY105067.1| Zea mays PCO081051 mRNA sequence Length = 1398 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctc 183 |||||| ||||||||||||||||||||||| |||| || ||| |||||||| Sbjct: 771 gtggccaccggggagcttctccttgatcttgtccagcaggcctttcttctc 721 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctcca 344 |||||||||||||||||||| |||| Sbjct: 761 gggagcttctccttgatcttgtcca 737 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||||| ||||||| ||| |||| |||||| Sbjct: 509 agcttctccttgagcttctccttgaggcccatcttct 473
>gb|M81791.1|COTLEA3C Gossypium hirsutum DNA fragment Length = 209 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||||||||||||||||||||| ||||| || || ||||||||||| Sbjct: 109 ccagggagcttctccttgatcttgtccatcactcctttcttctcgtg 63 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 |||||||||||||||||||| ||||||| || |||||||||||| Sbjct: 106 gggagcttctccttgatcttgtccatcactcctttcttctcgtgg 62
>gb|M81655.1|COTLEA3B Gossypium hirsutum dehydrin (Lea3-D147) gene, complete cds Length = 531 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||||||||||||||||||||| ||||| || || ||||||||||| Sbjct: 399 ccagggagcttctccttgatcttatccatcactcctttcttctcgtg 353 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcgtgg 187 |||||||||||||||||||| ||||||| || |||||||||||| Sbjct: 396 gggagcttctccttgatcttatccatcactcctttcttctcgtgg 352
>gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, complete cds Length = 616 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||||||||||||||||||||| | ||||| |||||| Sbjct: 338 ccggggagcttctccttgatcttctccttgatgcctttcttc 297 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttc 358 |||||||||||||||||||||||| ||| ||| |||||| Sbjct: 335 gggagcttctccttgatcttctccttgatgcctttcttc 297 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctc 360 ||||||||||||||||| ||||||| ||||||||||| Sbjct: 485 agcttctccttgatcttgtccatgagtcccttcttctc 448 Score = 48.1 bits (24), Expect = 0.024 Identities = 39/44 (88%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||| ||||||||||||||||| ||||| | ||||||||||| Sbjct: 491 ccgggaagcttctccttgatcttgtccatgagtcccttcttctc 448
>emb|X83596.1|SCDHN1 S.commersonii dhn1 gene Length = 493 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 142 ggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||| ||||||||||||||||| || ||||||||||| Sbjct: 493 ggggagcttttccttgatcttctccataattcccttcttctc 452 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctc 360 |||||||| ||||||||||||||||| | ||||||||||| Sbjct: 492 gggagcttttccttgatcttctccataattcccttcttctc 452
>emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene for dessication-related protein Length = 1742 Score = 60.0 bits (30), Expect = 6e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||| |||||||| |||||||| ||||| |||||||| ||||| Sbjct: 1529 tggccgccgggaagcttctctttgatcttgtccatgatgccctttttctc 1480 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttctt 180 ||||||||||| ||||||||||| ||||| ||| |||| |||||||| Sbjct: 1415 tggccgccgggaagcttctccttcatcttgtccttcatccccttctt 1369
>gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, complete cds Length = 483 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||||| ||| ||| |||||||||| Sbjct: 266 ccagggagcttctccttgatcttatccttgatgcccttcttc 225 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || |||||||||||||||||||| ||| | |||||||||||| Sbjct: 273 gtggccaccagggagcttctccttgatcttatccttgatgcccttcttc 225 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttctt 180 ||||| ||||| ||||||||||| ||||| ||||||||||| Sbjct: 473 ccgggcagcttttccttgatcttgtccatgatgcccttctt 433 Score = 46.1 bits (23), Expect = 0.093 Identities = 32/35 (91%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttctt 357 ||||| ||||||||||| ||||||| ||||||||| Sbjct: 467 agcttttccttgatcttgtccatgatgcccttctt 433
>gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-related protein mRNA, complete cds Length = 741 Score = 60.0 bits (30), Expect = 6e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||| |||||||| |||||||| ||||| |||||||| ||||| Sbjct: 528 tggccgccgggaagcttctctttgatcttgtccatgatgccctttttctc 479 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 134 tggccgccggggagcttctccttgatcttctccatcatgcccttctt 180 ||||||||||| ||||||||||| ||||| ||| |||| |||||||| Sbjct: 414 tggccgccgggaagcttctccttcatcttgtccttcatccccttctt 368
>gb|AF031250.1|AF031250 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-5) mRNA, complete cds Length = 697 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||| | |||||||||||||||| Sbjct: 243 gggagcttctccttgatgttctcgacgacgcccttcttctcg 202 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| |||||||||||||||||||| ||||| | | ||||||||||||| Sbjct: 253 gtggccaccggggagcttctccttgatgttctcgacgacgcccttcttctcg 202 Score = 44.1 bits (22), Expect = 0.37 Identities = 37/42 (88%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||| |||| |||||| ||||||||| |||||| Sbjct: 111 gggagcttctccgtgatgctctccacgacgcccttgttctcg 70 Score = 40.1 bits (20), Expect = 5.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||| ||||||||||| ||||||| || ||| ||||| Sbjct: 408 ccaggcagcttgtccttgatcttgtccatgatgctcttgttctc 365 Score = 40.1 bits (20), Expect = 5.8 Identities = 44/52 (84%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||| |||| |||||| | |||||| |||||| Sbjct: 121 gtggccaccggggagcttctccgtgatgctctccacgacgcccttgttctcg 70
>gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-like protein mRNA, complete cds Length = 775 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||||||||| |||||||| ||||||||||| Sbjct: 462 agcttctccttgatcttttccatcatccccttcttctc 425 Score = 44.1 bits (22), Expect = 0.37 Identities = 34/38 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctc 360 ||||||||||||||||| ||||| | ||||||||||| Sbjct: 462 agcttctccttgatcttttccatcatccccttcttctc 425 Score = 44.1 bits (22), Expect = 0.37 Identities = 40/46 (86%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| || ||||||||||| ||||||||| ||| ||||||||| Sbjct: 379 gccgcccggaagcttctcctttatcttctccttcagtcccttcttc 334
>emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene Length = 2890 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||| ||||||||||||||||||||| | || ||||||||| Sbjct: 1802 gccgccgggcagcttctccttgatcttctccttgatccccttcttc 1757 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 1969 agcttctccttgatcttgtccatgaatcccttcttctcg 1931 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| | |||||||||||| Sbjct: 1976 gccgggcagcttctccttgatcttgtccatgaatcccttcttctcg 1931 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| || ||||||||||||||||||||| ||| ||||||||| Sbjct: 1814 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgatccccttcttc 1757
>gb|AF181460.1|AF181460 Hordeum vulgare dehydrin (Dhn10) gene, complete cds Length = 2501 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||| ||||||||||||||||||||| | |||||||||||| Sbjct: 1267 ccgggaagcttctccttgatcttctccttgatgcccttcttc 1226 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||| ||| |||||||||| Sbjct: 1261 agcttctccttgatcttctccttgatgcccttcttc 1226 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| ||||||||||| ||||| || |||||||||||| Sbjct: 1882 agcttttccttgatcttgtccataatacccttcttctcg 1844 Score = 46.1 bits (23), Expect = 0.093 Identities = 32/35 (91%) Strand = Plus / Minus Query: 149 ttctccttgatcttctccatcatgcccttcttctc 183 |||||| ||||||| ||| |||||||||||||||| Sbjct: 1561 ttctccatgatcttgtccttcatgcccttcttctc 1527 Score = 44.1 bits (22), Expect = 0.37 Identities = 40/46 (86%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||| ||||| ||||||||||| ||||| | |||||||||||| Sbjct: 1889 gccaggcagcttttccttgatcttgtccataatacccttcttctcg 1844
>dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H03, full insert sequence Length = 872 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 136 gccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||||||| ||||||||||||||||||||| | || ||||||||| Sbjct: 447 gccgccgggcagcttctccttgatcttctccttgattcccttcttc 402 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| ||||||| |||||||||||| Sbjct: 614 agcttctccttgatcttgtccatgaatcccttcttctcg 576 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||| ||||||||||||||||| ||||| | |||||||||||| Sbjct: 621 gccgggcagcttctccttgatcttgtccatgaatcccttcttctcg 576 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 301 gttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttc 358 |||| |||||| ||||| || ||||||||||||||||||||| ||| ||||||||| Sbjct: 459 gttgcccttgttgccgccgggcagcttctccttgatcttctccttgattcccttcttc 402
>gb|AY104757.1| Zea mays PCO142314 mRNA sequence Length = 899 Score = 60.0 bits (30), Expect = 6e-06 Identities = 74/88 (84%), Gaps = 3/88 (3%) Strand = Plus / Minus Query: 271 gccgccggtcgtcgccgtggtgtgcggcgggttgtccttgtgcccgccagggagcttctc 330 |||||||||||||||||||| |||| | || ||||||||| || || || |||||||| Sbjct: 452 gccgccggtcgtcgccgtggcgtgctg---gtcgtccttgtggcctccgggcagcttctc 396 Query: 331 cttgatcttctccatgacgcccttcttc 358 |||||||||||| ||| ||||||||| Sbjct: 395 tttgatcttctccttgattcccttcttc 368 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||| |||||||| |||||||||||| | || ||||||||| Sbjct: 416 gtggcctccgggcagcttctctttgatcttctccttgattcccttcttc 368
>gb|AF043095.1|AF043095 Hordeum vulgare dehydrin 10 (dhn10) gene, complete cds Length = 2984 Score = 60.0 bits (30), Expect = 6e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttc 181 ||||| ||||||||||||||||||||| | |||||||||||| Sbjct: 1665 ccgggaagcttctccttgatcttctccttgatgcccttcttc 1624 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttc 358 ||||||||||||||||||||| ||| |||||||||| Sbjct: 1659 agcttctccttgatcttctccttgatgcccttcttc 1624 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| ||||||||||| ||||| || |||||||||||| Sbjct: 2280 agcttttccttgatcttgtccataatacccttcttctcg 2242 Score = 46.1 bits (23), Expect = 0.093 Identities = 32/35 (91%) Strand = Plus / Minus Query: 149 ttctccttgatcttctccatcatgcccttcttctc 183 |||||| ||||||| ||| |||||||||||||||| Sbjct: 1959 ttctccatgatcttgtccttcatgcccttcttctc 1925 Score = 44.1 bits (22), Expect = 0.37 Identities = 40/46 (86%) Strand = Plus / Minus Query: 316 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||| ||||| ||||||||||| ||||| | |||||||||||| Sbjct: 2287 gccaggcagcttttccttgatcttgtccataatacccttcttctcg 2242
>gb|AF044584.1|AF044584 Lavatera thuringiaca cold regulated LTCOR18 (LtCor18) mRNA, complete cds Length = 759 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||||||||||||||||| || ||||||||||| Sbjct: 502 agcttctccttgatcttctccataatacccttcttctc 465 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||||||||||||||||||||| | ||||||||||| Sbjct: 508 ccaggaagcttctccttgatcttctccataatacccttcttctc 465 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttctt 357 ||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 364 ccaggcagtttctctttgatcttctccatgacacccttctt 324
>dbj|AB010898.1| Daucus carota mRNA for ecpp44, complete cds Length = 925 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 137 ccgccggggagcttctccttgatcttctccatcatgcccttcttct 182 ||||| || ||||||||||||||||||||||| | ||||||||||| Sbjct: 544 ccgcctggcagcttctccttgatcttctccataaagcccttcttct 499 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 314 ccgccagggagcttctccttgatcttctccatgacgcccttcttct 359 ||||| || ||||||||||||||||||||||| | ||||||||||| Sbjct: 544 ccgcctggcagcttctccttgatcttctccataaagcccttcttct 499
>gb|AY303803.1| Brassica napus cultivar Q2 dehydrin (DHN1) mRNA, complete cds Length = 552 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||| ||||||||||||||||| | |||||||||||||| Sbjct: 531 gccggggagtttctccttgatcttctcgagaatgcccttcttctc 487 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||||||||||||||| | | |||||||||||| Sbjct: 527 gggagtttctccttgatcttctcgagaatgcccttcttctc 487
