ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart22g04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 638 e-180
2gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 250 4e-63
3gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 242 9e-61
4gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 234 2e-58
5gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 218 1e-53
6gb|AY109332.1| Zea mays CL502_5 mRNA sequence 218 1e-53
7gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 194 2e-46
8ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 186 5e-44
9ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 186 5e-44
10ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 186 5e-44
11dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 5e-44
12dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 5e-44
13dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 5e-44
14dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 5e-44
15dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
16dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 170 3e-39
17gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 155 2e-34
18gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 147 4e-32
19ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 143 6e-31
20dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 6e-31
21dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
22dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
23gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 139 9e-30
24ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 131 2e-27
25dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
26gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 127 4e-26
27gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 127 4e-26
28gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 127 4e-26
29ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 109 8e-21
30ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 109 8e-21
31dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 8e-21
32dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 107 3e-20
33ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 103 5e-19
34gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 101 2e-18
35dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 101 2e-18
36dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 100 8e-18
37dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 100 8e-18
38gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 98 3e-17
39ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 94 5e-16
40gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 94 5e-16
41gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 94 5e-16
42emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 94 5e-16
43emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 94 5e-16
44dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 5e-16
45dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 5e-16
46dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 5e-16
47dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 5e-16
48gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 92 2e-15
49dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
50gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 92 2e-15
51dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
52ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe... 88 3e-14
53emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 88 3e-14
54gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 88 3e-14
55gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 88 3e-14
56gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 88 3e-14
57emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co... 88 3e-14
58emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co... 88 3e-14
59dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
60dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
61dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
62gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 88 3e-14
63gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 88 3e-14
64dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 88 3e-14
65gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 86 1e-13
66gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 84 5e-13
67gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 84 5e-13
68dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 84 5e-13
69gb|AY103580.1| Zea mays PCO072544 mRNA sequence 84 5e-13
70gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 80 8e-12
71gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 80 8e-12
72gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 80 8e-12
73gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 80 8e-12
74ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 78 3e-11
75dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
76dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
77dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
78dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
79dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 78 3e-11
80ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 76 1e-10
81gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 76 1e-10
82gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 76 1e-10
83dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 76 1e-10
84gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 76 1e-10
85gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 76 1e-10
86gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 76 1e-10
87emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
88emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
89emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
90emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
91gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 76 1e-10
92gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 76 1e-10
93gb|AY107589.1| Zea mays PCO085320 mRNA sequence 76 1e-10
94ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 72 2e-09
95gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 72 2e-09
96gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 72 2e-09
97dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
98gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 72 2e-09
99gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 72 2e-09
100emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 70 7e-09
101emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p... 70 7e-09
102emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 70 7e-09
103gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 70 7e-09
104emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 68 3e-08
105gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 68 3e-08
106dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
107dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
108dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
109emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 68 3e-08
110gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 68 3e-08
111dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 68 3e-08
112gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 66 1e-07
113emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 66 1e-07
114emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 64 4e-07
115gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 64 4e-07
116emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 62 2e-06
117emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 62 2e-06
118gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds 62 2e-06
119gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 60 7e-06
120emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 58 3e-05
121dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 58 3e-05
122dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 58 3e-05
123dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran... 58 3e-05
124ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3... 56 1e-04
125gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 56 1e-04
126gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 56 1e-04
127emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 56 1e-04
128emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 56 1e-04
129emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ... 56 1e-04
130dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
131emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
132emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
133emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
134emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
135emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
136emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
137emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
138gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s... 56 1e-04
139dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
140dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 56 1e-04
141dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
142dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
143dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
144dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
145dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
146gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 56 1e-04
147gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 56 1e-04
148gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 56 1e-04
149dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 56 1e-04
150gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 54 4e-04
151gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 54 4e-04
152gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 54 4e-04
153emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 54 4e-04
154gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 54 4e-04
155gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 54 4e-04
156emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 52 0.002
157emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 52 0.002
158gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 52 0.002
159gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 52 0.002
160gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 52 0.002
161ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe... 50 0.007
162gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)... 50 0.007
163gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.007
164gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.007
165gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 50 0.007
166emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co... 50 0.007
167dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 50 0.007
168gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s... 50 0.007
169emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene... 50 0.007
170emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene... 50 0.007
171dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane... 50 0.007
172gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 50 0.007
173gb|U27347.1|GMU27347 Glycine max putative water channel protein ... 50 0.007
174ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37... 48 0.027
175ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 48 0.027
176gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 48 0.027
177gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (... 48 0.027
178emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins... 48 0.027
179emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 48 0.027
180emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 48 0.027
181gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m... 48 0.027
182gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot... 48 0.027
183gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein ... 48 0.027
184gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.027
185gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 48 0.027
186gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 48 0.027
187emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 48 0.027
188dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 48 0.027
189gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s... 48 0.027
190gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 48 0.027
191dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran... 48 0.027
192gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, comp... 48 0.027
193emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap... 48 0.027
194emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap... 48 0.027
195dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 48 0.027
196gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 48 0.027
197gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.027
198gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com... 48 0.027
199dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ... 48 0.027
200dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ... 48 0.027
201ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR... 46 0.11
202ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe... 46 0.11
203gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence 46 0.11
204gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr... 46 0.11
205emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic... 46 0.11
206emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 46 0.11
207emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 46 0.11
208gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot... 46 0.11
209gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.11
210gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.11
211gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ... 46 0.11
212gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, c... 46 0.11
213gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr... 46 0.11
214gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 46 0.11
215emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co... 46 0.11
216emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co... 46 0.11
217emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co... 46 0.11
218emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co... 46 0.11
219gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mR... 46 0.11
220dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane in... 46 0.11
221dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane in... 46 0.11
222gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se... 46 0.11
223gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s... 46 0.11
224emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap... 46 0.11
225dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds 46 0.11
226gb|AY107675.1| Zea mays PCO112712 mRNA sequence 46 0.11
227gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin... 46 0.11
228gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 46 0.11
229ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.42
230gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 44 0.42
231gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ... 44 0.42
232emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans... 44 0.42
233gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map... 44 0.42
234gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRN... 44 0.42
235gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 44 0.42
236gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 44 0.42
237dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.42
238dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.42
239dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 44 0.42
240dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 44 0.42
241ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 42 1.6
242gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.6
243gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot... 42 1.6
244gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.6
245gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 1.6
246emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 42 1.6
247emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 42 1.6
248gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 42 1.6
249emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 42 1.6
250gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 42 1.6
251ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-form... 42 1.6
252emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.6
253emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.6
254gb|AF218774.1|AF218774 Lycopersicon esculentum putative water ch... 42 1.6
255gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 42 1.6
256emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 42 1.6
257emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 42 1.6
258emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 42 1.6
259emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 42 1.6
260dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in... 42 1.6
261dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.6
262gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete ... 42 1.6
263gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 42 1.6
264gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming i... 42 1.6
265gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA... 42 1.6
266gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.6
267gb|AE000657.1| Aquifex aeolicus VF5, complete genome 42 1.6
268gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 42 1.6
269ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr... 40 6.5
270ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0... 40 6.5
271ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G5... 40 6.5
272ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A)... 40 6.5
273ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6... 40 6.5
274gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 6.5
275gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (... 40 6.5
276gb|AC016250.5| Homo sapiens chromosome 8 clone RP11-516P9, compl... 40 6.5
277gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 40 6.5
278gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 40 6.5
279emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 40 6.5
280gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 6.5
281emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1 40 6.5
282gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int... 40 6.5
283emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrins... 40 6.5
284emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 40 6.5
285emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 40 6.5
286emb|BX545848.23| Zebrafish DNA sequence from clone DKEY-8O19 in ... 40 6.5
287emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA... 40 6.5
288emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B... 40 6.5
289emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene) 40 6.5
290gb|AC025207.5| Homo sapiens chromosome 8, clone RP11-193J8, comp... 40 6.5
291emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch... 40 6.5
292gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int... 40 6.5
293gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 40 6.5
294gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int... 40 6.5
295gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 40 6.5
296gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic pr... 40 6.5
297gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ... 40 6.5
298gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp... 40 6.5
299gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 40 6.5
300gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 ... 40 6.5
301gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 40 6.5
302dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane in... 40 6.5
303gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds 40 6.5
304gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic pr... 40 6.5
305gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 40 6.5
306emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Co... 40 6.5
307emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Co... 40 6.5
308emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co... 40 6.5
309emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co... 40 6.5
310emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co... 40 6.5
311emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Co... 40 6.5
312emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co... 40 6.5
313emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co... 40 6.5
314emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Co... 40 6.5
315gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se... 40 6.5
316gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete s... 40 6.5
317gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA... 40 6.5
318dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
319gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp... 40 6.5
320dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 6.5
321dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei... 40 6.5
322dbj|AP004090.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
323emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 6.5
324emb|BX248523.8| Zebrafish DNA sequence from clone CH211-257G8 in... 40 6.5
325dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ... 40 6.5
326gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 40 6.5
327gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl... 40 6.5
328gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 40 6.5
329dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 40 6.5
330dbj|AP003548.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 6.5

