Clone Name | rbart22g11 |
---|---|
Clone Library Name | barley_pub |
>emb|Z23130.1|HVBLT63A H.vulgare BLT63 mRNA, complete CDS Length = 1560 Score = 315 bits (159), Expect = 7e-83 Identities = 210/227 (92%) Strand = Plus / Minus Query: 225 catctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttct 284 ||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||| Sbjct: 1394 catctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttct 1335 Query: 285 ccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggc 344 |||||||||||||||| ||||| |||||||||||||||||||||||||||||||| || | Sbjct: 1334 ccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgac 1275 Query: 345 ccaggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttga 404 |||| |||||||||||||| ||||||||||||||||| |||||||| || |||||||||| Sbjct: 1274 ccagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttga 1215 Query: 405 cgaacccggcgtcaccattcttgaggaacttgggcgccgcttccagc 451 ||||||| || |||||||||||||| ||||||||||| || |||||| Sbjct: 1214 cgaacccagcatcaccattcttgagaaacttgggcgctgcctccagc 1168
>gb|L11740.1|BLYEFIA Barley elongation factor 1 alpha, (EF-1A) mRNA sequence Length = 1725 Score = 315 bits (159), Expect = 7e-83 Identities = 210/227 (92%) Strand = Plus / Minus Query: 225 catctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttct 284 ||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||| Sbjct: 1455 catctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttct 1396 Query: 285 ccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggc 344 |||||||||||||||| ||||| |||||||||||||||||||||||||||||||| || | Sbjct: 1395 ccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgac 1336 Query: 345 ccaggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttga 404 |||| |||||||||||||| ||||||||||||||||| |||||||| || |||||||||| Sbjct: 1335 ccagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaatcatcttga 1276 Query: 405 cgaacccggcgtcaccattcttgaggaacttgggcgccgcttccagc 451 ||||||| || |||||||||||||| ||||||||||| || |||||| Sbjct: 1275 cgaacccagcatcaccattcttgagaaacttgggcgctgcctccagc 1229 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 18 tagcaactttaactgacgaagttttaccaacacaacc 54 ||||||| |||||||| |||||| |||||||||||| Sbjct: 1623 tagcaacattaactgatgaagttccaccaacacaacc 1587
>gb|AF479046.1| Triticum aestivum elongation factor-1 alpha mRNA, partial cds Length = 432 Score = 311 bits (157), Expect = 1e-81 Identities = 201/216 (93%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| |||||||||||||||||||| |||||||| ||||| |||||||| Sbjct: 432 tcatttcttcttggccgcagccttggtcaccttggcgccggtcggatccttnttctccac 373 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | |||||| |||||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 372 ggccttgataacgcccaccgcaaccgtctgcctcatgtcacgcacagcaaagcggcccag 313 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 312 gggagggtactgagcgaaggtctccaccaccatgggcttggtggggatcatcttgacgaa 253 Query: 409 cccggcgtcaccattcttgaggaacttgggcgccgc 444 |||||| ||||| ||||||||||||||||||||||| Sbjct: 252 cccggcatcaccgttcttgaggaacttgggcgccgc 217
>gb|BT016906.1| Zea mays clone Contig739 mRNA sequence Length = 687 Score = 218 bits (110), Expect = 1e-53 Identities = 185/210 (88%) Strand = Plus / Plus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| ||| ||||||||||||||||| || || || |||||||||||||| Sbjct: 196 tcatttcttcttggcagccgccttggtcaccttggctcccgttgggtccttcttctccac 255 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||| |||||||| || |||||||||||||||||||| || || || ||||| ||||| Sbjct: 256 gctctttatcacgccgactgcaaccgtctgcctcatgtcgcgaaccgcgaagcgccccag 315 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| |||| || ||| |||||||||||||| ||||| |||||||||||||||||||| Sbjct: 316 tggaggatactcggagaaagtctccaccaccatgggcttcgtggggatcatcttgacgaa 375 Query: 409 cccggcgtcaccattcttgaggaacttggg 438 ||||||||||| |||||||| |||||||| Sbjct: 376 gccggcgtcaccgttcttgagaaacttggg 405
>gb|BT017771.1| Zea mays clone EL01N0502E05.c mRNA sequence Length = 959 Score = 204 bits (103), Expect = 2e-49 Identities = 184/211 (87%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 |||||||||||| || ||||||||||||||||||||||| || || |||||||||||||| Sbjct: 804 tcatttcttctttattgcagccttggtcaccttggcaccagttgggtccttcttctccac 745 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 ||||||||| || || || ||||||||||||||||||||||| || ||||| || ||||| Sbjct: 744 gctcttgatgactccaacagcaaccgtctgcctcatgtcacggacagcaaaacgacccag 685 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| ||||| | ||||||||| |||||||| ||||| ||||| |||||||| || | Sbjct: 684 aggaggatactgagagaaggtctcaaccaccatgggcttagtgggaatcatcttcaccat 625 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 ||||| ||||||||||| |||||||||||| Sbjct: 624 accggcatcaccattcttcaggaacttgggc 594
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 198 bits (100), Expect = 1e-47 Identities = 184/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 4101208 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4101149 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || | Sbjct: 4101148 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 4101089 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 4101088 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4101029 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 4101028 taccagcatcaccgttcttgaggaacttgggc 4100997 Score = 196 bits (99), Expect = 4e-47 Identities = 183/211 (86%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| |||||||||||||||||||||||||| || |||||||||||||| Sbjct: 4084355 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 4084296 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || || Sbjct: 4084295 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 4084236 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 4084235 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 4084176 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 4084175 accagcatcaccgttcttgaggaacttgggc 4084145 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 4078916 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4078857 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||| ||||||||||| || || | Sbjct: 4078856 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 4078797 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 4078796 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4078737 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 4078736 taccagcatcaccgttcttgaggaacttgggc 4078705 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 4095038 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4094979 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 4094978 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 4094919 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| |||||||| || ||||||||||| | Sbjct: 4094918 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 4094859 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 4094858 taccagcatcaccgttcttcaagaacttgggc 4094827
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 198 bits (100), Expect = 1e-47 Identities = 184/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 4101317 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4101258 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || | Sbjct: 4101257 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 4101198 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 4101197 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4101138 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 4101137 taccagcatcaccgttcttgaggaacttgggc 4101106 Score = 196 bits (99), Expect = 4e-47 Identities = 183/211 (86%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| |||||||||||||||||||||||||| || |||||||||||||| Sbjct: 4084466 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 4084407 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || || Sbjct: 4084406 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 4084347 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 4084346 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 4084287 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 4084286 accagcatcaccgttcttgaggaacttgggc 4084256 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 4079027 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4078968 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||| ||||||||||| || || | Sbjct: 4078967 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 4078908 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 4078907 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4078848 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 4078847 taccagcatcaccgttcttgaggaacttgggc 4078816 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 4095149 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4095090 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 4095089 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 4095030 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| |||||||| || ||||||||||| | Sbjct: 4095029 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 4094970 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 4094969 taccagcatcaccgttcttcaagaacttgggc 4094938
>gb|AC125472.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0050H14, complete sequence Length = 142245 Score = 198 bits (100), Expect = 1e-47 Identities = 184/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1845 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1786 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || | Sbjct: 1785 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1726 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1725 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1666 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1665 taccagcatcaccgttcttgaggaacttgggc 1634
>dbj|AK073196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024M04, full insert sequence Length = 2157 Score = 198 bits (100), Expect = 1e-47 Identities = 184/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 2001 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1942 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || | Sbjct: 1941 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1882 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1881 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1822 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1821 taccagcatcaccgttcttgaggaacttgggc 1790
>dbj|AK072285.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023016F09, full insert sequence Length = 1653 Score = 198 bits (100), Expect = 1e-47 Identities = 184/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1428 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1369 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || | Sbjct: 1368 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1309 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1308 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1249 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1248 taccagcatcaccgttcttgaggaacttgggc 1217
>dbj|D63581.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1630 Score = 198 bits (100), Expect = 1e-47 Identities = 184/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1406 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1347 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || | Sbjct: 1346 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1287 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1286 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1227 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1226 taccagcatcaccgttcttgaggaacttgggc 1195
>gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0061L19, from chromosome 3, complete sequence Length = 153322 Score = 196 bits (99), Expect = 4e-47 Identities = 183/211 (86%) Strand = Plus / Plus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| |||||||||||||||||||||||||| || |||||||||||||| Sbjct: 15013 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 15072 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || || Sbjct: 15073 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 15132 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 15133 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 15192 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 15193 accagcatcaccgttcttgaggaacttgggc 15223 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 20452 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 20511 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||| ||||||||||| || || | Sbjct: 20512 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 20571 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 20572 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 20631 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 20632 taccagcatcaccgttcttgaggaacttgggc 20663 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Plus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 4330 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4389 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 4390 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 4449 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| |||||||| || ||||||||||| | Sbjct: 4450 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 4509 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 4510 taccagcatcaccgttcttcaagaacttgggc 4541
>dbj|AK119537.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B11, full insert sequence Length = 1722 Score = 196 bits (99), Expect = 4e-47 Identities = 183/211 (86%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| |||||||||||||||||||||||||| || |||||||||||||| Sbjct: 1441 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1382 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || || Sbjct: 1381 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 1322 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1321 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 1262 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1261 accagcatcaccgttcttgaggaacttgggc 1231
>dbj|AK061464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-C01, full insert sequence Length = 1620 Score = 196 bits (99), Expect = 4e-47 Identities = 183/211 (86%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| |||||||||||||||||||||||||| || |||||||||||||| Sbjct: 1440 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1381 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || || Sbjct: 1380 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 1321 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1320 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 1261 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1260 accagcatcaccgttcttgaggaacttgggc 1230
>dbj|D63583.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1599 Score = 196 bits (99), Expect = 4e-47 Identities = 183/211 (86%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| |||||||||||||||||||||||||| || |||||||||||||| Sbjct: 1419 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1360 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | ||||||| ||||| || || ||||| ||||||||||||||||||||||| || || || Sbjct: 1359 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 1300 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1299 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 1240 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1239 accagcatcaccgttcttgaggaacttgggc 1209
>dbj|AK105030.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-F06, full insert sequence Length = 1632 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1440 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1381 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||| ||||||||||| || || | Sbjct: 1380 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1321 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1320 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1261 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1260 taccagcatcaccgttcttgaggaacttgggc 1229
>dbj|AK119172.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A11, full insert sequence Length = 1661 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1435 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1376 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||| ||||||||||| || || | Sbjct: 1375 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1316 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1315 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1256 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1255 taccagcatcaccgttcttgaggaacttgggc 1224
>dbj|AK103738.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033138K07, full insert sequence Length = 3222 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 3030 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 2971 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||| ||||||||||| || || | Sbjct: 2970 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 2911 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 2910 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 2851 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 2850 taccagcatcaccgttcttgaggaacttgggc 2819
>dbj|AK072648.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023126K23, full insert sequence Length = 1760 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1439 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1380 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||| ||||||||||| || || | Sbjct: 1379 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1320 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1319 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1260 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1259 taccagcatcaccgttcttgaggaacttgggc 1228