>emb|X56280.1|RSLEAPR R.sativus mRNA for late embryogenesis abundant (LEA) protein Length = 744 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||| ||||||||||||||||| | |||||||||||||| Sbjct: 545 gccggggagtttctccttgatcttctcgagaatgcccttcttctc 501 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||||||||||||||| | | |||||||||||| Sbjct: 541 gggagtttctccttgatcttctcgagaatgcccttcttctc 501
>emb|X13204.1|GHLEA11 Cotton set 5B Lea gene for seed protein D-11 Length = 970 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||||||||| ||||| || || ||||||||| Sbjct: 839 ccagggagcttctccttgatcttgtccatcactcctttcttctcg 795 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||||| || ||||||||| Sbjct: 836 gggagcttctccttgatcttgtccatcactcctttcttctcg 795
>gb|AY130999.1| Brassica juncea dehydrin (DHN1) gene, complete cds Length = 1293 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||| ||||||||||||||||| | |||||||||||||| Sbjct: 910 gccggggagtttctccttgatcttctcgagaatgcccttcttctc 866 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||||||||||||||| | | |||||||||||| Sbjct: 906 gggagtttctccttgatcttctcgagaatgcccttcttctc 866
>gb|AY130998.1| Brassica juncea dehydrin (DHN1) mRNA, complete cds Length = 552 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||||||| ||||||||||||||||| | |||||||||||||| Sbjct: 531 gccggggagtttctccttgatcttctcgagaatgcccttcttctc 487 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctc 360 ||||| ||||||||||||||||| | | |||||||||||| Sbjct: 527 gggagtttctccttgatcttctcgagaatgcccttcttctc 487
>gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 7 (Dhn7) gene, complete cds Length = 1357 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttc 181 |||||| ||||||||||||||||||||||| ||| | || ||||||||| Sbjct: 583 gtggccaccggggagcttctccttgatcttatccttgatacccttcttc 535 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttctt 180 ||||| |||||||||||||| || ||||| ||||||||||| Sbjct: 828 ccgggcagcttctccttgattttgtccatgatgcccttctt 788 Score = 46.1 bits (23), Expect = 0.093 Identities = 32/35 (91%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttctt 357 |||||||||||||| || ||||||| ||||||||| Sbjct: 822 agcttctccttgattttgtccatgatgcccttctt 788 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttc 358 |||||||||||||||||||| ||| ||| ||||||||| Sbjct: 573 gggagcttctccttgatcttatccttgatacccttcttc 535
>gb|M19379.1|COTSPE G.hirsutum (cotton) storage protein (late embryogenesis abundant) mRNA, partial cds, clone D11 Length = 435 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||||||||| ||||| || || ||||||||| Sbjct: 390 ccagggagcttctccttgatcttgtccatcactcctttcttctcg 346 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||||| || ||||||||| Sbjct: 387 gggagcttctccttgatcttgtccatcactcctttcttctcg 346
>gb|M81654.1|COTLEA3A Gossypium hirsutum dehydrin (Lea3-D11) gene, complete cds Length = 531 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||||||||| ||||| || || ||||||||| Sbjct: 401 ccagggagcttctccttgatcttgtccatcactcctttcttctcg 357 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 143 gggagcttctccttgatcttctccatcatgcccttcttctcg 184 |||||||||||||||||||| ||||||| || ||||||||| Sbjct: 398 gggagcttctccttgatcttgtccatcactcctttcttctcg 357
>gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, complete cds Length = 697 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 132 ggtggccgccggggagcttctccttgatcttctccatcatgcccttcttctc 183 |||||||||| || || ||||||||||| || |||||||| ||||||||||| Sbjct: 475 ggtggccgccaggcagtttctccttgattttgtccatcatccccttcttctc 424 Score = 48.1 bits (24), Expect = 0.024 Identities = 42/48 (87%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttctt 180 |||||||||||| ||||||||||||| ||| ||| | || |||||||| Sbjct: 360 gtggccgccgggtagcttctccttgaccttgtccttgatccccttctt 313 Score = 44.1 bits (22), Expect = 0.37 Identities = 49/58 (84%) Strand = Plus / Minus Query: 300 ggttgtccttgtgcccgccagggagcttctccttgatcttctccatgacgcccttctt 357 ||||||| ||||| ||||| || ||||||||||||| ||| ||| ||| |||||||| Sbjct: 370 ggttgtctttgtggccgccgggtagcttctccttgaccttgtccttgatccccttctt 313