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
            complete cds
          Length = 1283

 Score =  638 bits (322), Expect = e-180
 Identities = 451/489 (92%), Gaps = 15/489 (3%)
 Strand = Plus / Minus

                                                                        
Query: 7    aaggtggcgacgttgggtcgatcatacatatggtcgctaaattaaaaca------ggaaa 60
            |||||||||||||||| |||||||||||||||||||||||||| ||| |      |||||
Sbjct: 1243 aaggtggcgacgttggatcgatcatacatatggtcgctaaatttaaatacaagtaggaaa 1184

                                                                        
Query: 61   aggaatgcgggctaattaagacaagcgaccccatggaccgaattacaacacacggcacgc 120
            || ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||
Sbjct: 1183 agcaatgcgggctaattaagacaagcgatcccatggaccgaattacaagacacggcacgc 1124

                                                                        
Query: 121  atgactgggc-acatac---gcatatgcagctgccgacacataaataacacgaccattgc 176
            ||||| || | || |||   |||||||||||||||||||||||| |||||||||||||||
Sbjct: 1123 atgaccggaccacgtactacgcatatgcagctgccgacacataa-taacacgaccattgc 1065

                                                                        
Query: 177  agcggcc-aactgaactgtcgagaagttgcaaaagcggctttctctttggatggatggac 235
             |||||| |||||||||||||||||||||||||||||  ||||||| |||||||||||||
Sbjct: 1064 ggcggccgaactgaactgtcgagaagttgcaaaagcgcatttctctctggatggatggac 1005

                                                                        
Query: 236  acagcacaggtcgccattgcttcaatcttgcatgcacatcacatggat---aactcgtta 292
            ||| ||| |||||||||||||||| |||||||| || || ||||||||   |||| ||||
Sbjct: 1004 acaacacgggtcgccattgcttcagtcttgcatacagatgacatggatgataacttgtta 945

                                                                        
Query: 293  cgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 352
            |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 944  cgcgttgctcctgaaggagccgagggccttgatggcgccggccctgaggatgtactggtg 885

                                                                        
Query: 353  gtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatc 412
            || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 884  gtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatc 825

                                                                        
Query: 413  ccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgcc 472
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 824  ccaggccttgtccttgttgtagatgacggcggcccccaggctccgggccgggttgatgcc 765

                     
Query: 473  ggtgccggt 481
            |||||||||
Sbjct: 764  ggtgccggt 756



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  250 bits (126), Expect = 4e-63
 Identities = 174/190 (91%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| |||||||||||| || ||||| |  | |||||| |||||||||||||| || || |
Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 804 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 745

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 744 cggtgccggt 735



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  242 bits (122), Expect = 9e-61
 Identities = 173/190 (91%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| |||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 752 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 693

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 692 cggtgccggt 683



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  234 bits (118), Expect = 2e-58
 Identities = 172/190 (90%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           ||||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||
Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| |||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 823 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 764

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 763 cggtgccggt 754



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  218 bits (110), Expect = 1e-53
 Identities = 170/190 (89%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| |||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
           |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 876 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 817

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 816 cggtgccggt 807



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  218 bits (110), Expect = 1e-53
 Identities = 170/190 (89%)
 Strand = Plus / Minus

                                                                        
Query: 292  acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
            ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587

                                                                        
Query: 352  ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
            ||| |||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527

                                                                        
Query: 412  cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 1526 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 1467

                      
Query: 472  cggtgccggt 481
            ||||||||||
Sbjct: 1466 cggtgccggt 1457



 Score =  147 bits (74), Expect = 4e-32
 Identities = 122/138 (88%)
 Strand = Plus / Minus

                                                                       
Query: 344 gtactggtggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 403
           ||||||||||| |  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262

                                                                       
Query: 404 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 463
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 202

                             
Query: 464 gttgatgccggtgccggt 481
           ||||||||||||||||||
Sbjct: 201 gttgatgccggtgccggt 184



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  194 bits (98), Expect = 2e-46
 Identities = 167/190 (87%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 848 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 789

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 788 cggtgccggt 779



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  186 bits (94), Expect = 5e-44
 Identities = 166/190 (87%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 798 cggtgccggt 789



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  186 bits (94), Expect = 5e-44
 Identities = 166/190 (87%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 800 cggtgccggt 791



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  186 bits (94), Expect = 5e-44
 Identities = 166/190 (87%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 801 cggtgccggt 792



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  186 bits (94), Expect = 5e-44
 Identities = 166/190 (87%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 798 cggtgccggt 789



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  186 bits (94), Expect = 5e-44
 Identities = 166/190 (87%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 452 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 393

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 392 cggtgccggt 383



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  186 bits (94), Expect = 5e-44
 Identities = 166/190 (87%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 798 cggtgccggt 789



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  186 bits (94), Expect = 5e-44
 Identities = 166/190 (87%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 801 cggtgccggt 792



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  178 bits (90), Expect = 1e-41
 Identities = 165/190 (86%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           ||||||||||||||| |||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 800 cggtgccggt 791



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  170 bits (86), Expect = 3e-39
 Identities = 164/190 (86%)
 Strand = Plus / Minus

                                                                       
Query: 292 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
           |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||
Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485

                                                                       
Query: 352 ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 411
           ||| ||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425

                                                                       
Query: 412 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 471
            ||||||||| || |||||| |||||||||| |  ||   | ||||||||||||||||||
Sbjct: 424 gccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgggttgatgc 365

                     
Query: 472 cggtgccggt 481
           ||||||||||
Sbjct: 364 cggtgccggt 355



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  155 bits (78), Expect = 2e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 320 cttgatggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgat 379
           |||| |||||| |||||| || | ||||||||||| |  ||| ||||| || ||||| ||
Sbjct: 927 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 868

                                                                       
Query: 380 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 439
           ||  ||||| |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 867 cagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 808

                                                     
Query: 440 ggcggcccccaggctcctggccgggttgatgccggtgccggt 481
            ||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 807 cgcggctcccaggctcctcgccgggttgatgccggtgccggt 766



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  147 bits (74), Expect = 4e-32
 Identities = 122/138 (88%)
 Strand = Plus / Minus

                                                                       
Query: 344 gtactggtggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 403
           ||||||||||| |  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834

                                                                       
Query: 404 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 463
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 774

                             
Query: 464 gttgatgccggtgccggt 481
           ||||||||||||||||||
Sbjct: 773 gttgatgccggtgccggt 756