>dbj|AK062030.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-G10, full insert sequence Length = 1357 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1161 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1102 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||| ||||||||||| || || | Sbjct: 1101 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1042 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1041 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 982 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 981 taccagcatcaccgttcttgaggaacttgggc 950
>gb|AF030517.1|AF030517 Oryza sativa translation elongation factor-1 alpha mRNA, complete cds Length = 1562 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1345 ctcatttcttcttgcgggcagccttggtcaccttggcaccggttgggtccttcttctcca 1286 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 1285 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1226 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1225 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1166 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1165 taccagcatcaccgttcttgaggaacttgggc 1134
>dbj|D63580.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1644 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1418 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1359 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||| ||||||||||| || || | Sbjct: 1358 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1299 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1298 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1239 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||||||||||||| Sbjct: 1238 taccagcatcaccgttcttgaggaacttgggc 1207
>gb|BT016740.1| Zea mays clone Contig573 mRNA sequence Length = 1712 Score = 188 bits (95), Expect = 1e-44 Identities = 182/211 (86%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1439 tcatttcttcttggcagcagccttggtcaccttggcaccggtcgggtccttcttctccac 1380 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || ||||||||||| ||||||||||| || ||||| | ||||| Sbjct: 1379 actcttgatgactccaacagcaaccgtctgtctcatgtcacggacagcaaacctacccag 1320 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||| ||||| | ||| |||||||||||||| ||||||||||| |||||||| || | Sbjct: 1319 gggaggatactgcgagaatgtctccaccaccatgggcttggtgggaatcatcttcaccat 1260 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 1259 accagcatcaccgttcttcaagaacttgggc 1229
>gb|AF136827.1|AF136827 Zea mays clone e elongation factor 1 alpha mRNA, complete cds Length = 1606 Score = 188 bits (95), Expect = 1e-44 Identities = 179/207 (86%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| || ||||||||||||||||| ||||| || |||||||||||||| Sbjct: 1432 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1373 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||||||||| || |||||||||||||||||||| || || ||||| | ||||| Sbjct: 1372 actcttgatcacgccgactgcaaccgtctgcctcatgtcgcggaccgcaaacctacccag 1313 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| |||| || ||| |||||||||||||| ||||| ||||||| |||||| ||||| Sbjct: 1312 tggaggatactcggagaaagtctccaccaccatgggcttcgtggggaccatcttcacgaa 1253 Query: 409 cccggcgtcaccattcttgaggaactt 435 ||||||||||| |||||||| ||||| Sbjct: 1252 accggcgtcaccgttcttgagaaactt 1226
>gb|AF136826.1|AF136826 Zea mays clone d elongation factor 1 alpha mRNA, complete cds Length = 1546 Score = 180 bits (91), Expect = 3e-42 Identities = 178/207 (85%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 |||||||||||| || ||||||||||||||||||||||| || || |||||||||||||| Sbjct: 1375 tcatttcttctttattgcagccttggtcaccttggcaccagttgggtccttcttctccac 1316 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 ||||||||| || || || |||||||||||||||||||| | || ||||| || ||||| Sbjct: 1315 gctcttgatgactccaacagcaaccgtctgcctcatgtcgaggacagcaaaacgacccag 1256 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| ||||| | ||||||||| |||||||| ||||| ||||| |||||||| || | Sbjct: 1255 aggaggatactgagagaaggtctcaaccaccatgggcttagtgggaatcatcttcaccat 1196 Query: 409 cccggcgtcaccattcttgaggaactt 435 ||||| ||||||||||| |||||||| Sbjct: 1195 accggcatcaccattcttcaggaactt 1169
>emb|Z50789.1|HVEF1ALFA H.vulgare mRNA for elongation factor 1-alpha Length = 1609 Score = 168 bits (85), Expect = 1e-38 Identities = 178/209 (85%) Strand = Plus / Minus Query: 231 atttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgc 290 ||||||||||||| |||||||||||||||||||| ||||| || |||||||||||||||| Sbjct: 1398 atttcttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgc 1339 Query: 291 tcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggg 350 |||||| || || || || || || |||||||||||||| || ||||| || || || | Sbjct: 1338 ccttgatgacaccaacagccacagtttgcctcatgtcacggacagcaaaacgaccaagag 1279 Query: 351 gagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacc 410 ||||||| ||| ||||||||||| ||||| ||||||||||| |||||||| || | | Sbjct: 1278 gagggtaagtggcaaaggtctccacaaccatgggcttggtgggaatcatcttcactatac 1219 Query: 411 cggcgtcaccattcttgaggaacttgggc 439 | || |||||||||||||||||||||||| Sbjct: 1218 cagcatcaccattcttgaggaacttgggc 1190
>gb|AF281361.1| Saccharum officinarum elongation factor mRNA, complete cds Length = 1745 Score = 168 bits (85), Expect = 1e-38 Identities = 178/209 (85%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||| Sbjct: 1447 tcatttcttcttggcagcagccttggtcaccttggcgccggtcgggtccttcttctccac 1388 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| | || || |||||||| ||||||||||| || || ||||| | || || Sbjct: 1387 actcttgatgattccaacagcaaccgtttgcctcatgtcgcggacagcaaacctaccaag 1328 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||| |||| || ||| |||||||||||||||||||||||||| |||||||| || | Sbjct: 1327 gggaggatactcggagaatgtctccaccaccatcggcttggtgggaatcatcttcaccat 1268 Query: 409 cccggcgtcaccattcttgaggaacttgg 437 || || ||||| ||||| |||||||||| Sbjct: 1267 accagcatcaccgttcttcaggaacttgg 1239
>dbj|AK119528.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C04, full insert sequence Length = 1818 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1431 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1372 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 1371 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1312 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| |||||||| || ||||||||||| | Sbjct: 1311 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1252 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 1251 taccagcatcaccgttcttcaagaacttgggc 1220
>dbj|AK119194.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-C03, full insert sequence Length = 1130 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 900 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 841 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 840 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 781 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| |||||||| || ||||||||||| | Sbjct: 780 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 721 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 720 taccagcatcaccgttcttcaagaacttgggc 689
>dbj|AK071619.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100M05, full insert sequence Length = 1867 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1706 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1647 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 1646 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1587 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| |||||||| || ||||||||||| | Sbjct: 1586 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1527 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 1526 taccagcatcaccgttcttcaagaacttgggc 1495
>dbj|AK071343.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023091A02, full insert sequence Length = 1658 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1431 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1372 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 1371 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1312 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| |||||||| || ||||||||||| | Sbjct: 1311 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1252 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 1251 taccagcatcaccgttcttcaagaacttgggc 1220
>dbj|D63582.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1637 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||| |||||||||||||||||||||||||| || ||||||||||||| Sbjct: 1410 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1351 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 1350 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1291 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| |||||||| || ||||||||||| | Sbjct: 1290 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1231 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 1230 taccagcatcaccgttcttcaagaacttgggc 1199
>gb|BT016525.1| Zea mays clone Contig358 mRNA sequence Length = 1705 Score = 165 bits (83), Expect = 2e-37 Identities = 179/211 (84%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| || ||||||||||||||||| ||||| || |||||||||||||| Sbjct: 1423 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1364 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || |||||||||||||||||||| || |||||||| | ||||| Sbjct: 1363 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1304 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||| ||| || ||| |||||||||||||| ||||||||||| |||||||| || | Sbjct: 1303 gggaggatacgcggagaatgtctccaccaccataggcttggtgggaatcatcttcaccat 1244 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| |||||||||||| Sbjct: 1243 accagcatcaccgttcttcaggaacttgggc 1213
>gb|AF136824.1|AF136824 Zea mays clone b elongation factor 1 alpha mRNA, complete cds Length = 1604 Score = 165 bits (83), Expect = 2e-37 Identities = 179/211 (84%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| || ||||||||||||||||| ||||| || |||||||||||||| Sbjct: 1404 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1345 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || |||||||||||||||||||| || |||||||| | ||||| Sbjct: 1344 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1285 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||| ||| || ||| |||||||||||||| ||||||||||| |||||||| || | Sbjct: 1284 gggaggatacgcggagaatgtctccaccaccataggcttggtgggaatcatcttcaccat 1225 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| |||||||||||| Sbjct: 1224 accagcatcaccgttcttcaggaacttgggc 1194
>gb|AY109326.1| Zea mays CL1256_1 mRNA sequence Length = 2360 Score = 165 bits (83), Expect = 2e-37 Identities = 179/211 (84%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| || ||||||||||||||||| ||||| || |||||||||||||| Sbjct: 2032 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1973 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || |||||||||||||||||||| || |||||||| | ||||| Sbjct: 1972 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1913 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||| ||| || ||| |||||||||||||| ||||||||||| |||||||| || | Sbjct: 1912 gggaggatacgcggagaatgtctccaccaccataggcttggtgggaatcatcttcaccat 1853 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| |||||||||||| Sbjct: 1852 accagcatcaccgttcttcaggaacttgggc 1822
>dbj|AK119647.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-G07, full insert sequence Length = 1660 Score = 159 bits (80), Expect = 1e-35 Identities = 179/212 (84%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||| ||||||||||||||||||| |||||| || ||||||||||||| Sbjct: 1433 ctcacttcttcttggcggcagccttggtcaccttggtaccggttgggtccttcttctcca 1374 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 || ||||||| ||||| || || ||||| ||||||||||||||||| ||||| || || | Sbjct: 1373 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1314 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | |||||||||| | |||||||||||| ||||| |||||||| || ||||||||||| | Sbjct: 1313 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1254 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | |||||||||| Sbjct: 1253 taccagcatcaccgttcttcaagaacttgggc 1222
>gb|BT016514.1| Zea mays clone Contig347 mRNA sequence Length = 1687 Score = 157 bits (79), Expect = 4e-35 Identities = 175/207 (84%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| ||||||||||||||||||||| ||||| || |||||||||||||| Sbjct: 1424 tcatttcttcttggcagcagccttggtcaccttggcgccggttgggtccttcttctccac 1365 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || ||||||||||||||||||||||| || ||||| | || || Sbjct: 1364 actcttgataactccaacagcaaccgtctgcctcatgtcacggacagcaaacctaccaag 1305 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||| ||| | ||| |||||||||||||| ||||||||||| |||||||| || | Sbjct: 1304 gggaggatacgctgagaatgtctccaccaccatgggcttggtgggtatcatcttcaccat 1245 Query: 409 cccggcgtcaccattcttgaggaactt 435 || || ||||| ||||| |||||||| Sbjct: 1244 accagcatcaccgttcttcaggaactt 1218
>gb|AF136823.1|AF136823 Zea mays clone a elongation factor 1 alpha mRNA, complete cds Length = 1600 Score = 157 bits (79), Expect = 4e-35 Identities = 175/207 (84%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| || ||||||||||||||||| ||||| || |||||||||||||| Sbjct: 1415 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1356 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || |||||||||||||||||||| || |||||||| | ||||| Sbjct: 1355 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1296 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||| ||| || ||| |||||||||||||| ||||||||||| |||||||| || | Sbjct: 1295 gggaggatacgcggagaatgtctccaccaccataggcttggtgggtatcatcttcaccat 1236 Query: 409 cccggcgtcaccattcttgaggaactt 435 || || ||||| ||||| |||||||| Sbjct: 1235 accagcatcaccgttcttcaggaactt 1209
>gb|DQ407753.1| Gymnadenia conopsea EF-1 alpha mRNA, complete cds Length = 1682 Score = 155 bits (78), Expect = 1e-34 Identities = 162/190 (85%) Strand = Plus / Minus Query: 250 cttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgcccacggc 309 |||||| |||||||| ||| | ||||||||||||||||| |||||||| ||||| ||||| Sbjct: 1381 cttggtgaccttggcgccgctgggctccttcttctccacactcttgataacgccgacggc 1322 Query: 310 aaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggt 369 ||||||||||||||||| | |||||| |||||||| || ||||| |||| || |||||| Sbjct: 1321 caccgtctgcctcatgtccctcacggcgaagcggccgagcggaggatactcggagaaggt 1262 Query: 370 ctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattcttgag 429 ||||||||||| ||||| | || |||||||| ||||| || ||||| || ||||| || Sbjct: 1261 ttccaccaccatgggcttcgacggaatcatcttcacgaaacctgcgtcgccgttcttcag 1202 Query: 430 gaacttgggc 439 |||||||||| Sbjct: 1201 gaacttgggc 1192
>gb|M90077.1|WHTTEF1X Wheat translation elongation factor 1 alpha-subunit (TEF1) mRNA, complete cds Length = 2062 Score = 151 bits (76), Expect = 2e-33 Identities = 178/212 (83%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||||| |||||||||||||||||||| ||||| || ||||||||||||| Sbjct: 1826 ctcatttcttcttgatggcagccttggtcaccttggcgccggttgggtccttcttctcca 1767 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 | | |||||| || || || || || || |||||||||||||| || ||||| || || | Sbjct: 1766 cacccttgatgacaccaacagccacagtttgcctcatgtcacggacagcaaaacgaccaa 1707 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | || ||||| || ||||||||||| ||||| ||||||||||| |||||||| || | Sbjct: 1706 gaggtgggtaagtagcaaaggtctccacaaccatgggcttggtgggaatcatcttcacta 1647 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || |||||||||||||||||||||||| Sbjct: 1646 tgccagcatcaccattcttgaggaacttgggc 1615
>gb|BT016889.1| Zea mays clone Contig722 mRNA sequence Length = 930 Score = 149 bits (75), Expect = 9e-33 Identities = 177/211 (83%) Strand = Plus / Plus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||| ||| ||| |||||||| |||||||| |||||||| |||||||||||||| Sbjct: 299 tcatttctttttggcagctgccttggtaaccttggcgccggtcgggtccttcttctccac 358 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || ||||| |||||||||||||| || || ||||| | || || Sbjct: 359 actcttgatgactccaacagcaactgtctgcctcatgtcgcggacagcaaacctaccaag 418 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||| ||||| | ||| |||||||||||||| ||||||||||| |||||||| || | Sbjct: 419 gggaggatactgcgagaatgtctccaccaccatgggcttggtgggaatcatcttcaccat 478 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| |||||||||||| Sbjct: 479 accagcatcaccgttcttcaggaacttgggc 509
>gb|AF136828.1|AF136828 Zea mays clone f elongation factor 1 alpha mRNA, complete cds Length = 1596 Score = 149 bits (75), Expect = 9e-33 Identities = 174/207 (84%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||| ||| ||| |||||||| |||||||| |||||||| |||||||||||||| Sbjct: 1413 tcatttctttttggcagctgccttggtaaccttggcgccggtcgggtccttcttctccac 1354 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || |||||||||||||||||||| || ||||| || | ||||| Sbjct: 1353 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggctaacctacccag 1294 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||| ||| || ||| |||||||||||||| ||||||||||| |||||||| || | Sbjct: 1293 gggaggatacgcggagaatgtctccaccaccataggcttggtgggtatcatcttcaccat 1234 Query: 409 cccggcgtcaccattcttgaggaactt 435 || || ||||| ||||| |||||||| Sbjct: 1233 accagcatcaccgttcttcaggaactt 1207
>dbj|D12709.1|DARELF1A Daucus carota mRNA for elongation factor 1-alpha, complete cds Length = 1700 Score = 149 bits (75), Expect = 9e-33 Identities = 177/211 (83%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||||| ||||||||||| |||||||| ||||| || |||||||||||||| Sbjct: 1377 tcatttcttcttgattgcagccttggtgaccttggctccggtaggatccttcttctccac 1318 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || ||||| ||||| ||||||||||||||||| || ||||| | || || Sbjct: 1317 actcttgatgactcccacagcaacagtctgcctcatgtcacgaacagcaaaccttccaag 1258 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 |||||||| ||||||||| |||||||| |||||||| || |||||||| ||||| Sbjct: 1257 tggagggtaggacatgaaggtctcgaccaccatgggcttggttggaatcatcttaacgaa 1198 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||||||||| | ||||||||| Sbjct: 1197 accagcatcaccattcttcaaaaacttgggc 1167
