>gb|AC134818.1| Homo sapiens chromosome 5 clone RP11-184G11, complete sequence
          Length = 81872

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 226   tcaggatcccggagttcctggggat 250
             |||||||||| ||||||||||||||
Sbjct: 79719 tcaggatcccagagttcctggggat 79695

>gb|AC063922.23| Homo sapiens 3 BAC RP11-315A15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 97817

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 47    ttcttcaactcacagattatt 67
             |||||||||||||||||||||
Sbjct: 87854 ttcttcaactcacagattatt 87834

>emb|AL161548.2|ATCHRIV48 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 48
          Length = 194143

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 41     ggtttattcttcaactcacag 61
              |||||||||||||||||||||
Sbjct: 174721 ggtttattcttcaactcacag 174741

>emb|AL021710.1|ATF28J12 Arabidopsis thaliana DNA chromosome 4, BAC clone F28J12 (ESSAII
             project)
          Length = 110102

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 41    ggtttattcttcaactcacag 61
             |||||||||||||||||||||
Sbjct: 66756 ggtttattcttcaactcacag 66776

>gb|AC008462.6|AC008462 Homo sapiens chromosome 5 clone CTC-352J10, complete sequence
          Length = 183591

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 226    tcaggatcccggagttcctggggat 250
              |||||||||| ||||||||||||||
Sbjct: 148434 tcaggatcccagagttcctggggat 148458

>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence
          Length = 384518

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 179    cggcagcagcgcaacgccag 198
              ||||||||||||||||||||
Sbjct: 324676 cggcagcagcgcaacgccag 324657

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 175     cttccggcagcagcgcaacgccag 198
               |||||| |||||||||||||||||
Sbjct: 3669735 cttccgtcagcagcgcaacgccag 3669712

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 175     cttccggcagcagcgcaacgccag 198
               |||||| |||||||||||||||||
Sbjct: 3456939 cttccgtcagcagcgcaacgccag 3456916

>gb|AC022296.34| Homo sapiens 3 BAC RP11-91K8 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 153650

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 105    acagatgatttattttttca 124
              ||||||||||||||||||||
Sbjct: 119070 acagatgatttattttttca 119089

>gb|AF195044.1|AF195849S2 Homo sapiens beaded filament component protein (CP49) gene, partial
            cds
          Length = 12473

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 105  acagatgatttattttttca 124
            ||||||||||||||||||||
Sbjct: 3977 acagatgatttattttttca 3958

>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gatgatttattttttcacac 127
               ||||||||||||||||||||
Sbjct: 1419186 gatgatttattttttcacac 1419205


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,324,632
Number of Sequences: 3902068
Number of extensions: 2324632
Number of successful extensions: 39465
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39410
Number of HSP's gapped (non-prelim): 55
length of query: 254
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 232
effective length of database: 17,147,199,772
effective search space: 3978150347104
effective search space used: 3978150347104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)