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  143 bits (72), Expect = 6e-31
 Identities = 135/156 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 ggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgatcatggg 385
           ||||| |||||| || | ||||||||||| |  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 386 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 445
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                               
Query: 446 ccccaggctcctggccgggttgatgccggtgccggt 481
            |||| |||||| |||||||| ||||||||||||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggt 746



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  143 bits (72), Expect = 6e-31
 Identities = 135/156 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 ggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgatcatggg 385
           ||||| |||||| || | ||||||||||| |  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 386 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 445
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                               
Query: 446 ccccaggctcctggccgggttgatgccggtgccggt 481
            |||| |||||| |||||||| ||||||||||||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggt 746



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  141 bits (71), Expect = 2e-30
 Identities = 104/115 (90%)
 Strand = Plus / Minus

                                                                            
Query: 292      acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
                |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793

                                                                       
Query: 352      ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
                ||| ||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                            
Query: 404      ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 463
                |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 15306327 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 15306268

                                  
Query: 464      gttgatgccggtgccggt 481
                ||||||||||||||||||
Sbjct: 15306267 gttgatgccggtgccggt 15306250



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                        
Query: 426      ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
                |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggt 15324181



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                        
Query: 426      ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
                |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggt 15316301



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                            
Query: 417      gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 476
                ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544

                     
Query: 477      ccggt 481
                |||||
Sbjct: 15355543 ccggt 15355539



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                               
Query: 360      gccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
                |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 15316521 gccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                               
Query: 360      gccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
                |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 15306485 gccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 363      gcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
                ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 291      tacgcgttgctcctgaaggagccg 314
                ||||||||||||| ||||||||||
Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score =  141 bits (71), Expect = 2e-30
 Identities = 104/115 (90%)
 Strand = Plus / Minus

                                                                         
Query: 292   acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 351
             |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792

                                                                    
Query: 352   ggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
             ||| ||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                         
Query: 404   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 463
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 13326 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 13267

                               
Query: 464   gttgatgccggtgccggt 481
             ||||||||||||||||||
Sbjct: 13266 gttgatgccggtgccggt 13249



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                     
Query: 426   ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
             |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 31235 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggt 31180



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                     
Query: 426   ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
             |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggt 23300



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                         
Query: 417   gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 476
             ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543

                  
Query: 477   ccggt 481
             |||||
Sbjct: 62542 ccggt 62538



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 360   gccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
             |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 23520 gccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 360   gccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
             |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 13484 gccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 363   gcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
             ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 291   tacgcgttgctcctgaaggagccg 314
             ||||||||||||| ||||||||||
Sbjct: 13550 tacgcgttgctccggaaggagccg 13527



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  139 bits (70), Expect = 9e-30
 Identities = 139/162 (85%)
 Strand = Plus / Minus

                                                                       
Query: 320 cttgatggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgat 379
           |||| |||||| |||||| || | ||||||||||| |  ||| ||||| || ||||| ||
Sbjct: 935 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 876

                                                                       
Query: 380 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 439
           ||  || || |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 875 cagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 816

                                                     
Query: 440 ggcggcccccaggctcctggccgggttgatgccggtgccggt 481
            ||||| |||||| |||| |||||||||||||||||||||||
Sbjct: 815 cgcggctcccaggatcctcgccgggttgatgccggtgccggt 774



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Minus

                                                                       
Query: 360 gccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggcc 419
           |||||||||||||||||||| |  || || |||||||||||||||||||||  |||||||
Sbjct: 888 gccgcgatcgccgcgccgatgaacggcccaacccagaagatccactgatcactccaggcc 829

                                                                       
Query: 420 ttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccg 479
           ||||  ||||||||||  |||||| | || ||||||||||||||||||||||||||||||
Sbjct: 828 ttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgccggtgccg 769

             
Query: 480 gt 481
           ||
Sbjct: 768 gt 767



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 291 tacgcgttgctcctgaaggagccg 314
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Minus

                                                                       
Query: 360 gccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggcc 419
           |||||||||||||||||||| |  || || |||||||||||||||||||||  |||||||
Sbjct: 888 gccgcgatcgccgcgccgatgaacggcccaacccagaagatccactgatcactccaggcc 829

                                                                       
Query: 420 ttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccg 479
           ||||  ||||||||||  |||||| | || ||||||||||||||||||||||||||||||
Sbjct: 828 ttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgccggtgccg 769

             
Query: 480 gt 481
           ||
Sbjct: 768 gt 767



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 291 tacgcgttgctcctgaaggagccg 314
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  127 bits (64), Expect = 4e-26
 Identities = 85/92 (92%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || ||||||||||||||||| |||||||||||||| || || |||
Sbjct: 761 acccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagcgccc 702

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           | ||||||||||||||||||||||||||||||
Sbjct: 701 aagctcctggccgggttgatgccggtgccggt 670



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  127 bits (64), Expect = 4e-26
 Identities = 85/92 (92%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || ||||||||||||||||| |||||||||||||| || || |||
Sbjct: 816 acccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagcgccc 757

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           | ||||||||||||||||||||||||||||||
Sbjct: 756 aagctcctggccgggttgatgccggtgccggt 725



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  127 bits (64), Expect = 4e-26
 Identities = 133/156 (85%)
 Strand = Plus / Minus