>gb|DQ057979.1| Musa acuminata elongation factor-1 alpha mRNA, complete cds Length = 1644 Score = 143 bits (72), Expect = 6e-31 Identities = 159/188 (84%) Strand = Plus / Minus Query: 251 ttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgcccacggca 310 ||||| |||||||| ||||| || ||||||||||||||||| ||||| || ||||||||| Sbjct: 1408 ttggtaaccttggctccggtgggatccttcttctccacgcttttgataacacccacggca 1349 Query: 311 accgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtc 370 |||||||| |||||||| | || ||||| | |||||||| | ||||| |||||| ||| Sbjct: 1348 accgtctgtctcatgtctctaacagcaaacctacccaggggcgagtactcggcgaaagtc 1289 Query: 371 tccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattcttgagg 430 || |||||||||||||| || || |||||||| || || || || || |||||||||||| Sbjct: 1288 tcgaccaccatcggctttgtcggaatcatcttcaccaaacctgcatctccattcttgagg 1229 Query: 431 aacttggg 438 |||||||| Sbjct: 1228 aacttggg 1221
>emb|X96678.1|NPELF N.pseudonarcissu mRNA for elongation factor Length = 988 Score = 141 bits (71), Expect = 2e-30 Identities = 167/199 (83%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| ||||||||| || ||||||||||| || || ||||||||||| | Sbjct: 732 ctcatttcttcttggcagcagcctttgtgaccttggcacctgtaggatccttcttctcaa 673 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 | |||||||| || || || ||||| |||||||||||||| | || ||||| || |||| Sbjct: 672 cactcttgataacaccaacagcaacagtctgcctcatgtccctaacagcaaaccgcccca 613 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 || ||||||| ||||||||||||||| |||||||||||||| || |||||||| || | Sbjct: 612 tcggtgggtactcggcgaaggtctccacaaccatcggcttggtcggaatcatcttcacca 553 Query: 408 acccggcgtcaccattctt 426 ||| || ||||||||||| Sbjct: 552 tcccagcatcaccattctt 534
>gb|AF331850.1| Saccharum hybrid cultivar CP72-2086 elongation factor 1 alpha (SEF1a) mRNA, partial cds Length = 1578 Score = 135 bits (68), Expect = 1e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||| || || || ||||||||||||| Sbjct: 1327 ctcatttcttcttggcggcagccttggtcaccttggctccagttgggtccttcttctcca 1268 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 | |||||||| || || || || ||||| ||||||||||| ||||| |||||||| || | Sbjct: 1267 cactcttgatgactccaacagccaccgtttgcctcatgtcccgcacagcaaagcgaccaa 1208 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | ||||| || | | |||||||||||||||||| ||||| ||||| | |||||| || | Sbjct: 1207 gaggaggatattcagagaaggtctccaccaccatgggcttagtgggaaccatcttcacca 1148 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||||||||| |||||| Sbjct: 1147 taccagcatcaccgttcttgaggaatttgggc 1116
>gb|AF331849.1| Saccharum hybrid cultivar CP65-357 elongation factor 1 alpha (SEF1a) gene, complete cds Length = 4537 Score = 135 bits (68), Expect = 1e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||||||||||||| |||||||||||||||||||| || || || ||||||||||||| Sbjct: 4090 ctcatttcttcttggcggcagccttggtcaccttggctccagttgggtccttcttctcca 4031 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 | |||||||| || || || || ||||| ||||||||||| ||||| |||||||| || | Sbjct: 4030 cactcttgatgactccgacagccaccgtttgcctcatgtcccgcacagcaaagcgaccaa 3971 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | ||||| || | | |||||||||||||||||| ||||| ||||| | |||||| || | Sbjct: 3970 gaggaggatattcagagaaggtctccaccaccatgggctttgtgggaaccatcttcacca 3911 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||||||||| |||||| Sbjct: 3910 taccagcatcaccgttcttgaggaatttgggc 3879
>gb|AY946009.1| Actinidia deliciosa elongation factor 1 alpha mRNA, complete cds Length = 1738 Score = 135 bits (68), Expect = 1e-28 Identities = 176/212 (83%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| |||||||| | |||||||||||| ||||||||||||||||| ||||||||||||| Sbjct: 1442 ctcacttcttcttcagagcagccttggtgaccttggcaccggtcggatccttcttctcca 1383 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 |||||||||| || || || || || || || | |||||| | ||| ||||| || || | Sbjct: 1382 cgctcttgatgacaccaaccgccacagtttgacgcatgtctctcacagcaaaacgaccga 1323 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | || ||||||| | ||| |||||||||||||| || |||||||| |||||||| || | Sbjct: 1322 gcggtgggtactccgagaaagtctccaccaccatgggtttggtgggaatcatcttcacca 1263 Query: 408 acccggcgtcaccattcttgaggaacttgggc 439 ||| | |||||||||||| | |||||||||| Sbjct: 1262 tcccagagtcaccattcttcaagaacttgggc 1231
>gb|AF136829.1|AF136829 Zea mays clone g elongation factor 1 alpha mRNA, complete cds Length = 1592 Score = 131 bits (66), Expect = 2e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| || ||||||||||||||||| |||||||| |||||||||||||| Sbjct: 1444 tcatttcttcttggcggccgccttggtcaccttggcgccggtcgggtccttcttctccac 1385 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || ||||| |||||||||||||| || || ||||| | || || Sbjct: 1384 actcttgatgactccaacagcaactgtctgcctcatgtcgcggacagcaaacctaccaag 1325 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatctt 402 |||||| || || ||| |||||||||||||| ||||||||||| |||||||| Sbjct: 1324 gggaggaaacgcggagaatgtctccaccaccataggcttggtgggtatcatctt 1271
>gb|AF136825.1|AF136825 Zea mays clone c elongation factor 1 alpha mRNA, complete cds Length = 1609 Score = 131 bits (66), Expect = 2e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| ||||||||| ||||||||||| || || || |||||||||||||| Sbjct: 1420 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1361 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || || ||||| |||||||||||||| |||||||| | ||||| Sbjct: 1360 actcttgatgactccgacagccaccgtttgcctcatgtcacggacggcaaacctacccag 1301 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatctt 402 ||||| ||| || ||| |||||||||||||| |||||||| || |||||||| Sbjct: 1300 aggaggatacgcggagaatgtctccaccaccataggcttggttggtatcatctt 1247
>gb|BT016827.1| Zea mays clone Contig660 mRNA sequence Length = 1780 Score = 125 bits (63), Expect = 1e-25 Identities = 174/211 (82%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| ||||||||| ||||||||||| || || || |||||||||||||| Sbjct: 1477 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1418 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || || ||||| |||||||||||||| || ||||| || || || Sbjct: 1417 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 1358 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| ||||| | ||||||||||||||||| ||||| ||||| | |||||| || | Sbjct: 1357 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 1298 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||| || |||||| Sbjct: 1297 accagcatcaccgttcttgagaaatttgggc 1267
>gb|BT009129.1| Triticum aestivum clone wl1n.pk0027.f4:fis, full insert mRNA sequence Length = 2565 Score = 125 bits (63), Expect = 1e-25 Identities = 174/211 (82%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| ||||||||| ||||||||||| || || || |||||||||||||| Sbjct: 2399 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 2340 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || || ||||| |||||||||||||| || ||||| || || || Sbjct: 2339 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 2280 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| ||||| | ||||||||||||||||| ||||| ||||| | |||||| || | Sbjct: 2279 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 2220 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||| || |||||| Sbjct: 2219 accagcatcaccgttcttgagaaatttgggc 2189
>emb|AJ234435.1|HVU234435 Hordeum vulgare partial mRNA; clone cMWG0716.rev Length = 325 Score = 125 bits (63), Expect = 1e-25 Identities = 135/159 (84%) Strand = Plus / Plus Query: 231 atttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgc 290 ||||||||||||| |||||||||||||||||||| ||||| || |||||||||||||||| Sbjct: 167 atttcttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgc 226 Query: 291 tcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggg 350 |||||| || || || || || || |||||||||||||| || ||||| || || || | Sbjct: 227 ccttgatgacaccaacagccacagtttgcctcatgtcacggacagcaaaacgaccaagag 286 Query: 351 gagggtactgggcgaaggtctccaccaccatcggcttgg 389 ||||||| ||| ||||||||||| ||||| ||||||| Sbjct: 287 gagggtaagtggcaaaggtctccacaaccatgggcttgg 325
>gb|AF121261.1|AF121261 Lilium longiflorum elongation factor 1-alpha 1 (EF-1-alpha1) mRNA, complete cds Length = 1700 Score = 125 bits (63), Expect = 1e-25 Identities = 165/199 (82%) Strand = Plus / Minus Query: 228 ctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcca 287 |||| ||||||||||||||||||||||||||||||||||| || || ||||||||||| | Sbjct: 1420 ctcacttcttcttgatagcagccttggtcaccttggcaccagtgggatccttcttctcaa 1361 Query: 288 cgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccca 347 | ||||| || || || || ||||| ||||| | |||||| | || ||||| || || | Sbjct: 1360 cactcttaataaccccaacagcaacagtctggcgcatgtccctaacagcaaaacgcccaa 1301 Query: 348 ggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacga 407 | ||||| |||| | ||| |||||||||||||| |||||||| || |||||||| |||| Sbjct: 1300 gaggaggatactcagagaatgtctccaccaccataggcttggtcggaatcatcttcacga 1241 Query: 408 acccggcgtcaccattctt 426 | || || ||||||||||| Sbjct: 1240 aaccagcatcaccattctt 1222
>dbj|D45408.1|MZEEF1A Zea mays elongation factor 1alpha gene, complete cds Length = 3062 Score = 125 bits (63), Expect = 1e-25 Identities = 174/211 (82%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| ||||||||| ||||||||||| || || || |||||||||||||| Sbjct: 2710 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 2651 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || || ||||| |||||||||||||| || ||||| || || || Sbjct: 2650 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 2591 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| ||||| | ||||||||||||||||| ||||| ||||| | |||||| || | Sbjct: 2590 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 2531 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||| || |||||| Sbjct: 2530 accagcatcaccgttcttgagaaatttgggc 2500
>dbj|AB073630.1| Suaeda japonica sjef-1A mRNA for eukaryotic elongation factor 1A, complete cds Length = 1857 Score = 125 bits (63), Expect = 1e-25 Identities = 174/211 (82%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 |||||||||||| || ||||||||||| |||||||||| || || |||||||| || || Sbjct: 1439 tcatttcttcttcatggcagccttggtgaccttggcactagttggttccttcttgtcaac 1380 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || ||||| ||||| |||||||||||||| | ||||||||| || || || Sbjct: 1379 actcttgatgacacccacagcaacagtctgcctcatgtccctcacggcaaaacgaccaag 1320 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 || | ||||| || || |||||||||||||| ||||||||||| |||||||| || | Sbjct: 1319 aggtgagtactctgcaaaagtctccaccaccatgggcttggtgggaatcatcttaaccat 1260 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||||||||| | ||| |||||| Sbjct: 1259 accagcatcaccattcttcaagaatttgggc 1229
>gb|U76259.1|ZMU76259 Zea mays elongation factor 1-alpha (EF1-A) mRNA, complete cds Length = 1692 Score = 125 bits (63), Expect = 1e-25 Identities = 174/211 (82%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| ||||||||| ||||||||||| || || || |||||||||||||| Sbjct: 1477 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1418 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || || ||||| |||||||||||||| || ||||| || || || Sbjct: 1417 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 1358 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| ||||| | ||||||||||||||||| ||||| ||||| | |||||| || | Sbjct: 1357 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 1298 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||| || |||||| Sbjct: 1297 accagcatcaccgttcttgagaaatttgggc 1267
>dbj|D45407.1|MZEEF1AA Corn mRNA for elongation factor 1A Length = 1519 Score = 125 bits (63), Expect = 1e-25 Identities = 174/211 (82%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||||||| ||||||||| ||||||||||| || || || |||||||||||||| Sbjct: 1328 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1269 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 |||||||| || || || || ||||| |||||||||||||| || ||||| || || || Sbjct: 1268 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 1209 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| ||||| | ||||||||||||||||| ||||| ||||| | |||||| || | Sbjct: 1208 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 1149 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||| |||||||| || |||||| Sbjct: 1148 accagcatcaccgttcttgagaaatttgggc 1118
>gb|AF035178.1|AF035178 Oryctolagus cuniculus elongation factor 1 A2 (EEF1A-2) mRNA, complete cds Length = 1749 Score = 117 bits (59), Expect = 3e-23 Identities = 89/99 (89%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| |||||||||| |||||| |||||||| Sbjct: 1356 cttcttctccacgttcttgatgacgcccacggccaccgtctgccgcatgtcgcgcacggc 1297 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| ||||| |||||||||| |||| ||||||| Sbjct: 1296 gaagcggccgaggggcgggtactgggagaagctctccac 1258
>gb|AF181491.1|AF181491 Lilium longiflorum elongation factor-1 alpha 2 mRNA, complete cds Length = 1761 Score = 115 bits (58), Expect = 1e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 233 ttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctc 292 |||||||| | ||| | ||| ||||||||||| || ||||| |||||||||||||| || Sbjct: 1402 ttcttcttcacagccgacttagtcaccttggctccagtcggttccttcttctccacattc 1343 Query: 293 ttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccagggga 352 ||||| || ||||| ||||| ||||||||||||||||| || ||||| || || || ||| Sbjct: 1342 ttgataacacccacagcaacagtctgcctcatgtcacgaacagcaaaccgcccaagtgga 1283 Query: 353 gggtactgggcgaaggtctccaccaccatcggcttggtggggatcatctt 402 ||||||| | || |||||||||||||| |||||||| || |||||||| Sbjct: 1282 gggtactcagaaaaagtctccaccaccattggcttggtaggaatcatctt 1233
>gb|U80268.1|MDU80268 Malus domestica elongation factor 1 alpha (EF-1alpha) mRNA, partial cds Length = 748 Score = 115 bits (58), Expect = 1e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 233 ttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctc 292 ||||||||| ||||| |||||| |||||||||||| | || ||||||||||| |||||| Sbjct: 429 ttcttcttggcagcagacttggtgaccttggcaccgctgggatccttcttctcaacgctc 370 Query: 293 ttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccagggga 352 ||||| || || || ||||| ||||| | ||||||||| || |||||||| |||| || Sbjct: 369 ttgataacaccaacagcaacagtctggcgcatgtcacgaacagcaaagcgacccaatggt 310 Query: 353 gggtactgggcgaaggtctccaccaccatcggcttggtggggatcatctt 402 ||||||| | |||||||||||| ||||| ||||||||||| | |||||| Sbjct: 309 gggtactcagagaaggtctccacaaccatgggcttggtgggaagcatctt 260
>gb|BT018898.1| Zea mays clone EL01T0207D05.d mRNA sequence Length = 1483 Score = 113 bits (57), Expect = 5e-22 Identities = 176/213 (82%), Gaps = 2/213 (0%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 ||||||||| ||| ||| |||||||| |||||||| |||||||| ||||||||||||| Sbjct: 1385 tcatttctttttggcagctgccttggtaaccttggcgccggtcggggccttcttctccac 1326 Query: 289 -gctc-ttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccc 346 | || ||||| || || || ||||| |||||||||||||| || || ||||| | || Sbjct: 1325 aggtcattgatgactccaacagcaactgtctgcctcatgtcgcggacagcaaacctacca 1266 Query: 347 aggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacg 406 |||||||| ||||| | ||| |||||||||||||| ||||||||||| |||||||| || Sbjct: 1265 aggggaggatactgcgagaatgtctccaccaccatgggcttggtgggaatcatcttcacc 1206 Query: 407 aacccggcgtcaccattcttgaggaacttgggc 439 | || || ||||| ||||| |||||||||||| Sbjct: 1205 ataccagcatcaccgttcttcaggaacttgggc 1173
>gb|AY550990.1| Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds Length = 1623 Score = 111 bits (56), Expect = 2e-21 Identities = 158/192 (82%) Strand = Plus / Minus Query: 244 agcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgcc 303 ||||| |||||| ||||||||||| | || ||||||||||| || |||||||| || || Sbjct: 1402 agcagacttggtgaccttggcaccactagggtccttcttctcaacactcttgatgactcc 1343 Query: 304 cacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggc 363 ||| || |||||||| |||||||| | || ||||| || || || ||||| ||||| | Sbjct: 1342 cacagccaccgtctgtctcatgtctctgacagcaaaacgaccaagaggaggatactgaga 1283 Query: 364 gaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccatt 423 ||| ||||| |||||||| ||||||||||| |||||||| || || || || |||||||| Sbjct: 1282 gaaagtctcaaccaccataggcttggtgggaatcatcttcacaaatccagcatcaccatt 1223 Query: 424 cttgaggaactt 435 ||| |||||||| Sbjct: 1222 cttaaggaactt 1211
>emb|BX934090.2| Gallus gallus finished cDNA, clone ChEST61e17 Length = 1466 Score = 111 bits (56), Expect = 2e-21 Identities = 98/112 (87%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| ||||||||| || || Sbjct: 1185 cttcttctccacgttcttgatgacgcccacggccacggtctgccgcatgtcacggacagc 1126 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccaccaccatcggcttg 388 ||||||||| ||||| |||||||||| |||| ||||||| |||||||||| Sbjct: 1125 aaagcggccaaggggtgggtactgggagaagctctccacacacatcggcttg 1074
>gb|BT019804.1| Synthetic construct Homo sapiens eukaryotic translation elongation factor 1 alpha 2 mRNA, partial cds Length = 1392 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1332 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1273 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1272 gaagcggccgagaggcgggtactgggagaagctctccac 1234
>gb|BT019803.1| Synthetic construct Homo sapiens eukaryotic translation elongation factor 1 alpha 2 mRNA, partial cds Length = 1392 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1332 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1273 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1272 gaagcggccgagaggcgggtactgggagaagctctccac 1234
>gb|BC000432.2| Homo sapiens eukaryotic translation elongation factor 1 alpha 2, mRNA (cDNA clone MGC:8362 IMAGE:2819899), complete cds Length = 1781 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1400 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1341 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1340 gaagcggccgagaggcgggtactgggagaagctctccac 1302
>gb|BC018855.2| Homo sapiens eukaryotic translation elongation factor 1 alpha 2, mRNA (cDNA clone IMAGE:3161327) Length = 1402 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1042 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 983 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 982 gaagcggccgagaggcgggtactgggagaagctctccac 944
