>emb|AL592546.7| Human DNA sequence from clone RP11-211N11 on chromosome 10 Contains the
3' end of the CASP7 gene for caspase 7 apoptosis-related
cysteine protease, a novel gene (FLJ23537), the DCLRE1A
gene for DNA cross-link repair 1A (PSO2 homolog S.
cerevisiae), the 5' end of the gene for a novel NHL repeat
domain containing protein (FLJ33312), a novel gene and a
CpG island, complete sequence
Length = 174776
Score = 40.1 bits (20), Expect = 3.3
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 219 cagcctctcccttatctttt 238
||||||||||||||||||||
Sbjct: 20587 cagcctctcccttatctttt 20568
>emb|AL390882.12| Human DNA sequence from clone RP11-113D19 on chromosome 9p21.2-22.3
Contains the IFNA21 gene for interferon, alpha 21, the
IFNW1 gene for interferon, omega 1, an interferon, omega 1
(IFNW1) pseudogene, the IFNB1 gene for interferon, beta 1,
fibroblast, an interferon, beta 1, fibroblast (IFNB1)
pseudogene and a novel gene, possible otholog of mouse
RIKEN cDNA 4933428I03 gene, complete sequence
Length = 162064
Score = 40.1 bits (20), Expect = 3.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 31 atatagagaaacaaacaaaa 50
||||||||||||||||||||
Sbjct: 58769 atatagagaaacaaacaaaa 58788
>emb|AL049569.13|HSDJ37C10 Human DNA sequence from clone RP1-37C10 on chromosome 1p35.2-35.21
Contains the 3' end of the CROCC gene for ciliary rootlet
coiled-coil rootletin (KIAA0445), the MFAP2 gene for
microfibrillar-associated protein 2, a novel gene, the
gene for a novel protein, the SDHB gene for succinate
dehydrogenase complex subunit B iron sulfur (Ip), the
PADI2 gene for type II peptidyl arginine deiminase,
complete sequence
Length = 216497
Score = 40.1 bits (20), Expect = 3.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 28 tagatatagagaaacaaaca 47
||||||||||||||||||||
Sbjct: 14047 tagatatagagaaacaaaca 14066
>dbj|AP001053.1| Homo sapiens genomic DNA, chromosome 21, clone:KB836E9, MX1-D21S171
region, complete sequence
Length = 161920
Score = 40.1 bits (20), Expect = 3.3
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 130 agcgcgtccccctggcagat 149
||||||||||||||||||||
Sbjct: 108712 agcgcgtccccctggcagat 108693
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,339,283
Number of Sequences: 3902068
Number of extensions: 3339283
Number of successful extensions: 59339
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59230
Number of HSP's gapped (non-prelim): 109
length of query: 258
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 236
effective length of database: 17,147,199,772
effective search space: 4046739146192
effective search space used: 4046739146192
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)