                                                                       
Query: 326 ggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgatcatggg 385
           ||||| |||||| || | ||||||||||| |  ||| ||||| || ||||||||||  ||
Sbjct: 875 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagcgg 816

                                                                       
Query: 386 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 445
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 815 ccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatgacagcagc 756

                                               
Query: 446 ccccaggctcctggccgggttgatgccggtgccggt 481
            |||| ||| || |||||||||||||||||||||||
Sbjct: 755 tcccaagcttctcgccgggttgatgccggtgccggt 720



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score =  109 bits (55), Expect = 8e-21
 Identities = 103/119 (86%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 422
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723

                                                                      
Query: 423 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
              |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 722 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggt 664



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score =  109 bits (55), Expect = 8e-21
 Identities = 103/119 (86%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 422
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281

                                                                      
Query: 423 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
              |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 280 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggt 222



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score =  109 bits (55), Expect = 8e-21
 Identities = 103/119 (86%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 422
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280

                                                                      
Query: 423 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
              |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 279 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggt 221



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score =  107 bits (54), Expect = 3e-20
 Identities = 135/162 (83%)
 Strand = Plus / Minus

                                                                       
Query: 320 cttgatggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgat 379
           |||| |||||| |||||| || | |||||||||||  ||||| ||||| || || |||||
Sbjct: 913 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 854

                                                                       
Query: 380 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 439
            |  || || |||||||| ||||| || |||||||||||||| || ||||||||||| ||
Sbjct: 853 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 794

                                                     
Query: 440 ggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           ||| || || | |||||| |||||||||||||||||||||||
Sbjct: 793 ggcagctccgaagctcctcgccgggttgatgccggtgccggt 752



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score =  103 bits (52), Expect = 5e-19
 Identities = 130/156 (83%)
 Strand = Plus / Minus

                                                                       
Query: 326 ggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgatcatggg 385
           ||||| |||||| || | ||||||||||| |  ||| ||||| || |||||||| | |||
Sbjct: 837 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 778

                                                                       
Query: 386 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 445
            || |||||||||||||| || |||| ||| ||||||| || ||||||||| || || ||
Sbjct: 777 ccccacccagaagatccagtggtcatgccatgccttgtgctggttgtagatcaccgcagc 718

                                               
Query: 446 ccccaggctcctggccgggttgatgccggtgccggt 481
            |||| |||||| |||||||||||||||||||||||
Sbjct: 717 tcccaagctccttgccgggttgatgccggtgccggt 682



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           |||||||||||||||||||| || |||||  | || || |||||||||||||||||||| 
Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcggcg 728

                                              
Query: 447 cccaggctcctggccgggttgatgccggtgccggt 481
           || | ||||||||| ||||||||||||||||||||
Sbjct: 727 ccgaagctcctggcggggttgatgccggtgccggt 693



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Minus

                                                                       
Query: 383 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 442
           |||||| |||||||||||||| || |||| |||||| | |||| |||||||||||| |||
Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818

                                                  
Query: 443 ggcccccaggctcctggccgggttgatgccggtgccggt 481
            ||||| |||||||| || ||||||||||||||||||||
Sbjct: 817 agccccaaggctcctagctgggttgatgccggtgccggt 779



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 372 gcgccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttg 431
           ||||||||||  || || |||||||||||||| || |||||||||||||||||  |||||
Sbjct: 917 gcgccgatcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttg 858

                                                             
Query: 432 tagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||||| || || |||| ||| || || ||||||||||||||||||||
Sbjct: 857 tagatgacagcagctcccaagcttctcgcggggttgatgccggtgccggt 808



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 372 gcgccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttg 431
           ||||||||||  || || |||||||||||||| || |||||||||||||||||  |||||
Sbjct: 837 gcgccgatcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttg 778

                                                             
Query: 432 tagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||||| || || |||| ||| || || ||||||||||||||||||||
Sbjct: 777 tagatgacagcagctcccaagcttctcgcggggttgatgccggtgccggt 728



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 148/181 (81%)
 Strand = Plus / Minus

                                                                       
Query: 298 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtgga 357
           |||||||||| || || || |||||||| || || || || | |||| ||||||||| ||
Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853

                                                                       
Query: 358 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 417
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793

                                                                       
Query: 418 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 477
           |||| || ||||||||||| || || |||||||  |||||||| |||||||| |||||||
Sbjct: 792 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtgc 733

            
Query: 478 c 478
           |
Sbjct: 732 c 732



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 383 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 442
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 715

                                                  
Query: 443 ggcccccaggctcctggccgggttgatgccggtgccggt 481
            || || |||||||| || ||||||||||||||||||||
Sbjct: 714 agcgccaaggctcctcgctgggttgatgccggtgccggt 676



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 113/135 (83%)
 Strand = Plus / Minus

                                                                       
Query: 347 ctggtggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
           |||||||| || ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338

                                                                       
Query: 407 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 466
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 337 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 278

                          
Query: 467 gatgccggtgccggt 481
           |||||||||||||||
Sbjct: 277 gatgccggtgccggt 263



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 113/135 (83%)
 Strand = Plus / Minus

                                                                       
Query: 347 ctggtggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
           |||||||| || ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769