>emb|CR626526.1| full-length cDNA clone CS0DF022YE23 of Fetal brain of Homo sapiens (human) Length = 1715 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR626229.1| full-length cDNA clone CS0DF035YB19 of Fetal brain of Homo sapiens (human) Length = 1717 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR622432.1| full-length cDNA clone CS0DF022YE17 of Fetal brain of Homo sapiens (human) Length = 1729 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1434 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1375 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1374 gaagcggccgagaggcgggtactgggagaagctctccac 1336
>emb|CR621513.1| full-length cDNA clone CL0BB003ZA11 of Neuroblastoma of Homo sapiens (human) Length = 1748 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR616067.1| full-length cDNA clone CS0DF027YE14 of Fetal brain of Homo sapiens (human) Length = 1733 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR614088.1| full-length cDNA clone CS0DA011YO22 of Neuroblastoma of Homo sapiens (human) Length = 1681 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1413 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1354 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1353 gaagcggccgagaggcgggtactgggagaagctctccac 1315
>emb|CR613690.1| full-length cDNA clone CS0DA008YL24 of Neuroblastoma of Homo sapiens (human) Length = 1732 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR608520.1| full-length cDNA clone CS0DF026YL10 of Fetal brain of Homo sapiens (human) Length = 1699 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR604699.1| full-length cDNA clone CS0DF031YE07 of Fetal brain of Homo sapiens (human) Length = 1732 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR602821.1| full-length cDNA clone CS0DF033YL04 of Fetal brain of Homo sapiens (human) Length = 1757 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1433 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1374 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1373 gaagcggccgagaggcgggtactgggagaagctctccac 1335
>emb|CR600141.1| full-length cDNA clone CS0DF036YB07 of Fetal brain of Homo sapiens (human) Length = 1762 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1433 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1374 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1373 gaagcggccgagaggcgggtactgggagaagctctccac 1335
>emb|CR597004.1| full-length cDNA clone CS0DA004YG17 of Neuroblastoma of Homo sapiens (human) Length = 1722 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR593279.1| full-length cDNA clone CS0DF032YD11 of Fetal brain of Homo sapiens (human) Length = 1717 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR592792.1| full-length cDNA clone CS0DF008YI21 of Fetal brain of Homo sapiens (human) Length = 1732 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>emb|CR589974.1| full-length cDNA clone CS0DF034YE11 of Fetal brain of Homo sapiens (human) Length = 1709 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1404 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1345 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1344 gaagcggccgagaggcgggtactgggagaagctctccac 1306
>ref|NM_001958.2| Homo sapiens eukaryotic translation elongation factor 1 alpha 2 (EEF1A2), mRNA Length = 1841 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1498 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1439 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1438 gaagcggccgagaggcgggtactgggagaagctctccac 1400
>gb|AY891430.1| Synthetic construct Homo sapiens clone FLH117043.01L eukaryotic translation elongation factor 1 alpha 2 (EEF1A2) mRNA, partial cds Length = 1392 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1332 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1273 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1272 gaagcggccgagaggcgggtactgggagaagctctccac 1234
>gb|AY891104.1| Synthetic construct Homo sapiens clone FLH007860.01L eukaryotic translation elongation factor 1 alpha 2 (EEF1A2) mRNA, partial cds Length = 1392 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1332 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1273 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1272 gaagcggccgagaggcgggtactgggagaagctctccac 1234
>gb|AY891103.1| Synthetic construct Homo sapiens clone FLH007859.01L eukaryotic translation elongation factor 1 alpha 2 (EEF1A2) mRNA, partial cds Length = 1392 Score = 109 bits (55), Expect = 8e-21 Identities = 88/99 (88%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1332 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1273 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1272 gaagcggccgagaggcgggtactgggagaagctctccac 1234
>gb|AF181492.1|AF181492 Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds Length = 1686 Score = 109 bits (55), Expect = 8e-21 Identities = 169/207 (81%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 |||||||||||| | ||||| |||||| |||||||| || || || ||||||||||| || Sbjct: 1383 tcatttcttcttcacagcagacttggtaaccttggctccagtgggatccttcttctcaac 1324 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 ||||||| || || || ||||| |||||||||||||| | ||| ||||| | ||||| Sbjct: 1323 attcttgatgacaccgacagcaacagtctgcctcatgtccctcacagcaaacctccccag 1264 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 ||||| |||| ||||||||||| |||||||||||||| || || |||||||| || | Sbjct: 1263 tggaggatactcagcgaaggtctcaaccaccatcggcttagtcggaatcatcttcaccat 1204 Query: 409 cccggcgtcaccattcttgaggaactt 435 || || ||||||||||| || ||||| Sbjct: 1203 accagcatcaccattcttcagaaactt 1177
>gb|BT016242.1| Zea mays clone Contig75 mRNA sequence Length = 1421 Score = 105 bits (53), Expect = 1e-19 Identities = 158/193 (81%) Strand = Plus / Minus Query: 247 agccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgcccac 306 |||||||||||||||||| || || || |||||||||||||| |||||||| || || || Sbjct: 1179 agccttggtcaccttggctccagttgggtccttcttctccacactcttgatgactccgac 1120 Query: 307 ggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcgaa 366 || ||||| |||||||||||||| || |||||||| || || ||||| || | | || Sbjct: 1119 agccaccgtttgcctcatgtcacggacagcaaagcgaccaagaggaggatattcagaaaa 1060 Query: 367 ggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattctt 426 ||||||||| ||||| ||||| ||||| | |||||| || | || || ||||||||||| Sbjct: 1059 ggtctccactaccatgggcttagtgggaaccatcttcaccataccagcatcaccattctt 1000 Query: 427 gaggaacttgggc 439 ||| || |||||| Sbjct: 999 gagaaatttgggc 987
>gb|DQ174256.1| Gossypium hirsutum translation elongation factor 1A-7 (EF1A7) mRNA, complete cds Length = 1617 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 ||||||| ||||| ||||||||||||||| || || || |||||||||||||| ||||| Sbjct: 1338 cttcttggcagcagacttggtcaccttggctccagttgggtccttcttctccacactctt 1279 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| ||||| |||||||| | |||||||| || || || ||||| Sbjct: 1278 gattacaccaacagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagg 1219 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggt 390 ||||| || |||||| ||||| ||||| |||||||| Sbjct: 1218 gtactcggagaaggtttccacaaccatgggcttggt 1183
>gb|AY039764.1| Sinapis arvensis elongation factor-1 alpha mRNA, partial cds Length = 523 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| |||||||||||||||||||| ||||| || |||||||| ||||||||||| Sbjct: 258 cttcttgacggcagccttggtcaccttggctccggttgggtccttcttgtccacgctctt 199 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || ||||| || Sbjct: 198 gatgacaccgactgcaacagtctgcctcatgtcccccacagcgaaacgtccaaggggtgg 139 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggt 390 ||||| | ||| ||||| || ||||| |||||||| Sbjct: 138 gtactcagagaatgtctcgacaaccatgggcttggt 103
>dbj|AB073631.1| Salsola komarovii skef-1A mRNA for eukaryotic elongation factor 1A, complete cds Length = 1646 Score = 103 bits (52), Expect = 5e-19 Identities = 133/160 (83%) Strand = Plus / Minus Query: 231 atttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgc 290 |||||||||| | ||||||||||| ||||||||||| || || ||||||||||| || Sbjct: 1364 atttcttcttaagggcagccttggtgaccttggcaccagttgggtccttcttctcaacat 1305 Query: 291 tcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggg 350 ||||||| || || || ||||| || ||||||||||| | ||||||||| || || |||| Sbjct: 1304 tcttgatgacaccaacagcaacagtttgcctcatgtccctcacggcaaaacgaccaaggg 1245 Query: 351 gagggtactgggcgaaggtctccaccaccatcggcttggt 390 | ||||||| | ||| |||||||||||||| |||||||| Sbjct: 1244 gtgggtactccgagaaagtctccaccaccataggcttggt 1205
>gb|BT016891.1| Zea mays clone Contig724 mRNA sequence Length = 521 Score = 101 bits (51), Expect = 2e-18 Identities = 129/155 (83%) Strand = Plus / Plus Query: 248 gccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgcccacg 307 ||||||||||||||||| |||| || ||||||||||||| |||||||| | || || Sbjct: 321 gccttggtcaccttggcgccgggtggggccttcttctccacactcttgatgagtccaaca 380 Query: 308 gcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcgaag 367 |||||||||||||||||||| || |||| ||| | ||||||||||| ||| || ||| Sbjct: 381 gcaaccgtctgcctcatgtcgcggacgggaaacctacccaggggaggatacgcggagaat 440 Query: 368 gtctccaccaccatcggcttggtggggatcatctt 402 | |||||||||||| || |||| |||||||||||| Sbjct: 441 ggctccaccaccatagggttgggggggatcatctt 475
>gb|DQ174251.1| Gossypium hirsutum translation elongation factor 1A-2 (EF1A2) mRNA, complete cds Length = 1566 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Minus Query: 244 agcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgcc 303 ||||| |||||| |||||||||||||| || ||||||||||| || |||||||| || || Sbjct: 1329 agcagacttggtgaccttggcaccggttgggtccttcttctcgacactcttgataacacc 1270 Query: 304 cacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggc 363 || || || ||||| | |||||| | ||| ||||| || |||||||| ||||||| | Sbjct: 1269 aacagccacggtctgacgcatgtccctcacagcaaaacgacccaggggtgggtactcaga 1210 Query: 364 gaaggtctccaccaccatcggcttggtggggatcatctt 402 |||||||||||| ||||| |||||||| || |||||||| Sbjct: 1209 gaaggtctccacaaccatgggcttggtaggaatcatctt 1171
>ref|NM_001037464.1| Bos taurus eukaryotic translation elongation factor 1 alpha 2 (EEF1A2), mRNA Length = 1852 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| |||||| |||||||| Sbjct: 1436 cttcttctccacgttcttgatgacgcccacggccactgtctgccgcatgtcgcgcacggc 1377 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1376 gaagcggccgagaggtgggtactgggagaagctctccac 1338
>emb|X70940.1|HSEFAC1A2 H.sapiens mRNA for elongation factor 1 alpha-2 Length = 1755 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 |||||| |||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1415 cttcttttccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1356 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1355 gaagcggccgagaggcgggtactgggagaagctctccac 1317
>gb|BC108110.1| Bos taurus cDNA clone MGC:128473 IMAGE:7984422, complete cds Length = 1852 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| |||||| |||||||| Sbjct: 1436 cttcttctccacgttcttgatgacgcccacggccactgtctgccgcatgtcgcgcacggc 1377 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1376 gaagcggccgagaggtgggtactgggagaagctctccac 1338
>gb|BC074016.1| Rattus norvegicus eukaryotic translation elongation factor 1 alpha 2, mRNA (cDNA clone MGC:91772 IMAGE:7105980), complete cds Length = 2035 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| |||||| |||||||| Sbjct: 1659 cttcttctccacgttcttgatgacgcccacggccacagtctgccgcatgtcgcgcacggc 1600 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| ||||| |||||||| | |||| ||||||| Sbjct: 1599 gaagcggccgaggggtgggtactgtgagaagctctccac 1561
>ref|NM_012660.2| Rattus norvegicus eukaryotic translation elongation factor 1 alpha 2 (Eef1a2), mRNA Length = 2035 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| |||||| |||||||| Sbjct: 1659 cttcttctccacgttcttgatgacgcccacggccacagtctgccgcatgtcgcgcacggc 1600 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| ||||| |||||||| | |||| ||||||| Sbjct: 1599 gaagcggccgaggggtgggtactgtgagaagctctccac 1561
>gb|L26479.1|MUSMS1X Mouse elongation factor-1 alpha (MS1) mRNA, complete cds Length = 1782 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| |||||| |||||||| Sbjct: 1465 cttcttctccacgttcttgatgacgcccacggccacagtctgccgcatgtctcgcacggc 1406 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| ||||| |||||||| | |||| ||||||| Sbjct: 1405 gaagcggccgaggggtgggtactgtgagaagctctccac 1367
>gb|L10340.1|HUMHS1X Human elongation factor-1 alpha (ef-1) mRNA, 3' end Length = 1590 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| ||||||| Sbjct: 1249 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgggcacggc 1190 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||||| |||| ||||||| Sbjct: 1189 gaagcggccgagaggcgggtactgggagaagctctccac 1151
>gb|M62751.1|RATPS1 Rat statin-related protein mRNA, complete CDS Length = 1719 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| |||||| |||||||| Sbjct: 1446 cttcttctccacgttcttgatgacgcccacggccacagtctgccgcatgtcgcgcacggc 1387 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| ||||| |||||||| | |||| ||||||| Sbjct: 1386 gaagcggccgaggggtgggtactgtgagaagctctccac 1348
>gb|DQ174253.1| Gossypium hirsutum translation elongation factor 1A-4 (EF1A4) mRNA, complete cds Length = 1565 Score = 99.6 bits (50), Expect = 8e-18 Identities = 173/214 (80%) Strand = Plus / Minus Query: 226 atctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctc 285 |||||||||||||||| ||||| ||||| ||||| |||||||| || ||||||||||| Sbjct: 1347 atctcatttcttcttggcagcagatttggtgaccttagcaccggttggatccttcttctc 1288 Query: 286 cacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcc 345 ||||||||||| || || || || || ||||| | |||||| | || ||||| || || Sbjct: 1287 aacgctcttgatgacaccaacagccacagtctgacgcatgtccctgacagcaaaccgtcc 1228 Query: 346 caggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgac 405 ||||| ||||||| | ||| |||||||| ||||| ||||||||||| | |||||| | Sbjct: 1227 aaggggtgggtactcagagaaagtctccacaaccataggcttggtgggaaccatctttat 1168 Query: 406 gaacccggcgtcaccattcttgaggaacttgggc 439 | ||| || ||||||||||| | |||||||||| Sbjct: 1167 catccctgcatcaccattcttcaagaacttgggc 1134
>gb|DQ174250.1| Gossypium hirsutum translation elongation factor 1A-1 (EF1A1) mRNA, complete cds Length = 1567 Score = 99.6 bits (50), Expect = 8e-18 Identities = 173/214 (80%) Strand = Plus / Minus Query: 226 atctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctc 285 |||||||||||||||| ||||| ||||| ||||| |||||||| || ||||||||||| Sbjct: 1347 atctcatttcttcttggcagcagatttggtgaccttagcaccggttggatccttcttctc 1288 Query: 286 cacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcc 345 ||||||||||| || || || || || ||||| | |||||| | || ||||| || || Sbjct: 1287 aacgctcttgatgacaccaacagccacagtctgacgcatgtccctgacagcaaaccgtcc 1228 Query: 346 caggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgac 405 ||||| ||||||| | ||| |||||||| ||||| ||||||||||| | |||||| | Sbjct: 1227 aaggggtgggtactcagagaaagtctccacaaccataggcttggtgggaaccatctttat 1168 Query: 406 gaacccggcgtcaccattcttgaggaacttgggc 439 | ||| || ||||||||||| | |||||||||| Sbjct: 1167 catccctgcatcaccattcttcaagaacttgggc 1134
>gb|AY962821.1| Prunus armeniaca elongation factor 1 alpha mRNA, partial cds Length = 314 Score = 99.6 bits (50), Expect = 8e-18 Identities = 140/170 (82%) Strand = Plus / Minus Query: 233 ttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctc 292 ||||||||| ||||| |||||| ||||||||||| | || |||||||||||||||||| Sbjct: 255 ttcttcttggcagcagacttggtgaccttggcaccactgggatccttcttctccacgctc 196 Query: 293 ttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccagggga 352 ||||| || || || ||||| ||||| | ||||||||| || ||||| || |||| ||| Sbjct: 195 ttgataacaccaacagcaacagtctgacgcatgtcacggacagcaaaacgacccaatgga 136 Query: 353 gggtactgggcgaaggtctccaccaccatcggcttggtggggatcatctt 402 ||||||| | ||| || ||||| ||||| ||||||||||| | |||||| Sbjct: 135 gggtactcagagaaagtttccacaaccatgggcttggtgggaagcatctt 86
>ref|NM_100666.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07920 mRNA, complete cds Length = 1782 Score = 97.6 bits (49), Expect = 3e-17 Identities = 166/205 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| ||||| || |||||||| || || ||||| Sbjct: 1450 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1391 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1390 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1331 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1330 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1271 Query: 415 gtcaccattcttgaggaacttgggc 439 ||||||||||| | |||||||||| Sbjct: 1270 atcaccattcttcaagaacttgggc 1246
>emb|X16431.1|ATEF1A23 A.thaliana A2 and A3 genes encoding elongation factor 1-alpha Length = 6022 Score = 97.6 bits (49), Expect = 3e-17 Identities = 166/205 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| ||||| || |||||||| || || ||||| Sbjct: 1910 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1851 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1850 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1791 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1790 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1731 Query: 415 gtcaccattcttgaggaacttgggc 439 ||||||||||| | |||||||||| Sbjct: 1730 atcaccattcttcaagaacttgggc 1706 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 5331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 5272 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 5271 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 5212 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 5211 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 5152 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 5151 ttcaagaatttgggc 5137