>emb|AJ249273.1|HAN249273 Helianthus annuus partial dhn1wt1 gene for putative dehydrin, exons 1-2 Length = 1002 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 852 agcttttctttgatcttctccatcatccctttcttctcgtgggt 809
>gb|AY088292.1| Arabidopsis thaliana clone 5256 mRNA, complete sequence Length = 833 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctccatcatgcccttcttctcgtg 186 |||||| ||||| |||||||||||||| | ||||||||||||||||| Sbjct: 619 gccgggaagcttgtccttgatcttctcgagaatgcccttcttctcgtg 572 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcgtg 363 ||||| |||||||||||||| | | ||||||||||||||| Sbjct: 612 agcttgtccttgatcttctcgagaatgcccttcttctcgtg 572
>emb|AJ438980.1|HAN438980 Helianthus annuus partial dhn1f gene for putative dehydrin, exons 1-2 Length = 1081 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 911 agcttttctttgatcttctccatcatccctttcttctcgtgggt 868
>emb|AJ438979.1|HAN438979 Helianthus annuus partial dhn1wt7 gene for putative dehydrin, exons 1-2 Length = 1081 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 909 agcttttctttgatcttctccatcatccctttcttctcgtgggt 866
>emb|AJ300525.4|PEU300525 Populus euramericana mRNA for putative dehydrin (dhn2 gene) Length = 2165 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgccctt 177 |||||||||||||||||||||||||| ||||| Sbjct: 1918 agcttctccttgatcttctccatcattccctt 1887 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccat 345 ||||| ||||||||||||||||||||||| Sbjct: 1924 ccaggaagcttctccttgatcttctccat 1896
>emb|AJ250227.1|HAN250227 Helianthus annuus partial dhn1wt5 gene for putative dehydrin, exons 1-2 Length = 1068 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 905 agcttttctttgatcttctccatcatccctttcttctcgtgggt 862
>emb|AJ250226.1|HAN250226 Helianthus annuus partial dhn1wt4 gene for putative dehydrin, exons 1-2 Length = 1076 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 906 agcttttctttgatcttctccatcatccctttcttctcgtgggt 863
>emb|AJ250225.1|HAN250225 Helianthus annuus partial dhn1wt3 gene for putative dehydrin, exons 1-2 Length = 1028 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 851 agcttttctttgatcttctccatcatccctttcttctcgtgggt 808
>emb|AJ250224.1|HAN250224 Helianthus annuus partial dhn1wt2 gene for putative dehydrin, exons 1-2 Length = 1086 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 914 agcttttctttgatcttctccatcatccctttcttctcgtgggt 871
>emb|AJ250153.1|HPR250153 Helianthus praecox partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1032 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 852 agcttttctttgatcttctccatcatccctttcttctcgtgggt 809
>emb|AJ250152.1|HPE250152 Helianthus petiolaris ssp. petiolaris partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1009 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 836 agcttttctttgatcttctccatcatccctttcttctcgtgggt 793
>emb|AJ250151.1|HPE250151 Helianthus petiolaris ssp. fallax partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1003 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 828 agcttttctttgatcttctccatcatccctttcttctcgtgggt 785
>emb|AJ250150.1|HNE250150 Helianthus neglectus partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1027 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 851 agcttttctttgatcttctccatcatccctttcttctcgtgggt 808
>emb|AJ250149.1|HMA250149 Helianthus maximiliani partial dhn1 gene for putative dehyidrin, exons 1-2 Length = 981 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 804 agcttttctttgatcttctccatcatccctttcttctcgtgggt 761