                                                                       
Query: 407 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 466
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 768 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 709

                          
Query: 467 gatgccggtgccggt 481
           |||||||||||||||
Sbjct: 708 gatgccggtgccggt 694



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 113/135 (83%)
 Strand = Plus / Minus

                                                                       
Query: 347 ctggtggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
           |||||||| || ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826

                                                                       
Query: 407 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 466
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 825 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 766

                          
Query: 467 gatgccggtgccggt 481
           |||||||||||||||
Sbjct: 765 gatgccggtgccggt 751



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 113/135 (83%)
 Strand = Plus / Minus

                                                                       
Query: 347 ctggtggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
           |||||||| || ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

                                                                       
Query: 407 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 466
            ||   |||||| |  ||| |||||||||||| ||| || || |||||||| ||||||||
Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779

                          
Query: 467 gatgccggtgccggt 481
           |||||||||||||||
Sbjct: 778 gatgccggtgccggt 764



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 383 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 442
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 792

                                                  
Query: 443 ggcccccaggctcctggccgggttgatgccggtgccggt 481
            || || |||||||| || ||||||||||||||||||||
Sbjct: 791 agcgccaaggctcctcgctgggttgatgccggtgccggt 753



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 383 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 442
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 852 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 793

                                                  
Query: 443 ggcccccaggctcctggccgggttgatgccggtgccggt 481
            || || |||||||| || ||||||||||||||||||||
Sbjct: 792 agcgccaaggctcctcgctgggttgatgccggtgccggt 754



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 383 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 442
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 795

                                                  
Query: 443 ggcccccaggctcctggccgggttgatgccggtgccggt 481
            || || |||||||| || ||||||||||||||||||||
Sbjct: 794 agcgccaaggctcctcgctgggttgatgccggtgccggt 756



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 383  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 442
            |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 1091

                                                   
Query: 443  ggcccccaggctcctggccgggttgatgccggtgccggt 481
             || || |||||||| || ||||||||||||||||||||
Sbjct: 1090 agcgccaaggctcctcgctgggttgatgccggtgccggt 1052



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                       
Query: 341 tatgtactggtggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 400
           |||| ||||||||| |||||| || || || || || || | ||| || ||||| |||||
Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814

                                                                       
Query: 401 ccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggc 460
           |||||| |||||||||||||| || ||||||||||| || || |||||||  ||||||||
Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggc 754

                             
Query: 461 cgggttgatgccggtgcc 478
            |||||||| ||||||||
Sbjct: 753 agggttgataccggtgcc 736



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                            
Query: 408      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
                ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 25184038 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 25183979

                              
Query: 468      atgccggtgccggt 481
                ||||||||||||||
Sbjct: 25183978 atgccggtgccggt 25183965



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                            
Query: 408      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
                |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 27065064 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 27065005

                              
Query: 468      atgccggtgccggt 481
                ||||| || |||||
Sbjct: 27065004 atgccagtaccggt 27064991



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                            
Query: 326      ggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgatcatggg 385
                ||||| |||||| || | ||||||||||| |  ||| ||||| || |||||||||| |||
Sbjct: 25184682 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 25184623

                                      
Query: 386      gccgacccagaagatccactga 407
                ||| ||||||||||||||||||
Sbjct: 25184622 gcccacccagaagatccactga 25184601



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                          
Query: 440      ggcggcccccaggctcctggccgggttgatgccggtgccggt 481
                |||||| || ||||| | ||| ||||||||||||||||||||
Sbjct: 35369049 ggcggcgccgaggctgcgggcggggttgatgccggtgccggt 35369008



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 45     aaattaaaacaggaaaagga 64
              ||||||||||||||||||||
Sbjct: 751943 aaattaaaacaggaaaagga 751962



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 145/178 (81%)
 Strand = Plus / Minus

                                                                       
Query: 298 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtgga 357
           |||||||||| || || || |||||||| || || || || | |||| ||||||||| ||
Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407

                                                                       
Query: 358 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 417
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347

                                                                     
Query: 418 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggt 475
           |||| || ||||||||||| || || |||||||  |||||||| |||||||| |||||
Sbjct: 346 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggt 289



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                         
Query: 408   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
             ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 84431 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 84372

                           
Query: 468   atgccggtgccggt 481
             ||||||||||||||
Sbjct: 84371 atgccggtgccggt 84358



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                         
Query: 326   ggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgatcatggg 385
             ||||| |||||| || | ||||||||||| |  ||| ||||| || |||||||||| |||
Sbjct: 85075 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 85016

                                   
Query: 386   gccgacccagaagatccactga 407
             ||| ||||||||||||||||||
Sbjct: 85015 gcccacccagaagatccactga 84994



to top

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 786

                                           
Query: 447 cccaggctcctggccgggttgatgccggtgcc 478
           || |  ||||| |||||||| || ||||||||
Sbjct: 785 ccaaaactcctagccgggtttattccggtgcc 754