>dbj|AK221085.1| Arabidopsis thaliana mRNA for elongation factor 1-alpha, complete cds, clone: RAFL22-81-H15 Length = 630 Score = 97.6 bits (49), Expect = 3e-17 Identities = 166/205 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| ||||| || |||||||| || || ||||| Sbjct: 358 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 299 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 298 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 239 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 238 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 179 Query: 415 gtcaccattcttgaggaacttgggc 439 ||||||||||| | |||||||||| Sbjct: 178 atcaccattcttcaagaacttgggc 154
>gb|AY088358.1| Arabidopsis thaliana clone 6135 mRNA, complete sequence Length = 1687 Score = 97.6 bits (49), Expect = 3e-17 Identities = 166/205 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| ||||| || |||||||| || || ||||| Sbjct: 1419 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1360 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1359 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1300 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1299 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1240 Query: 415 gtcaccattcttgaggaacttgggc 439 ||||||||||| | |||||||||| Sbjct: 1239 atcaccattcttcaagaacttgggc 1215
>gb|BT002442.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07940) mRNA, complete cds Length = 1704 Score = 97.6 bits (49), Expect = 3e-17 Identities = 166/205 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| ||||| || |||||||| || || ||||| Sbjct: 1418 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1359 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1358 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1299 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1298 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1239 Query: 415 gtcaccattcttgaggaacttgggc 439 ||||||||||| | |||||||||| Sbjct: 1238 atcaccattcttcaagaacttgggc 1214
>gb|BT002423.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07920) mRNA, complete cds Length = 1664 Score = 97.6 bits (49), Expect = 3e-17 Identities = 166/205 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| ||||| || |||||||| || || ||||| Sbjct: 1418 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1359 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1358 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1299 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1298 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1239 Query: 415 gtcaccattcttgaggaacttgggc 439 ||||||||||| | |||||||||| Sbjct: 1238 atcaccattcttcaagaacttgggc 1214
>gb|AC026875.4|AC026875 Genomic sequence for Arabidopsis thaliana BAC T6D22 from chromosome I, complete sequence Length = 120965 Score = 97.6 bits (49), Expect = 3e-17 Identities = 166/205 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| ||||| || |||||||| || || ||||| Sbjct: 12884 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 12825 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 12824 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 12765 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 12764 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 12705 Query: 415 gtcaccattcttgaggaacttgggc 439 ||||||||||| | |||||||||| Sbjct: 12704 atcaccattcttcaagaacttgggc 12680 Score = 79.8 bits (40), Expect = 7e-12 Identities = 154/192 (80%) Strand = Plus / Plus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| || || || |||||||| || || ||||| Sbjct: 19257 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 19316 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 19317 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 19376 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 19377 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 19436 Query: 415 gtcaccattctt 426 ||||||||||| Sbjct: 19437 atcaccattctt 19448 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 16331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 16272 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 16271 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 16212 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 16211 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 16152 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 16151 ttcaagaatttgggc 16137
>gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, AT.I.24-3, AT.I.24-4, AT.I.24-5, AT.I.24-6, AT.I.24-9 and AT.I.24-14 genes, partial cds, AT.I.24-7, ascorbate peroxidase (ATHAPX1), EF-1alpha-A1, -A2 and -A3 (EF-1alpha) and AT.I.24-13 genes, complete cds Length = 63093 Score = 97.6 bits (49), Expect = 3e-17 Identities = 166/205 (80%) Strand = Plus / Plus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| ||||| || |||||||| || || ||||| Sbjct: 47828 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 47887 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 47888 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 47947 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 47948 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 48007 Query: 415 gtcaccattcttgaggaacttgggc 439 ||||||||||| | |||||||||| Sbjct: 48008 atcaccattcttcaagaacttgggc 48032 Score = 79.8 bits (40), Expect = 7e-12 Identities = 154/192 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| || || || |||||||| || || ||||| Sbjct: 41467 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 41408 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 41407 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 41348 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 41347 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 41288 Query: 415 gtcaccattctt 426 ||||||||||| Sbjct: 41287 atcaccattctt 41276 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Plus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 44398 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 44457 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 44458 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 44517 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 44518 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 44577 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 44578 ttcaagaatttgggc 44592
>gb|DQ174254.1| Gossypium hirsutum translation elongation factor 1A-5 (EF1A5) mRNA, complete cds Length = 1738 Score = 95.6 bits (48), Expect = 1e-16 Identities = 129/156 (82%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 ||||||| ||||| ||| ||||||||||| || || || |||||||||||||| ||||| Sbjct: 1338 cttcttggcagcagacttcgtcaccttggctccagttgggtccttcttctccacactctt 1279 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 |||||| || || ||||| ||||| |||||||| | |||||||| || || || ||||| Sbjct: 1278 gatcacaccaacagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagg 1219 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggt 390 ||||| || ||| || ||||| ||||| |||||||| Sbjct: 1218 gtactcggagaaagtttccacaaccatgggcttggt 1183
>gb|DQ174252.1| Gossypium hirsutum translation elongation factor 1A-3 (EF1A3) mRNA, complete cds Length = 1711 Score = 95.6 bits (48), Expect = 1e-16 Identities = 129/156 (82%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 ||||||| ||||| ||||||||||||||| || || || |||||||||||||| ||||| Sbjct: 1338 cttcttggcagcagacttggtcaccttggctccagttgggtccttcttctccacactctt 1279 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 |||||| || || ||||| ||||| |||||||| | |||||||| || || || ||||| Sbjct: 1278 gatcacaccaacagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagg 1219 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggt 390 |||| || |||||| || || ||||| |||||||| Sbjct: 1218 gtacgcggagaaggtttctacaaccatgggcttggt 1183
>gb|AF464925.1| Elaeis oleifera elongation factor 1-alpha mRNA, complete cds Length = 1805 Score = 95.6 bits (48), Expect = 1e-16 Identities = 156/192 (81%) Strand = Plus / Minus Query: 248 gccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgcccacg 307 |||||||| | ||||||||| || || ||||||||||||||||||||||| || ||||| Sbjct: 1381 gccttggtgatcttggcaccagttggatccttcttctccacgctcttgatgacacccact 1322 Query: 308 gcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcgaag 367 || || ||||| | |||||| | ||| ||||| || || || || ||||||| | |||| Sbjct: 1321 gctacggtctggcgcatgtccctcacagcaaatcgaccaagaggggggtactcagagaag 1262 Query: 368 gtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattcttg 427 ||||| || ||||| ||||||||||| | |||||| || || || || ||||||||||| Sbjct: 1261 gtctcaacaaccatgggcttggtgggaagcatcttcacaaaacctgcatcaccattcttt 1202 Query: 428 aggaacttgggc 439 | ||||||||| Sbjct: 1201 aaaaacttgggc 1190
>dbj|AB098024.1| Porphyra yezoensis EF-1a gene for elongation factor-1a, complete cds Length = 2218 Score = 95.6 bits (48), Expect = 1e-16 Identities = 99/116 (85%) Strand = Plus / Minus Query: 274 ctccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcac 333 ||||||||||||||| |||||| || || || || |||||||| | |||||||||||| Sbjct: 1867 ctccttcttctccaccgacttgatgacaccaacagcgaccgtctggcgcatgtcacgcac 1808 Query: 334 ggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccatcggcttgg 389 ||||||||||||||| || |||||||||| ||||| |||||| ||||||||||| Sbjct: 1807 ggcaaagcggcccagcggcgggtactgggtgaaggcctccacgcacatcggcttgg 1752
>dbj|AB048204.1| Porphyra yezoensis EF-1a mRNA for elongation factor 1-alpha, complete cds Length = 1644 Score = 95.6 bits (48), Expect = 1e-16 Identities = 99/116 (85%) Strand = Plus / Minus Query: 274 ctccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcac 333 ||||||||||||||| |||||| || || || || |||||||| | |||||||||||| Sbjct: 1389 ctccttcttctccaccgacttgatgacaccaacagcgaccgtctggcgcatgtcacgcac 1330 Query: 334 ggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccatcggcttgg 389 ||||||||||||||| || |||||||||| ||||| |||||| ||||||||||| Sbjct: 1329 ggcaaagcggcccagcggcgggtactgggtgaaggcctccacgcacatcggcttgg 1274
>gb|BC018235.1| Mus musculus eukaryotic translation elongation factor 1 alpha 2, mRNA (cDNA clone MGC:25318 IMAGE:4504385), complete cds Length = 2111 Score = 93.7 bits (47), Expect = 5e-16 Identities = 86/99 (86%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| |||||| |||||||| Sbjct: 1699 cttcttctccacgttcttgatgacgcccacggccacagtctgccgcatgtcgcgcacggc 1640 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||| | |||| ||||||| Sbjct: 1639 gaagcggccgagaggtgggtactgtgagaagctctccac 1601
>gb|AY300042.1| Solanum tuberosum putative translation elongation factor protein mRNA, partial cds Length = 864 Score = 93.7 bits (47), Expect = 5e-16 Identities = 155/191 (81%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||||||||||||||| || || |||||||| || ||| |||||| || || Sbjct: 845 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacgttcttgacaacacca 786 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| || ||||||||||| | ||| ||||| || |||| || ||||||| || Sbjct: 785 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtactcagca 726 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 |||||||| || ||||| ||||||||||| |||||||| || | || || ||||||||| Sbjct: 725 aaggtctcaacaaccataggcttggtgggaatcatcttaaccatacctgcatcaccattc 666 Query: 425 ttgaggaactt 435 || | |||||| Sbjct: 665 ttcaagaactt 655
>gb|BT012707.1| Lycopersicon esculentum clone 113585F, mRNA sequence Length = 1768 Score = 93.7 bits (47), Expect = 5e-16 Identities = 155/191 (81%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| ||||||||||| || || |||||||| || || |||||| || ||| Sbjct: 1414 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacaccc 1355 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | ||| ||||| || |||| || ||||| | ||| Sbjct: 1354 acagcaacagtctgcctcatgtccctcacagcaaaacgacccaatggtgggtattcggca 1295 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 |||||||| || ||||| ||||||||||| |||||||| || | || || ||||||||| Sbjct: 1294 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccattc 1235 Query: 425 ttgaggaactt 435 || | |||||| Sbjct: 1234 ttcaagaactt 1224
>ref|NM_007906.2| Mus musculus eukaryotic translation elongation factor 1 alpha 2 (Eef1a2), mRNA Length = 2111 Score = 93.7 bits (47), Expect = 5e-16 Identities = 86/99 (86%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| |||||| |||||||| Sbjct: 1699 cttcttctccacgttcttgatgacgcccacggccacagtctgccgcatgtcgcgcacggc 1640 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 |||||||| || || |||||||| | |||| ||||||| Sbjct: 1639 gaagcggccgagaggtgggtactgtgagaagctctccac 1601
>dbj|AB214933.1| Raja kenojei EF-1a mRNA for elongation factor 1 alpha, complete cds Length = 664 Score = 93.7 bits (47), Expect = 5e-16 Identities = 86/99 (86%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| |||||||||||||||| || |||||||||| |||||| ||||| || Sbjct: 348 cttcttctccacgttcttgatcacgcccaccgccaccgtctgccgcatgtcccgcaccgc 289 Query: 337 aaagcggcccaggggagggtactgggcgaaggtctccac 375 ||||||||| || || || |||| || |||| ||||||| Sbjct: 288 aaagcggccgagagggggatacttggagaagctctccac 250
>gb|U04632.1|NTU04632 Nicotiana tabacum Wisconsin 38 vitronectin-like adhesion protein mRNA, complete cds Length = 1776 Score = 93.7 bits (47), Expect = 5e-16 Identities = 170/211 (80%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 |||||||||||| |||||||||||| ||||||||||| || || |||||||| || || Sbjct: 1439 tcatttcttcttctgagcagccttggtgaccttggcaccagttgggtccttcttgtcaac 1380 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | ||||||| || || || ||||| || || | |||||| | ||| ||||| || |||| Sbjct: 1379 gttcttgataacaccaacagcaacagtttgacgcatgtccctcacagcaaaacgtcccaa 1320 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 || ||||||| | ||||||||| || ||||| ||||||||||| |||||||| || | Sbjct: 1319 tggtgggtactcagagaaggtctcaacaaccatgggcttggtgggaatcatcttaaccat 1260 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||||||||| | |||||||||| Sbjct: 1259 accagcatcaccattcttcaagaacttgggc 1229
>dbj|D63396.1|TOBBY2A Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds Length = 1671 Score = 93.7 bits (47), Expect = 5e-16 Identities = 170/211 (80%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 |||||||||||| |||||||||||| ||||||||||| || || |||||||| || || Sbjct: 1371 tcatttcttcttctgagcagccttggtgaccttggcaccagttgggtccttcttgtcaac 1312 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | ||||||| || || || ||||| || || | |||||| | ||| ||||| || |||| Sbjct: 1311 gttcttgataacaccaacagcaacagtttgacgcatgtccctcacagcaaaacgtcccaa 1252 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 || ||||||| | ||||||||| || ||||| ||||||||||| |||||||| || | Sbjct: 1251 tggtgggtactcagagaaggtctcaacaaccatgggcttggtgggaatcatcttaaccat 1192 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||||||||| | |||||||||| Sbjct: 1191 accagcatcaccattcttcaagaacttgggc 1161
>emb|X53043.1|LEEF1A L.esculentum gene for elongation factor 1-alpha Length = 4565 Score = 91.7 bits (46), Expect = 2e-15 Identities = 130/158 (82%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||||||||||||||| || || |||||||| || || |||||| || || Sbjct: 3861 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 3802 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | ||| ||||| || |||| |||||||| | || Sbjct: 3801 acagcaacagtctgcctcatgtccctcacagcaaaacgacccaatggagggtattcagca 3742 Query: 365 aaggtctccaccaccatcggcttggtggggatcatctt 402 |||||||| || ||||| ||||||||||| |||||||| Sbjct: 3741 aaggtctcaacaaccatgggcttggtgggaatcatctt 3704
>emb|X14449.1|LELEEF1 Tomato LeEF-1 mRNA for elongation factor 1 alpha Length = 1692 Score = 91.7 bits (46), Expect = 2e-15 Identities = 130/158 (82%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||||||||||||||| || || |||||||| || || |||||| || || Sbjct: 1388 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1329 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | ||| ||||| || |||| |||||||| | || Sbjct: 1328 acagcaacagtctgcctcatgtccctcacagcaaaacgacccaatggagggtattcagca 1269 Query: 365 aaggtctccaccaccatcggcttggtggggatcatctt 402 |||||||| || ||||| ||||||||||| |||||||| Sbjct: 1268 aaggtctcaacaaccatgggcttggtgggaatcatctt 1231
>emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K14 on chromosome 20 Contains the C20orf148 gene for a novel tyrosine kinase, the PTK6 gene for protein tyrosine kinase 6, a novel gene, the EEF1A2 gene for eukaryotic translation elongation factor 1 alpha 2, the 5' end of the KCNQ2 gene for potassium voltage-gated channel (KQT-like subfamily member 2), the gene for peroxisomal proliferator-activated receptor A interacting complex 285 (PRIC285)(FLJ00244, KIAA1769), the C20orf149 gene, the gene for novel protein MGC5356 (MGC5356), the gene for a novel protein (LOC200213), a novel gene and thirteen CpG islands, complete sequence Length = 113196 Score = 89.7 bits (45), Expect = 7e-15 Identities = 63/69 (91%) Strand = Plus / Plus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 17363 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 17422 Query: 337 aaagcggcc 345 |||||||| Sbjct: 17423 gaagcggcc 17431
>emb|CR597303.1| full-length cDNA clone CS0DF022YM13 of Fetal brain of Homo sapiens (human) Length = 1526 Score = 89.7 bits (45), Expect = 7e-15 Identities = 63/69 (91%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 1203 cttcttctccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 1144 Query: 337 aaagcggcc 345 |||||||| Sbjct: 1143 gaagcggcc 1135
>dbj|AB073629.1| Bruguiera sexangula bsef-1A mRNA for eukaryotic elongation factor 1A, complete cds Length = 1664 Score = 89.7 bits (45), Expect = 7e-15 Identities = 135/165 (81%) Strand = Plus / Minus Query: 275 tccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacg 334 ||||| ||||| || |||||||| || ||||| ||||| ||||| | |||||| | ||| Sbjct: 1331 tcctttttctcgacactcttgatgactcccactgcaacagtctggcgcatgtccctgacg 1272 Query: 335 gcaaagcggcccaggggagggtactgggcgaaggtctccaccaccatcggcttggtgggg 394 ||||| | || || ||||| |||| || ||| || ||||||||||| |||||||| || Sbjct: 1271 gcaaatctaccaagcggaggatactcggagaaagtttccaccaccataggcttggtcgga 1212 Query: 395 atcatcttgacgaacccggcgtcaccattcttgaggaacttgggc 439 |||||||| |||||||| || ||||||||||| | |||||||||| Sbjct: 1211 atcatcttcacgaacccagcatcaccattcttcaagaacttgggc 1167