>emb|AJ250148.1|HTU250148 Helianthus tuberosus partial dhn1 gene for putative dehydrin, exons 1-2 Length = 998 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 836 agcttttctttgatcttctccatcatccctttcttctcgtgggt 793
>emb|X92647.1|HADEHY H.annuus mRNA for homologous dehydrin Length = 1043 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 815 agcttttctttgatcttctccatcatccctttcttctcgtgggt 772
>emb|AJ250147.1|HNI250147 Helianthus niveus partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1030 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 855 agcttttctttgatcttctccatcatccctttcttctcgtgggt 812
>emb|AJ250146.1|HMO250146 Helianthus mollis partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1020 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 843 agcttttctttgatcttctccatcatccctttcttctcgtgggt 800
>emb|AJ250145.1|HHI250145 Helianthus hirsutus partial dhn1 gene for putative dehydrin, exons 1-2 Length = 998 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 836 agcttttctttgatcttctccatcatccctttcttctcgtgggt 793
>emb|AJ250126.1|HPR250126 Helianthus praecox partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1027 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 852 agcttttctttgatcttctccatcatccctttcttctcgtgggt 809
>emb|AJ250125.1|HPR250125 Helianthus praecox partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1027 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 852 agcttttctttgatcttctccatcatccctttcttctcgtgggt 809
>emb|AJ249710.1|HDE249710 Helianthus debilis partial sDhn1 gene for putative dehydrin, exons 1-2 subsp. silvestris Length = 1020 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 843 agcttttctttgatcttctccatcatccctttcttctcgtgggt 800
>emb|AJ249709.1|HDE249709 Helianthus debilis partial dDhn1 gene for putative dehydrin, exons 1-2 subsp. debilis Length = 1033 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 853 agcttttctttgatcttctccatcatccctttcttctcgtgggt 810
>emb|AJ249708.1|HDE249708 Helianthus debilis partial cDhn1 gene for putative dehydrin, exons 1-2 subsp. cucumerifolius Length = 1017 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 838 agcttttctttgatcttctccatcatccctttcttctcgtgggt 795
>emb|AJ249272.1|HAN249272 Helianthus annuus partial dhn1e gene for putative dehydrin, exons 1-2 Length = 1039 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 891 agcttttctttgatcttctccatcatccctttcttctcgtgggt 848
>emb|AJ249271.1|HAN249271 Helianthus annuus partial dhn1d gene for putative dehydrin, exons 1-2 Length = 1039 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 891 agcttttctttgatcttctccatcatccctttcttctcgtgggt 848
>emb|AJ249270.1|HAN249270 Helianthus annuus partial dhn1c gene for putative dehydrin, exons 1-2 Length = 1042 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 894 agcttttctttgatcttctccatcatccctttcttctcgtgggt 851
>emb|AJ249269.1|HAN249269 Helianthus annuus partial dhn1b gene for putative dehydrin, exons 1-2 Length = 1042 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 894 agcttttctttgatcttctccatcatccctttcttctcgtgggt 851
>emb|AJ010944.1|HAN010944 Helianthus annuus mRNA for dehydrin-like protein, partial Length = 892 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 744 agcttttctttgatcttctccatcatccctttcttctcgtgggt 701
>emb|AJ002741.1|HAAJ2741 Helianthus annuus gene encoding dehydrin-like protein, partial Length = 1081 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 911 agcttttctttgatcttctccatcatccctttcttctcgtgggt 868
>emb|AJ297737.1|HCI297737 Helianthus ciliaris partial dhn1 gene for putative dehydrin, exons 1-2 Length = 931 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctcgtgggt 189 ||||| || ||||||||||||||||| || |||||||||||||| Sbjct: 781 agcttttctttgatcttctccatcatccctttcttctcgtgggt 738
>gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene, complete cds Length = 2890 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttct 179 ||||||||||||||||||| ||||||| ||| |||||||| Sbjct: 1726 ccggggagcttctccttgaccttctccttcacgcccttct 1687 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 311 tgcccgccagggagcttctccttgatcttctccatgacgcccttct 356 ||||| || |||||||||||||||| ||||||| | |||||||||| Sbjct: 1732 tgcccaccggggagcttctccttgaccttctccttcacgcccttct 1687 Score = 46.1 bits (23), Expect = 0.093 Identities = 35/39 (89%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctcg 361 ||||||||||||||||| |||| ||| ||||||| |||| Sbjct: 1879 agcttctccttgatcttgtccacgactcccttctcctcg 1841 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctcca 167 ||||| ||||||||||||||||| |||| Sbjct: 1885 ccgggcagcttctccttgatcttgtcca 1858
>gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, complete cds Length = 748 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctc 183 ||||| ||||||||||||||||| ||||| ||||| |||||||| Sbjct: 490 ccgggcagcttctccttgatcttgtccatgatgcctttcttctc 447 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttctc 360 ||||||||||||||||| ||||||| ||| |||||||| Sbjct: 484 agcttctccttgatcttgtccatgatgcctttcttctc 447 Score = 40.1 bits (20), Expect = 5.8 Identities = 35/40 (87%) Strand = Plus / Minus Query: 300 ggttgtccttgtgcccgccagggagcttctccttgatctt 339 ||||||||||||| | || || ||||||||||||||||| Sbjct: 360 ggttgtccttgtgggctccgggcagcttctccttgatctt 321
>dbj|AB076807.1| Triticum aestivum Wdhn13 mRNA for LEA D-11 dehydrin, complete cds Length = 657 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 310 gtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||| || || |||||||||||||| ||||| | |||||||||||||||| Sbjct: 220 gtgcccaccgggaagcttctccttgatgttctcgacgacgcccttcttctcg 169 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 320 gggagcttctccttgatcttctccatgacgcccttcttctcg 361 |||||||||||| |||| | ||||||||||||||||||||| Sbjct: 78 gggagcttctccgtgatgctttccatgacgcccttcttctcg 37 Score = 44.1 bits (22), Expect = 0.37 Identities = 34/38 (89%) Strand = Plus / Minus Query: 146 agcttctccttgatcttctccatcatgcccttcttctc 183 ||||| ||||||||||| |||||||||| ||| ||||| Sbjct: 369 agcttgtccttgatcttgtccatcatgctcttgttctc 332 Score = 42.1 bits (21), Expect = 1.5 Identities = 39/45 (86%) Strand = Plus / Minus Query: 140 ccggggagcttctccttgatcttctccatcatgcccttcttctcg 184 ||||| |||||||||||||| ||||| | | ||||||||||||| Sbjct: 213 ccgggaagcttctccttgatgttctcgacgacgcccttcttctcg 169
>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible protein 1 mRNA, complete cds Length = 1315 Score = 54.0 bits (27), Expect = 4e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctc 183 |||||||||||| ||||||||||||||||| || | | |||||||||||| Sbjct: 741 gtggccgccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 691 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 307 cttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctc 360 |||||| ||||| || ||||||||||||||||| || | || |||||||||||| Sbjct: 744 cttgtggccgccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 691 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||||||||||||| ||| |||||||||| Sbjct: 467 agcttctccttgatcttctccttgagccccttcttct 431 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctcc 166 |||||| ||||||||||||||||||||| Sbjct: 474 gccgggcagcttctccttgatcttctcc 447
>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1) mRNA, complete cds Length = 1117 Score = 54.0 bits (27), Expect = 4e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctc 183 |||||||||||| ||||||||||||||||| || | | |||||||||||| Sbjct: 731 gtggccgccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 681 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 307 cttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctc 360 |||||| ||||| || ||||||||||||||||| || | || |||||||||||| Sbjct: 734 cttgtggccgccgggcagcttctccttgatcttgtcgaggaagcccttcttctc 681 Score = 50.1 bits (25), Expect = 0.006 Identities = 34/37 (91%) Strand = Plus / Minus Query: 323 agcttctccttgatcttctccatgacgcccttcttct 359 ||||||||||||||||||||| ||| |||||||||| Sbjct: 457 agcttctccttgatcttctccttgagccccttcttct 421 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 139 gccggggagcttctccttgatcttctcc 166 |||||| ||||||||||||||||||||| Sbjct: 464 gccgggcagcttctccttgatcttctcc 437