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           ||||||||||| ||||||||||| || |||||
Sbjct: 752 aggctcctggctgggttgatgccagtaccggt 721



to top

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 781

                                           
Query: 447 cccaggctcctggccgggttgatgccggtgcc 478
           || |  ||||| |||||||| || ||||||||
Sbjct: 780 ccaaaactcctagccgggtttattccggtgcc 749



to top

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 699

                                           
Query: 447 cccaggctcctggccgggttgatgccggtgcc 478
           || |  ||||| |||||||| || ||||||||
Sbjct: 698 ccaaaactcctagccgggtttattccggtgcc 667



to top

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 783

                                           
Query: 447 cccaggctcctggccgggttgatgccggtgcc 478
           || |  ||||| |||||||| || ||||||||
Sbjct: 782 ccaaaactcctagccgggtttattccggtgcc 751



to top

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 760

                                           
Query: 447 cccaggctcctggccgggttgatgccggtgcc 478
           || |  ||||| |||||||| || ||||||||
Sbjct: 759 ccaaaactcctagccgggtttattccggtgcc 728



to top

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 770

                                           
Query: 447 cccaggctcctggccgggttgatgccggtgcc 478
           || |  ||||| |||||||| || ||||||||
Sbjct: 769 ccaaaactcctagccgggtttattccggtgcc 738



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           ||||||||||| ||||||||||| || |||||
Sbjct: 785 aggctcctggctgggttgatgccagtaccggt 754



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           ||||||||||| ||||||||||| || |||||
Sbjct: 840 aggctcctggctgggttgatgccagtaccggt 809



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           ||||||||||| ||||||||||| || |||||
Sbjct: 785 aggctcctggctgggttgatgccagtaccggt 754



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           ||||||||||||||||| |||||||| ||||||||||||||||| || || || || || 
Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgtaaattacagcagctccg 687

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  |||||||| |||||||| |||||||||||
Sbjct: 686 aaactcctggctgggttgataccggtgccggt 655



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 297 ttgctcctgaaggagccgagggccttgatggc 328
           |||||||||||||| ||||| |||||||||||
Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           ||||||||||| ||||||||||| || |||||
Sbjct: 780 aggctcctggctgggttgatgccagtaccggt 749



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           ||||||||||| ||||||||||| || |||||
Sbjct: 783 aggctcctggctgggttgatgccagtaccggt 752



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||| ||||| || ||||||||||||||||| ||||| |||||||| || || 
Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgacagcagct 712

                                              
Query: 447 cccaggctcctggccgggttgatgccggtgccggt 481
           || | ||| || ||||||||||| |||||||||||
Sbjct: 711 ccgaagcttctagccgggttgataccggtgccggt 677



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 372 gcgccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttg 431
           |||||||| | ||||||||||||||||||||| || ||   ||| || |  |||  ||||
Sbjct: 915 gcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatgatcccggttg 856

                                                             
Query: 432 tagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           ||||||| |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 855 tagatgatggcggcgccaaggctcctagccgggttgatgccggtgccggt 806



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 372 gcgccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttg 431
           |||||||| | ||||||||||||||||||||| || ||   ||| || |  |||  ||||
Sbjct: 910 gcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatgatcccggttg 851

                                                             
Query: 432 tagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           ||||||| |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 850 tagatgatggcggcgccaaggctcctagccgggttgatgccggtgccggt 801



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0475E07
          Length = 139961

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                         
Query: 404   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 463
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 92340 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 92281

                               
Query: 464   gttgatgccggtgccggt 481
             ||||||||||||||||||
Sbjct: 92280 gttgatgccggtgccggt 92263



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                      
Query: 426    ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
              |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 110249 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggt 110194



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                      
Query: 426    ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
              |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggt 102314



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 360    gccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
              |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 102534 gccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 360   gccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
             |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 92498 gccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 363    gcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
              ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 291   tacgcgttgctcctgaaggagccg 314
             ||||||||||||| ||||||||||
Sbjct: 92564 tacgcgttgctccggaaggagccg 92541



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                        
Query: 372  gcgccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttg 431
            |||||||| | ||||||||||||||||||||| || ||   ||| || |  |||  ||||
Sbjct: 1239 gcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatgatcccggttg 1180

                                                              
Query: 432  tagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
            ||||||| |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 1179 tagatgatggcggcgccaaggctcctagccgggttgatgccggtgccggt 1130



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || || ||||| || | ||||||||||||||||| ||| || |||
Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatgatggccgcaccc 751

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |||||||  || |||||||||||||| |||||
Sbjct: 750 aggctccgagctgggttgatgccggttccggt 719



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 422
           ||||||||||| ||||| |  ||||| ||||||||||||||||| ||   |||||| |||
Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttg 825

                                                                   
Query: 423 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgcc 478
              |||||||| | ||||||||| || |||||||| ||||||||||| ||||||||
Sbjct: 824 ctgttgttgtacacgacggcggcgccgaggctcctcgccgggttgataccggtgcc 769



to top

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| || 
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           | ||| ||||| ||||| || |||||||||||
Sbjct: 686 aagcttctggcggggttaattccggtgccggt 655



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 82/96 (85%)
 Strand = Plus / Minus

                                                                       
Query: 383 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 442
           ||||||||||||||||||||| || |||| |||||| |  ||| |||||||||||| |||
Sbjct: 348 ggggccgacccagaagatccaatggtcattccaggcgtgctccctgttgtagatgatggc 289