>gb|AY422992.1| Danio rerio eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) mRNA, complete cds Length = 1721 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 278 ttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggca 337 |||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||| ||| Sbjct: 1363 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1304 Query: 338 aagcggcccaggggagggta 357 ||||| || || |||||||| Sbjct: 1303 aagcgaccaagaggagggta 1284
>gb|BC064291.1| Danio rerio elongation factor 1-alpha, mRNA (cDNA clone MGC:77644 IMAGE:6996963), complete cds Length = 1760 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 278 ttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggca 337 |||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||| ||| Sbjct: 1384 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1325 Query: 338 aagcggcccaggggagggta 357 ||||| || || |||||||| Sbjct: 1324 aagcgaccaagaggagggta 1305
>ref|NM_131263.1| Danio rerio elongation factor 1-alpha (ef1a), mRNA Length = 1753 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 278 ttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggca 337 |||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||| ||| Sbjct: 1405 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1346 Query: 338 aagcggcccaggggagggta 357 ||||| || || |||||||| Sbjct: 1345 aagcgaccaagaggagggta 1326
>gb|AY264201.1| Amblydoras cf. monitor elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1168 Score = 87.7 bits (44), Expect = 3e-14 Identities = 59/64 (92%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| | Sbjct: 1168 ccttcttctcgacgctcttgatgacgccgacggcaacggtctgcctcatgtcacgcacag 1109 Query: 336 caaa 339 |||| Sbjct: 1108 caaa 1105
>gb|AY264200.1| Amblydoras nauticus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1154 Score = 87.7 bits (44), Expect = 3e-14 Identities = 59/64 (92%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| | Sbjct: 1154 ccttcttctcgacgctcttgatgacgccaacggcaacggtctgcctcatgtcacgcacag 1095 Query: 336 caaa 339 |||| Sbjct: 1094 caaa 1091
>gb|DQ174258.1| Gossypium hirsutum translation elongation factor 1A-9 (EF1A9) mRNA, complete cds Length = 1734 Score = 87.7 bits (44), Expect = 3e-14 Identities = 128/156 (82%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 ||||||| ||||| ||| ||||||||||| || || || |||||||||||||| ||||| Sbjct: 1338 cttcttggcagcagacttcgtcaccttggctccagttgggtccttcttctccacactctt 1279 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 |||||| || || ||||| ||||| |||||||| | |||||||| || || || ||||| Sbjct: 1278 gatcacaccaacagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagg 1219 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggt 390 ||||| || ||| || ||||| | ||| |||||||| Sbjct: 1218 gtactcggagaaagtttccacaagcatgggcttggt 1183
>emb|X77689.1|BREF1MRN B.rerio ef-1 alpha mRNA Length = 1729 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 278 ttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggca 337 |||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||| ||| Sbjct: 1372 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1313 Query: 338 aagcggcccaggggagggta 357 ||||| || || |||||||| Sbjct: 1312 aagcgaccaagaggagggta 1293
>gb|DQ083545.1| Danio rerio eukaryotic translation elongation factor 1 alpha 1 mRNA, complete cds Length = 1455 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 278 ttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggca 337 |||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||| ||| Sbjct: 1397 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1338 Query: 338 aagcggcccaggggagggta 357 ||||| || || |||||||| Sbjct: 1337 aagcgaccaagaggagggta 1318
>dbj|AB183717.1| Lethenteron japonicum LjEF-1a mRNA for elongation factor-1 alpha, complete cds Length = 1751 Score = 87.7 bits (44), Expect = 3e-14 Identities = 86/100 (86%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || || || || ||||||||||||||||||||||||| Sbjct: 1428 ccttcttctcgacggccttgatgacaccaacagccaccgtctgcctcatgtcacgcacgg 1369 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 ||||||| |||||||| ||||| | || |||| ||||||| Sbjct: 1368 caaagcgtcccaggggtgggtagtcggagaagctctccac 1329
>gb|L23807.1|ZEFEF1AL Danio rerio elongation factor 1 alpha (EFL1-alpha) mRNA, complete cds Length = 1739 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 278 ttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggca 337 |||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||| ||| Sbjct: 1391 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1332 Query: 338 aagcggcccaggggagggta 357 ||||| || || |||||||| Sbjct: 1331 aagcgaccaagaggagggta 1312
>ref|NM_125432.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT5G60390 transcript variant AT5G60390.1 mRNA, complete cds Length = 1761 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1394 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1335 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1334 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1275 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1274 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1215 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1214 ttcaaaaacttgggc 1200
>gb|DQ228328.1| Solanum tuberosum clone 135G05 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1708 Score = 85.7 bits (43), Expect = 1e-13 Identities = 154/191 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| ||||||||||| || || |||||||| || || |||||| ||||| Sbjct: 1390 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacgcca 1331 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| || ||||||||||| | ||| ||||| || |||| || ||||||| || Sbjct: 1330 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtactcagca 1271 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 |||||||| || ||||| ||||||||||| |||||||| || | || || ||||||||| Sbjct: 1270 aaggtctcaacaaccataggcttggtgggaatcatcttaaccatacctgcatcaccattc 1211 Query: 425 ttgaggaactt 435 || | |||||| Sbjct: 1210 ttcaagaactt 1200
>gb|AY264199.1| Amblydoras cf. affinis haplotype II elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1040 Score = 85.7 bits (43), Expect = 1e-13 Identities = 70/79 (88%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||| | Sbjct: 1040 ccttcttctcgacgctcttgatgacgccaacagcaacggtctgcctcatgtcacgcacag 981 Query: 336 caaagcggcccaggggagg 354 |||| || || |||||||| Sbjct: 980 caaaacgaccaaggggagg 962
>gb|BT000688.1| Arabidopsis thaliana clone RAFL08-11-M03 (R11086) putative translation elongation factor eEF-1 alpha chain (gene A4) (At5g60390) mRNA, complete cds Length = 1653 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1211 ttcaaaaacttgggc 1197
>emb|X16432.1|ATEF1AA4 Arabidopsis thaliana EF-1 alpha-A4 (NAEEFTU 4) gene for elongation factor 1-alpha Length = 2594 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 2009 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1950 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1949 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1890 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1889 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1830 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1829 ttcaaaaacttgggc 1815
>gb|AF360167.1| Arabidopsis thaliana putative translation elongation factor eEF-1 alpha chain A4 (At5g60390) mRNA, complete cds Length = 1597 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1389 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1330 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1329 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1270 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1269 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1210 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1209 ttcaaaaacttgggc 1195
>gb|AY140099.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 1601 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1393 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1334 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1333 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1274 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1273 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1214 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1213 ttcaaaaacttgggc 1199
>gb|AY140095.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 1615 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1390 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1331 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1330 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1271 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1270 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1211 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1210 ttcaaaaacttgggc 1196
>gb|AY133532.1| Arabidopsis thaliana At5g60390/muf9_40 mRNA, complete cds Length = 1350 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1268 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1209 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1208 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1149 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1148 ttcaaaaacttgggc 1134
>gb|AY128802.1| Arabidopsis thaliana elongation factor 1-alpha mRNA, complete cds Length = 1526 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1268 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1209 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1208 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1149 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1148 ttcaaaaacttgggc 1134
>gb|AY060564.1| Arabidopsis thaliana AT5g60390/muf9_40 mRNA, complete cds Length = 1595 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1211 ttcaaaaacttgggc 1197
>gb|AF419586.1|AF419586 Arabidopsis thaliana AT5g60390/muf9_40 mRNA, complete cds Length = 1583 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1211 ttcaaaaacttgggc 1197
>gb|AY059904.1| Arabidopsis thaliana elongation factor 1-alpha (EF-1-alpha) (MUF9.4) mRNA, complete cds Length = 1616 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1211 ttcaaaaacttgggc 1197
>gb|AF416379.1|AF416379 Leishmania donovani elongation factor 1-alpha mRNA, partial cds Length = 1347 Score = 85.7 bits (43), Expect = 1e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 274 ctccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcac 333 ||||||||| | ||||| |||||| | ||||||||| |||||||||| |||||| ||||| Sbjct: 1299 ctccttcttgttcacgcccttgatgatgcccacggccaccgtctgccgcatgtcgcgcac 1240 Query: 334 ggcaaagcggcccag 348 ||||||||||||||| Sbjct: 1239 ggcaaagcggcccag 1225
>dbj|AK221176.1| Arabidopsis thaliana mRNA for translation elongation factor eEF-1 alpha chain, partial cds, clone: RAFL22-97-N17 Length = 623 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 410 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 351 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 350 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 291 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 290 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 231 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 230 ttcaaaaacttgggc 216
>gb|BT006369.1| Arabidopsis thaliana At5g60390/muf9_40 gene, complete cds Length = 1350 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1268 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1209 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1208 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1149 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1148 ttcaaaaacttgggc 1134
>emb|BX829434.1|CNS0A06V Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZG03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1526 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1377 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1318 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1317 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1258 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1257 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1198 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1197 ttcaaaaacttgggc 1183
>gb|BT002510.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 1576 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 1393 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1334 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 1333 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1274 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 1273 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1214 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1213 ttcaaaaacttgggc 1199
>dbj|AB011483.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUF9 Length = 77298 Score = 85.7 bits (43), Expect = 1e-13 Identities = 157/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| || || || |||||||| ||||||||||| || || || Sbjct: 11153 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 11094 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || |||| || ||||||| || | Sbjct: 11093 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 11034 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || ||||| || ||||| |||||||| ||| ||||||| || | || |||||||||||| Sbjct: 11033 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 10974 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 10973 ttcaaaaacttgggc 10959
>gb|DQ174257.1| Gossypium hirsutum translation elongation factor 1A-8 (EF1A8) mRNA, complete cds Length = 1555 Score = 83.8 bits (42), Expect = 5e-13 Identities = 120/146 (82%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 |||| ||||||||||||||| || | || |||||||||||||| ||||||||||| || Sbjct: 1328 gcagacttggtcaccttggctccagatgggtccttcttctccacactcttgatcacacca 1269 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| ||||| |||||||| | |||||||| || || || ||||||||| || | Sbjct: 1268 acagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagggtacgcggag 1209 Query: 365 aaggtctccaccaccatcggcttggt 390 ||||| || || ||||| |||||||| Sbjct: 1208 aaggtttcgacaaccatgggcttggt 1183
>dbj|AB020734.1| Oryzias latipes gene for polypeptide elongation factor 1 alpha, complete cds Length = 10485 Score = 83.8 bits (42), Expect = 5e-13 Identities = 63/70 (90%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 ||||||||||||| ||||||| || || ||||| ||||||||||||||||||||||||| Sbjct: 10254 ccttcttctccacattcttgatgaccccgacggccaccgtctgcctcatgtcacgcacgg 10195 Query: 336 caaagcggcc 345 | |||||||| Sbjct: 10194 cgaagcggcc 10185 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 314 gtctgcctcatgtcacgcacggcaaa 339 |||||||||||||||||||| ||||| Sbjct: 5312 gtctgcctcatgtcacgcacagcaaa 5287
>emb|X96555.1|PSEF1ALPH P.sativum mRNA for elongation factor 1-alpha Length = 1670 Score = 81.8 bits (41), Expect = 2e-12 Identities = 152/189 (80%) Strand = Plus / Minus Query: 251 ttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgcccacggca 310 ||||| |||||||| || || || |||||||||||||| |||||||| || || || ||| Sbjct: 1425 ttggtgaccttggctccagttgggtccttcttctccacactcttgatgactccgacagca 1366 Query: 311 accgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtc 370 || || || |||||||| | ||| ||||| || || || ||||| |||| || || || Sbjct: 1365 acagtttgtctcatgtccctcacagcaaaacgaccaagaggaggatactcagcaaaagtt 1306 Query: 371 tccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattcttgagg 430 ||||||||||| |||||||| || |||||||| || | ||||| ||||||||||| | Sbjct: 1305 tccaccaccatgggcttggttggaatcatcttaaccataccggcatcaccattcttcaaa 1246 Query: 431 aacttgggc 439 ||||||||| Sbjct: 1245 aacttgggc 1237
>gb|AF163763.1|AF163763 Homo sapiens elongation factor 1 A-2 (EF1A-2) gene, complete cds Length = 12124 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Minus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 |||||| |||||| ||||||| ||||| ||||| ||||||||||||||||| |||||||| Sbjct: 11690 cttcttttccacgttcttgatgacgcctacggccaccgtctgcctcatgtcgcgcacggc 11631 Query: 337 aaagcggcc 345 |||||||| Sbjct: 11630 gaagcggcc 11622
>gb|AY157315.1| Stevia rebaudiana elongation factor 1 alpha mRNA, complete cds Length = 1544 Score = 81.8 bits (41), Expect = 2e-12 Identities = 80/93 (86%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||||||||||||| ||||| || |||||||| || || ||||| Sbjct: 1370 cttcttgacagcagccttggtcaccttggctccggttgggtccttcttgtcaacactctt 1311 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtc 327 ||| || || || ||||||||||| | |||||| Sbjct: 1310 gataacaccgactgcaaccgtctgacgcatgtc 1278
>emb|AL450341.10| Mouse DNA sequence from clone RP23-401L17 on chromosome 2, complete sequence Length = 214573 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Plus Query: 277 cttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggc 336 ||||||||||||| ||||||| ||||||||||| || ||||||| |||||| |||||||| Sbjct: 147176 cttcttctccacgttcttgatgacgcccacggccacagtctgccgcatgtcgcgcacggc 147235 Query: 337 aaagcggcc 345 |||||||| Sbjct: 147236 gaagcggcc 147244
>dbj|AB106676.1| Avicennia marina EF1-A mRNA for elongation factor 1A, complete cds Length = 1809 Score = 81.8 bits (41), Expect = 2e-12 Identities = 161/201 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||| | ||| |||||||||||||| ||||| | ||||||||||| ||||||||||| Sbjct: 1491 cttcttaacagcggccttggtcaccttagcacctgaaggctccttcttttccacgctctt 1432 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 || || || || ||||| ||||| | ||| ||||| || ||||| || ||||| || || Sbjct: 1431 tatgacaccaacagcaactgtctgacgcatatcacgaacagcaaaacgacccagtggtgg 1372 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||| | | |||||| ||||| ||||| |||||||| || |||||||| || || || || Sbjct: 1371 gtattcagagaaggtttccacaaccatgggcttggttggaatcatcttcacaaatccagc 1312 Query: 415 gtcaccattcttgaggaactt 435 ||||| ||||| | |||||| Sbjct: 1311 atcaccgttcttcaagaactt 1291