>gb|AY607707.1| Quercus robur dehydrin 3 (Dhn3) mRNA, complete cds Length = 739 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 148 cttctccttgatcttctccatcatgcccttcttct 182 ||||||||||||||||||||||| |||||||||| Sbjct: 456 cttctccttgatcttctccatcactcccttcttct 422 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 325 cttctccttgatcttctccatgacgcccttcttct 359 ||||||||||||||||||||| || |||||||||| Sbjct: 456 cttctccttgatcttctccatcactcccttcttct 422
>gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence Length = 722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcatgcccttcttctc 183 |||||| ||||| ||||||||||||||||| |||| || ||| |||||||| Sbjct: 199 gtggccaccgggtagcttctccttgatcttgtccagcaggcctttcttctc 149
>gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial sequence Length = 391 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctcca 167 |||||||||||| ||||||||||||||||| |||| Sbjct: 249 gtggccgccgggcagcttctccttgatcttttcca 215 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 307 cttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctc 360 |||||| ||||| || ||||||||||||||||| |||| || ||| |||||||| Sbjct: 252 cttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 199
>gb|AY706990.1| Vitis vinifera dehydrin 1b (DHN1b) gene, complete cds, alternatively spliced Length = 1296 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcat 171 |||||| || || |||||||||||||||||||||||||| Sbjct: 610 gtggcccccaggcagcttctccttgatcttctccatcat 572 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccat 345 ||||| ||||||||||||||||||||||| Sbjct: 603 ccaggcagcttctccttgatcttctccat 575
>gb|AY706989.1| Vitis vinifera dehydrin 1a (DHN1a) gene, complete cds, alternatively spliced Length = 845 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcat 171 |||||| || || |||||||||||||||||||||||||| Sbjct: 624 gtggcccccaggcagcttctccttgatcttctccatcat 586 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccat 345 ||||| ||||||||||||||||||||||| Sbjct: 617 ccaggcagcttctccttgatcttctccat 589
>gb|AY706988.1| Vitis riparia dehydrin 1b (DHN1b) gene, partial sequence Length = 1296 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctccatcat 171 |||||| || || |||||||||||||||||||||||||| Sbjct: 610 gtggcccccaggcagcttctccttgatcttctccatcat 572 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 317 ccagggagcttctccttgatcttctccat 345 ||||| ||||||||||||||||||||||| Sbjct: 603 ccaggcagcttctccttgatcttctccat 575
>emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin (dhn11 gene) Length = 1127 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 133 gtggccgccggggagcttctccttgatcttctcca 167 |||||||||||| ||||||||||||||||| |||| Sbjct: 656 gtggccgccgggcagcttctccttgatcttttcca 622 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 307 cttgtgcccgccagggagcttctccttgatcttctccatgacgcccttcttctc 360 |||||| ||||| || ||||||||||||||||| |||| || ||| |||||||| Sbjct: 659 cttgtggccgccgggcagcttctccttgatcttttccaagaagcctttcttctc 606 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,190,249 Number of Sequences: 3902068 Number of extensions: 3190249 Number of successful extensions: 78762 Number of sequences better than 10.0: 420 Number of HSP's better than 10.0 without gapping: 423 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 76389 Number of HSP's gapped (non-prelim): 2360 length of query: 429 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 407 effective length of database: 17,147,199,772 effective search space: 6978910307204 effective search space used: 6978910307204 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