>gb|L47669.1|ZEFEF1A Brachydanio rerio translation elongation factor 1 alpha (EF1a) gene, complete cds Length = 4015 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 278 ttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggca 337 |||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||| ||| Sbjct: 3223 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 3164 Query: 338 aagcg 342 ||||| Sbjct: 3163 aagcg 3159
>ref|NM_001035916.1| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07940 transcript variant AT1G07940.2 mRNA, complete cds Length = 1990 Score = 79.8 bits (40), Expect = 7e-12 Identities = 154/192 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| || || || |||||||| || || ||||| Sbjct: 1581 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1522 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1521 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1462 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1461 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1402 Query: 415 gtcaccattctt 426 ||||||||||| Sbjct: 1401 atcaccattctt 1390
>ref|NM_100668.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07940 transcript variant AT1G07940.1 mRNA, complete cds Length = 1864 Score = 79.8 bits (40), Expect = 7e-12 Identities = 154/192 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| || || || |||||||| || || ||||| Sbjct: 1455 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1396 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1395 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1336 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1335 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1276 Query: 415 gtcaccattctt 426 ||||||||||| Sbjct: 1275 atcaccattctt 1264
>gb|AY264238.1| Leptodoras cf. praelongus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1113 Score = 79.8 bits (40), Expect = 7e-12 Identities = 58/64 (90%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||| | Sbjct: 1113 ccttcttctcaacgctcttgatgacgccaacagcaacggtctgcctcatgtcacgcacag 1054 Query: 336 caaa 339 |||| Sbjct: 1053 caaa 1050
>gb|AY264232.1| Leptodoras juruensis elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1111 Score = 79.8 bits (40), Expect = 7e-12 Identities = 58/64 (90%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || |||||||| |||||||||||||||||||| | Sbjct: 1111 ccttcttctcaacgctcttgatgacaccaacggcaacggtctgcctcatgtcacgcacag 1052 Query: 336 caaa 339 |||| Sbjct: 1051 caaa 1048
>gb|AY264218.1| Doras carinatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1083 Score = 79.8 bits (40), Expect = 7e-12 Identities = 58/64 (90%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || |||||||| |||||||||||||||||||| | Sbjct: 1083 ccttcttctcaacgctcttgatgacaccaacggcaacggtctgcctcatgtcacgcacag 1024 Query: 336 caaa 339 |||| Sbjct: 1023 caaa 1020
>gb|AY264212.1| Orinocodoras eigenmanni elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1126 Score = 79.8 bits (40), Expect = 7e-12 Identities = 58/64 (90%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||||| Sbjct: 1126 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacgg 1067 Query: 336 caaa 339 |||| Sbjct: 1066 caaa 1063
>gb|DQ174255.1| Gossypium hirsutum translation elongation factor 1A-6 (EF1A6) mRNA, complete cds Length = 1499 Score = 79.8 bits (40), Expect = 7e-12 Identities = 142/176 (80%) Strand = Plus / Minus Query: 227 tctcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctcc 286 ||||||||||||||| ||||| ||||| ||||| ||||| || || ||||||||||| Sbjct: 1346 tctcatttcttcttggcagcagatttggtgaccttagcaccagttgggtccttcttctca 1287 Query: 287 acgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggccc 346 || |||||||| || || |||||||| ||||| | ||||||||| || ||||| || || Sbjct: 1286 acactcttgatgacaccgacggcaacagtctggcgcatgtcacggacagcaaaacgtcca 1227 Query: 347 aggggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatctt 402 || || ||||| | | ||| ||||| || ||||| || |||||||| |||||||| Sbjct: 1226 agtggtgggtattcagagaaagtctcaacaaccatgggtttggtgggaatcatctt 1171
>emb|CR734904.2|CNS0GTTZ Tetraodon nigroviridis full-length cDNA Length = 1675 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 1391 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 1332 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 1331 cgaagcggcccagcggggggtactgggagaagctctccac 1292
>emb|CR732122.2|CNS0GRUN Tetraodon nigroviridis full-length cDNA Length = 1411 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 1130 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 1071 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 1070 cgaagcggcccagcggtgggtactgggagaagctctccac 1031
>emb|CR731738.2|CNS0GRJZ Tetraodon nigroviridis full-length cDNA Length = 1028 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 759 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 700 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 699 cgaagcggcccagcggtgggtactgggagaagctctccac 660
>emb|CR730865.2|CNS0GQVQ Tetraodon nigroviridis full-length cDNA Length = 1021 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 772 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 713 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 712 cgaagcggcccagcggtgggtactgggagaagctctccac 673
>emb|CR728539.1|CNS0GP35 Tetraodon nigroviridis full-length cDNA Length = 1395 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || |||||||| || |||||||||||||| ||||| | Sbjct: 1118 ccttcttctcaacggacttgatgacccccacggccacagtctgcctcatgtcccgcacag 1059 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||| ||||| || |||||||||| |||| ||||||| Sbjct: 1058 cgaagcgccccagcggtgggtactgggagaagctctccac 1019
>emb|CR727203.2|CNS0GO21 Tetraodon nigroviridis full-length cDNA Length = 1042 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 768 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 709 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 708 cgaagcggcccagcggtgggtactgggagaagctctccac 669
>emb|CR726822.2|CNS0GNRG Tetraodon nigroviridis full-length cDNA Length = 1067 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 786 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 727 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 726 cgaagcggcccagcggtgggtactgggagaagctctccac 687
>emb|CR725347.2|CNS0GMMH Tetraodon nigroviridis full-length cDNA Length = 1410 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 1129 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 1070 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 1069 cgaagcggcccagcggtgggtactgggagaagctctccac 1030
>emb|CR723455.2|CNS0GL5X Tetraodon nigroviridis full-length cDNA Length = 1068 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 787 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 728 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 727 cgaagcggcccagcggtgggtactgggagaagctctccac 688
>emb|CR703641.2|CNS0G5VP Tetraodon nigroviridis full-length cDNA Length = 844 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 562 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 503 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 502 cgaagcggcccagcggtgggtactgggagaagctctccac 463
>emb|CR677409.2|CNS0FLNH Tetraodon nigroviridis full-length cDNA Length = 664 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 382 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 323 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 322 cgaagcggcccagcggtgggtactgggagaagctctccac 283
>emb|CR674541.2|CNS0FJG3 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 562 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 503 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 502 cgaagcggcccagcggtgggtactgggagaagctctccac 463
>emb|CR672427.2|CNS0FHTD Tetraodon nigroviridis full-length cDNA Length = 907 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 626 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 567 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 566 cgaagcggcccagcggtgggtactgggagaagctctccac 527
>emb|CR664877.2|CNS0FBZN Tetraodon nigroviridis full-length cDNA Length = 633 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 351 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 292 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 291 cgaagcggcccagcggtgggtactgggagaagctctccac 252
>emb|CR661408.2|CNS0F9BA Tetraodon nigroviridis full-length cDNA Length = 1235 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 973 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 914 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 913 cgaagcggcccagcggtgggtactgggagaagctctccac 874
>emb|CR657394.2|CNS0F67S Tetraodon nigroviridis full-length cDNA Length = 662 Score = 79.8 bits (40), Expect = 7e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || ||||| || || |||||||||||||| ||||| | Sbjct: 380 ccttcttctcaacggacttgatgacccccacagccacagtctgcctcatgtcccgcacag 321 Query: 336 caaagcggcccaggggagggtactgggcgaaggtctccac 375 | ||||||||||| || |||||||||| |||| ||||||| Sbjct: 320 cgaagcggcccagcggtgggtactgggagaagctctccac 281
>gb|BT000595.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07940/T6D22_14) mRNA, complete cds Length = 1350 Score = 79.8 bits (40), Expect = 7e-12 Identities = 154/192 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| || || || |||||||| || || ||||| Sbjct: 1338 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1279 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1278 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1219 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1218 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1159 Query: 415 gtcaccattctt 426 ||||||||||| Sbjct: 1158 atcaccattctt 1147
>emb|X16430.1|ATEF1AA1 Arabidopsis thaliana EF-1 alpha A1 gene for elongation factor 1-alpha Length = 3230 Score = 79.8 bits (40), Expect = 7e-12 Identities = 154/192 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| || || || |||||||| || || ||||| Sbjct: 2589 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 2530 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 2529 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 2470 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 2469 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 2410 Query: 415 gtcaccattctt 426 ||||||||||| Sbjct: 2409 atcaccattctt 2398
>dbj|AK221032.1| Arabidopsis thaliana mRNA for elongation factor 1-alpha, partial cds, clone: RAFL22-71-O21 Length = 599 Score = 79.8 bits (40), Expect = 7e-12 Identities = 154/192 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| || || || |||||||| || || ||||| Sbjct: 273 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 214 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 213 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 154 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 153 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 94 Query: 415 gtcaccattctt 426 ||||||||||| Sbjct: 93 atcaccattctt 82
>gb|AY039583.1| Arabidopsis thaliana At1g07940/T6D22_14 mRNA, complete cds Length = 1650 Score = 79.8 bits (40), Expect = 7e-12 Identities = 154/192 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| || || || |||||||| || || ||||| Sbjct: 1410 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1351 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1350 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1291 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1290 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1231 Query: 415 gtcaccattctt 426 ||||||||||| Sbjct: 1230 atcaccattctt 1219
>emb|BX814695.1|CNS0ADQC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB8ZA02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1593 Score = 79.8 bits (40), Expect = 7e-12 Identities = 154/192 (80%) Strand = Plus / Minus Query: 235 cttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctctt 294 |||||||| ||||||||||| |||||||| || || || |||||||| || || ||||| Sbjct: 1359 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1300 Query: 295 gatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagg 354 ||| || || || ||||| |||||||||||||| | ||| || || || || || || || Sbjct: 1299 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1240 Query: 355 gtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggc 414 ||||| | |||||||||||| ||||| |||||||| || ||||||| || | || || Sbjct: 1239 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1180 Query: 415 gtcaccattctt 426 ||||||||||| Sbjct: 1179 atcaccattctt 1168
>dbj|AB056104.1| Carassius auratus mRNA for elongation factor-1 alpha, complete cds Length = 1704 Score = 79.8 bits (40), Expect = 7e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 278 ttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggca 337 |||||||| ||||||||||| || || || ||||| |||||||||||||||||||| ||| Sbjct: 1366 ttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacagca 1307 Query: 338 aagcggcccaggggagggta 357 ||||| || || |||||||| Sbjct: 1306 aagcgaccaagaggagggta 1287
>gb|AY378166.1| Cichorium intybus elongation factor 1-alpha mRNA, complete cds Length = 1582 Score = 77.8 bits (39), Expect = 3e-11 Identities = 128/158 (81%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||||||||| || || ||||| |||||||| || || ||||| | || || Sbjct: 1368 gcagccttggtcaccttagctccagtcgggtccttcttgtcaacattcttggtaacacca 1309 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||||||||| | |||||| | ||||||||| | || || || ||||||| || Sbjct: 1308 acagcaaccgtctgacgcatgtccctcacggcaaaccttccaagnggggggtactcagca 1249 Query: 365 aaggtctccaccaccatcggcttggtggggatcatctt 402 || |||||||||||||| |||||||| || |||||||| Sbjct: 1248 aaagtctccaccaccataggcttggttggaatcatctt 1211
>ref|NM_100667.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07930 mRNA, complete cds Length = 1778 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 1424 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1365 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 1364 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1305 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 1304 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1245 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 1244 ttcaagaatttgggc 1230
>gb|AY973258.1| Leishmania major elongation factor1-alpha mRNA, complete cds Length = 1350 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 274 ctccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcac 333 ||||||||| | ||||| |||||| | ||||||||| |||||||| | |||||| ||||| Sbjct: 1299 ctccttcttgttcacgcccttgatgatgcccacggccaccgtctggcgcatgtcgcgcac 1240 Query: 334 ggcaaagcggcccag 348 ||||||||||||||| Sbjct: 1239 ggcaaagcggcccag 1225
>gb|AY123029.1| Arabidopsis thaliana putative elongation factor 1-alpha (At1g07930) mRNA, complete cds Length = 1381 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1269 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 1268 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1209 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 1208 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1149 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 1148 ttcaagaatttgggc 1134
>gb|AY080660.1| Arabidopsis thaliana putative elongation factor 1-alpha (At1g07930) mRNA, complete cds Length = 1705 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 1240 ttcaagaatttgggc 1226
>emb|AJ222579.1|VFEF1A Vicia faba mRNA for elongation factor 1-alpha (EF1-a) Length = 1599 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||| ||||| |||||||| || || || |||||||||||||| |||||||| || || Sbjct: 1369 gcagctttggtgaccttggctccagttgggtccttcttctccacactcttgatgactccg 1310 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| || || |||||||| | || ||||| || || || ||||| |||| ||| Sbjct: 1309 acagcaacagtttgtctcatgtccctaacagcaaaacgaccaagtggaggatactcggca 1250 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 || || ||||| ||||| ||||||||||| |||||||| || | || || ||||||||| Sbjct: 1249 aaagtttccacaaccatgggcttggtgggaatcatcttaaccatacctgcatcaccattc 1190 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1189 ttcaaaaacttgggc 1175
>gb|AF361822.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1679 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 1240 ttcaagaatttgggc 1226
>gb|AY065008.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1657 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 1240 ttcaagaatttgggc 1226
>gb|AY059160.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1350 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1269 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 1268 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1209 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 1208 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1149 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 1148 ttcaagaatttgggc 1134
>gb|AF398148.1|AF398148 Brassica rapa subsp. pekinensis translation elongation factor 1 alpha chain (eEF-1) mRNA, partial cds Length = 460 Score = 77.8 bits (39), Expect = 3e-11 Identities = 72/83 (86%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| ||||| |||||||| || |||||||| || ||||||||||| || || Sbjct: 273 gcagccttggtgaccttagcaccggttgggtccttcttgtcgacgctcttgataacacca 214 Query: 305 acggcaaccgtctgcctcatgtc 327 || || ||||||||||||||||| Sbjct: 213 acagccaccgtctgcctcatgtc 191
>gb|AY048275.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1682 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 1414 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1355 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 1354 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1295 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 1294 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1235 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 1234 ttcaagaatttgggc 1220
>gb|BT003325.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 1677 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| |||||||| ||||| || |||||||| || || |||||||| || || Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| |||||||||||||| | || || || || || || || ||||||| | | Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 ||||||||||| ||||| |||||||| || ||||||| || | || || ||||||||| Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241 Query: 425 ttgaggaacttgggc 439 || | ||| |||||| Sbjct: 1240 ttcaagaatttgggc 1226
>emb|CT010481.8| M.truncatula DNA sequence from clone MTH2-62G7 on chromosome 3, complete sequence Length = 113400 Score = 77.8 bits (39), Expect = 3e-11 Identities = 165/207 (79%) Strand = Plus / Plus Query: 233 ttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctc 292 ||||||||| |||||||||||| |||||||| ||||| || |||||||||||||| | Sbjct: 72725 ttcttcttggcagcagccttggtgaccttggctccggtaggatccttcttctccacagcc 72784 Query: 293 ttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccagggga 352 ||||| || || || ||||| || || | |||||| | || ||||| || || || ||| Sbjct: 72785 ttgatgacaccaacagcaacagtttgacgcatgtccctgacagcaaaacgtccaagagga 72844 Query: 353 gggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccg 412 || || | || |||||||| |||||||| ||||||||||| | |||||| | || || Sbjct: 72845 ggatattcagcaaaggtctcaaccaccatgggcttggtgggaaccatcttaatgatacca 72904 Query: 413 gcgtcaccattcttgaggaacttgggc 439 || ||||||||||| | |||||||||| Sbjct: 72905 gcatcaccattcttcaagaacttgggc 72931 Score = 69.9 bits (35), Expect = 7e-09 Identities = 164/207 (79%) Strand = Plus / Plus Query: 233 ttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccacgctc 292 ||||||||| |||||| ||||| || ||||| ||||| || |||||||||||||| | Sbjct: 82262 ttcttcttggcagcagctttggtgactttggctccggtgggatccttcttctccacagcc 82321 Query: 293 ttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccagggga 352 ||||| || || || ||||| || || | |||||| | |||||||| || || || ||| Sbjct: 82322 ttgatgacaccaacagcaacagtttgacgcatgtccctgacggcaaaacgtccaagagga 82381 Query: 353 gggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaacccg 412 || || | ||||||||||| |||||||| ||||||||||| | |||||| | || || Sbjct: 82382 ggatattcagcgaaggtctcaaccaccatgggcttggtgggaaccatcttaatgatacca 82441 Query: 413 gcgtcaccattcttgaggaacttgggc 439 || ||||| ||||| | |||||||||| Sbjct: 82442 gcatcaccgttcttcaagaacttgggc 82468
>gb|DQ284495.1| Solanum tuberosum clone 063G03 elongation factor-1 alpha-like mRNA, complete cds Length = 1621 Score = 77.8 bits (39), Expect = 3e-11 Identities = 156/195 (80%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||| || |||||||| || || || ||||| || ||| |||||| ||| || Sbjct: 1378 gcagccttggtgactttggcaccagtagggtctttcttgtcgacgttcttgaccacacca 1319 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| || || | |||||| | ||| ||||| || |||| || ||||||| ||| Sbjct: 1318 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcggca 1259 Query: 365 aaggtctccaccaccatcggcttggtggggatcatcttgacgaacccggcgtcaccattc 424 |||||||| || ||||| ||||||||||| |||||||| || | ||||| ||||||||| Sbjct: 1258 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccggcatcaccattc 1199 Query: 425 ttgaggaacttgggc 439 || | ||||||||| Sbjct: 1198 ttcaaaaacttgggc 1184
>dbj|AB019427.1| Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds Length = 1734 Score = 77.8 bits (39), Expect = 3e-11 Identities = 168/211 (79%) Strand = Plus / Minus Query: 229 tcatttcttcttgatagcagccttggtcaccttggcaccggtcggctccttcttctccac 288 |||||||||||| |||||||||||| ||||| ||||| || || |||||||| || || Sbjct: 1412 tcatttcttcttctgagcagccttggtgaccttagcaccagttgggtccttcttgtcaac 1353 Query: 289 gctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggcaaagcggcccag 348 | ||||||| || || || ||||| || || | |||||| | ||| ||||| || |||| Sbjct: 1352 gttcttgataacaccaacagcaacagtttgacgcatgtccctcacagcaaaacgtcccaa 1293 Query: 349 gggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaa 408 || || |||| | ||||||||| || ||||| ||||||||||| |||||||| || | Sbjct: 1292 tggtggatactcagagaaggtctcaacaaccatgggcttggtgggaatcatcttaaccat 1233 Query: 409 cccggcgtcaccattcttgaggaacttgggc 439 || || ||||||||||| | |||||||||| Sbjct: 1232 accagcatcaccattcttcaagaacttgggc 1202
>gb|DQ228326.1| Solanum tuberosum clone 135F02 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1753 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||||||||||||||| || || |||||||| || || |||||| || || Sbjct: 1379 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1320 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| || ||||||||||| | ||| ||||| || |||| || ||||| | || Sbjct: 1319 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtattcagca 1260 Query: 365 aaggtctccaccaccatcggcttggtggggatcatctt 402 |||||||| || ||||| ||||||||||| |||||||| Sbjct: 1259 aaggtctcaacaaccatgggcttggtgggaatcatctt 1222
>gb|DQ222490.1| Solanum tuberosum clone 098G02 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1723 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Minus Query: 245 gcagccttggtcaccttggcaccggtcggctccttcttctccacgctcttgatcacgccc 304 ||||||||||||||||||||||| || || |||||||| || || |||||| || || Sbjct: 1390 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1331 Query: 305 acggcaaccgtctgcctcatgtcacgcacggcaaagcggcccaggggagggtactgggcg 364 || ||||| || ||||||||||| | ||| ||||| || |||| || ||||| | || Sbjct: 1330 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtattcagca 1271 Query: 365 aaggtctccaccaccatcggcttggtggggatcatctt 402 |||||||| || ||||| ||||||||||| |||||||| Sbjct: 1270 aaggtctcaacaaccatgggcttggtgggaatcatctt 1233
>gb|DQ447160.1| Passiflora edulis translation elongation factor 1a-1 (EF1a1) mRNA, partial cds Length = 358 Score = 75.8 bits (38), Expect = 1e-10 Identities = 77/90 (85%) Strand = Plus / Minus Query: 350 ggagggtactgggcgaaggtctccaccaccatcggcttggtggggatcatcttgacgaac 409 |||||||||| || |||||||||||||||||| |||||||| || |||||||| ||||| Sbjct: 318 ggagggtactcggagaaggtctccaccaccatgggcttggtaggaatcatcttcacgaat 259 Query: 410 ccggcgtcaccattcttgaggaacttgggc 439 || || ||||| ||||| | ||| |||||| Sbjct: 258 ccagcatcaccgttcttcaagaatttgggc 229
>gb|AY629396.1| Escovopsis sp. nmg011027-02 EF-1 alpha gene, partial sequence Length = 1606 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| ||||| || ||||| ||||||||||||| || ||| | ||| || ||| Sbjct: 1600 catgtcacggacggcgaaacggccaaggggagggtactcggtgaaagactcgacacacat 1541 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||| Sbjct: 1540 gggcttggaggggatcatcttgacgatggcggcgtcaccagacttgatgaacttggg 1484
>gb|AY629380.1| Escovopsis sp. sp011108-02 EF-1 alpha gene, partial sequence Length = 1622 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1616 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1557 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1556 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1500
>gb|AY629377.1| Escovopsis sp. cc011211-03 EF-1 alpha gene, partial sequence Length = 1619 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1613 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1554 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1553 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1497
>gb|AY629376.1| Escovopsis sp. sp011108-03 EF-1 alpha gene, partial sequence Length = 1620 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1614 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1555 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1554 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1498
>gb|AY629375.1| Escovopsis sp. cc011205-06 EF-1 alpha gene, partial sequence Length = 1619 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1613 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1554 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1553 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1497
>gb|AY629374.1| Escovopsis sp. cc011211-02 EF-1 alpha gene, partial sequence Length = 1619 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1613 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1554 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1553 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1497
>gb|AY629373.1| Escovopsis sp. cc011124-03 EF-1 alpha gene, partial sequence Length = 1618 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1612 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1553 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1552 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1496
>gb|AY629372.1| Escovopsis sp. ugm010323-01 EF-1 alpha gene, partial sequence Length = 1616 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1610 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1551 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1550 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1494
>gb|AY629371.1| Escovopsis sp. ugm010407-27 EF-1 alpha gene, partial sequence Length = 1619 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1613 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1554 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1553 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1497
>gb|AY629370.1| Escovopsis sp. sp011105-01 EF-1 alpha gene, partial sequence Length = 1618 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1612 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1553 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1552 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1496
>gb|AY629369.1| Escovopsis sp. cc011120-03 EF-1 alpha gene, partial sequence Length = 1618 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 1612 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 1553 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 1552 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 1496
>emb|CR728391.2|CNS0GOZ1 Tetraodon nigroviridis full-length cDNA Length = 1401 Score = 73.8 bits (37), Expect = 4e-10 Identities = 86/101 (85%), Gaps = 1/101 (0%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| |||||| || |||||||| || |||||||||||||| ||||| | Sbjct: 1119 ccttcttctcaacggacttgatgacccccacggccacagtctgcctcatgtcccgcacag 1060 Query: 336 caaagcggc-ccaggggagggtactgggcgaaggtctccac 375 | ||||||| |||| || |||||||||| |||| ||||||| Sbjct: 1059 cgaagcggctccagcggtgggtactgggagaagctctccac 1019
>emb|AJ223969.1|MDAJ39669 Malus domestica mRNA for elongation factor 1 alpha subunit Length = 1715 Score = 73.8 bits (37), Expect = 4e-10 Identities = 133/165 (80%) Strand = Plus / Minus Query: 275 tccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacg 334 ||||||||||| ||||||||||| || || || ||||| ||||| | |||||| | ||| Sbjct: 1392 tccttcttctcaacgctcttgatgacaccaactgcaacagtctggcgcatgtccctcaca 1333 Query: 335 gcaaagcggcccaggggagggtactgggcgaaggtctccaccaccatcggcttggtgggg 394 ||||| || || || || ||||||| | ||||||||| || ||||| ||||||||||| Sbjct: 1332 gcaaaacgtccgagcggtgggtactcagagaaggtctcaacaaccatgggcttggtggga 1273 Query: 395 atcatcttgacgaacccggcgtcaccattcttgaggaacttgggc 439 | |||||| || || || || ||||||||||| | ||||||||| Sbjct: 1272 agcatcttcacaaatccagcatcaccattctttaaaaacttgggc 1228
>gb|AY172625.1| Escovopsis sp. CC4 elongation factor 1-alpha (EF1a) gene, exon 6 and partial cds Length = 987 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 984 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 925 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 924 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 868
>gb|AY172624.1| Escovopsis sp. CC1 elongation factor 1-alpha (EF1a) gene, exon 6 and partial cds Length = 987 Score = 73.8 bits (37), Expect = 4e-10 Identities = 97/117 (82%) Strand = Plus / Minus Query: 322 catgtcacgcacggcaaagcggcccaggggagggtactgggcgaaggtctccaccaccat 381 ||||||||| |||||||| || |||||||||||||||| || ||||| ||| || ||| Sbjct: 984 catgtcacggacggcaaaacgacccaggggagggtactcggtgaaggcctcaacacacat 925 Query: 382 cggcttggtggggatcatcttgacgaacccggcgtcaccattcttgaggaacttggg 438 ||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||| Sbjct: 924 gggcttggagggaatcatcttgacgatggcggcatcaccagacttgatgaacttggg 868
>gb|AY643400.1| Pimephales promelas elongation factor 1-alpha mRNA, complete cds Length = 1748 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 278 ttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacggca 337 |||||||| ||||||||||| || || || ||||| |||||||||||||||||||| ||| Sbjct: 1402 ttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacagca 1343 Query: 338 aagcg 342 ||||| Sbjct: 1342 aagcg 1338
>gb|AY264256.1| Synodontis sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1142 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1142 ccttcttctcaacgctcttgatgacaccgacagcaacggtctgcctcatgtcacgcacag 1083 Query: 336 caaa 339 |||| Sbjct: 1082 caaa 1079
>gb|AY264255.1| Centromochlus heckelii elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1072 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1072 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1013 Query: 336 caaa 339 |||| Sbjct: 1012 caaa 1009
>gb|AY264253.1| Tatia intermedia elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1118 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1118 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1059 Query: 336 caaa 339 |||| Sbjct: 1058 caaa 1055
>gb|AY264252.1| Auchenipterichthys thoracatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1140 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1140 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1081 Query: 336 caaa 339 |||| Sbjct: 1080 caaa 1077
>gb|AY264249.1| Parauchenipterus cf. galeatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1074 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1074 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1015 Query: 336 caaa 339 |||| Sbjct: 1014 caaa 1011
>gb|AY264248.1| Acanthodoras cataphractus truncated elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1131 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1131 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1072 Query: 336 caaa 339 |||| Sbjct: 1071 caaa 1068
>gb|AY264247.1| Acanthodoras spinosissimus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1077 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1077 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1018 Query: 336 caaa 339 |||| Sbjct: 1017 caaa 1014
>gb|AY264245.1| Trachydoras cf. microstomus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1118 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1118 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1059 Query: 336 caaa 339 |||| Sbjct: 1058 caaa 1055
>gb|AY264243.1| Trachydoras steindachneri elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1120 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1120 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1061 Query: 336 caaa 339 |||| Sbjct: 1060 caaa 1057
>gb|AY264241.1| Leptodoras cf. copei elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1109 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1109 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1050 Query: 336 caaa 339 |||| Sbjct: 1049 caaa 1046
>gb|AY264240.1| Leptodoras linnelli elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1111 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1111 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1052 Query: 336 caaa 339 |||| Sbjct: 1051 caaa 1048
>gb|AY264239.1| Leptodoras praelongus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1118 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||| ||||||| ||||| || ||||| |||||||||||||||||||| | Sbjct: 1118 ccttcttctcaacgttcttgatgacgccaacagcaacggtctgcctcatgtcacgcacag 1059 Query: 336 caaa 339 |||| Sbjct: 1058 caaa 1055
>gb|AY264236.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1083 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1083 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1024 Query: 336 caaa 339 |||| Sbjct: 1023 caaa 1020
>gb|AY264225.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1053 Query: 336 caaa 339 |||| Sbjct: 1052 caaa 1049
>gb|AY264224.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1053 Query: 336 caaa 339 |||| Sbjct: 1052 caaa 1049
>gb|AY264223.1| Opsodoras sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1113 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1113 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1054 Query: 336 caaa 339 |||| Sbjct: 1053 caaa 1050
>gb|AY264222.1| Opsodoras ternetzi haplotype I elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1107 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1107 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1048 Query: 336 caaa 339 |||| Sbjct: 1047 caaa 1044
>gb|AY264221.1| Nemadoras hemipeltis elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1114 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1114 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1055 Query: 336 caaa 339 |||| Sbjct: 1054 caaa 1051
>gb|AY264219.1| Doras micropoeus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1053 Query: 336 caaa 339 |||| Sbjct: 1052 caaa 1049
>gb|AY264217.1| Doraops zuloagai elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1120 Score = 71.9 bits (36), Expect = 2e-09 Identities = 57/64 (89%) Strand = Plus / Minus Query: 276 ccttcttctccacgctcttgatcacgcccacggcaaccgtctgcctcatgtcacgcacgg 335 |||||||||| ||||||||||| || || || ||||| |||||||||||||||||||| | Sbjct: 1120 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1061 Query: 336 caaa 339 |||| Sbjct: 1060 caaa 1057 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,806,286 Number of Sequences: 3902068 Number of extensions: 3806286 Number of successful extensions: 125228 Number of sequences better than 10.0: 1103 Number of HSP's better than 10.0 without gapping: 1087 Number of HSP's successfully gapped in prelim test: 16 Number of HSP's that attempted gapping in prelim test: 123874 Number of HSP's gapped (non-prelim): 1293 length of query: 451 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 429 effective length of database: 17,147,199,772 effective search space: 7356148702188 effective search space used: 7356148702188 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)