                                               
Query: 443 ggcccccaggctcctggccgggttgatgccggtgcc 478
            || || |||||||| || ||||||||||| |||||
Sbjct: 288 agcgccaaggctcctagctgggttgatgccagtgcc 253



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 391 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 450
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683

                                          
Query: 451 ggctcctggccgggttgatgccggtgccggt 481
            ||||| ||| ||||||||||| ||||||||
Sbjct: 682 tgctccgggcagggttgatgcccgtgccggt 652



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 296 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 352
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 391 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 450
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669

                                          
Query: 451 ggctcctggccgggttgatgccggtgccggt 481
            ||||| ||| ||||||||||| ||||||||
Sbjct: 668 tgctccgggcagggttgatgcccgtgccggt 638



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 298 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 352
           |||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 391 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 450
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782

                                          
Query: 451 ggctcctggccgggttgatgccggtgccggt 481
            ||||| ||| ||||||||||| ||||||||
Sbjct: 781 tgctccgggcagggttgatgcccgtgccggt 751



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 296 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 352
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 391 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 450
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776

                                          
Query: 451 ggctcctggccgggttgatgccggtgccggt 481
            ||||| ||| ||||||||||| ||||||||
Sbjct: 775 tgctccgggcagggttgatgcccgtgccggt 745



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 296 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 352
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 391 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 450
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770

                                          
Query: 451 ggctcctggccgggttgatgccggtgccggt 481
            ||||| ||| ||||||||||| ||||||||
Sbjct: 769 tgctccgggcagggttgatgcccgtgccggt 739



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 296 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 352
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 93/111 (83%)
 Strand = Plus / Minus

                                                                       
Query: 368 cgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttgtcctt 427
           |||||||||||| |  || || |||||||||||||| || || ||||| ||||  | |||
Sbjct: 896 cgccgcgccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttctt 837

                                                              
Query: 428 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgcc 478
           ||||||||||| |||||| || |||  ||| ||||||||||||||||||||
Sbjct: 836 gttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtgcc 786



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                     
Query: 447 cccaggctcctggccgggttgatgcc 472
           || || |||||||||||||| |||||
Sbjct: 774 ccgagactcctggccgggttaatgcc 749



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 726

                                     
Query: 447 cccaggctcctggccgggttgatgcc 472
           || || |||||||||||||| |||||
Sbjct: 725 ccgagactcctggccgggttaatgcc 700



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                     
Query: 447 cccaggctcctggccgggttgatgcc 472
           || || |||||||||||||| |||||
Sbjct: 774 ccgagactcctggccgggttaatgcc 749



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 90  ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 31

                                     
Query: 447 cccaggctcctggccgggttgatgcc 472
           || || |||||||||||||| |||||
Sbjct: 30  ccgagactcctggccgggttaatgcc 5



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 399

                                     
Query: 450 aggctcctggccgggttgatgccggt 475
           ||||||||||| |||||||| |||||
Sbjct: 398 aggctcctggcggggttgataccggt 373



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 729

                                     
Query: 450 aggctcctggccgggttgatgccggt 475
           ||||||||||| |||||||| |||||
Sbjct: 728 aggctcctggcggggttgataccggt 703



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 408 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
           |||| ||||||| |||| |||||||||||||| || || |||| ||| || |||||||||
Sbjct: 407 tcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggttg 348

                         
Query: 468 atgccggtgccggt 481
           ||||||||||||||
Sbjct: 347 atgccggtgccggt 334



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 99

                                     
Query: 447 cccaggctcctggccgggttgatgcc 472
           || || |||||||||||||| |||||
Sbjct: 98  ccgagactcctggccgggttaatgcc 73



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 358

                                     
Query: 447 cccaggctcctggccgggttgatgcc 472
           || || |||||||||||||| |||||
Sbjct: 357 ccgagactcctggccgggttaatgcc 332



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 764

                                     
Query: 447 cccaggctcctggccgggttgatgcc 472
           || || |||||||||||||| |||||
Sbjct: 763 ccgagactcctggccgggttaatgcc 738



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 739

                                     
Query: 447 cccaggctcctggccgggttgatgcc 472
           || || |||||||||||||| |||||
Sbjct: 738 ccgagactcctggccgggttaatgcc 713



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 773

                                     
Query: 447 cccaggctcctggccgggttgatgcc 472
           || || |||||||||||||| |||||
Sbjct: 772 ccgagactcctggccgggttaatgcc 747



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                             
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||||||||| |||||||||||||||||||||||||  |||||||||||
Sbjct: 845 ccgacccagaaaatccactgatcatcccaggccttgttgttgttgtagat 796



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 384 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 443
           |||||||||||||| ||||| ||||| ||||| |||||   || |||||| |  ||||| 
Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctttcgctggttgtacacaacggcc 135

                                                 
Query: 444 gcccccaggctcctggccgggttgatgccggtgccggt 481
           | |||||||||||| |||||||||||||| ||||||||
Sbjct: 134 ggccccaggctccttgccgggttgatgcccgtgccggt 97



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 626 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 567

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           | |||||| ||||| |||||||| ||||||||
Sbjct: 566 aagctcctcgccggattgatgcccgtgccggt 535



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 426 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||| |||||||| |||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 968 ttgtcgtagatgatggcggcgccgaggctcctggcggggttgatgccggtgccggt 913



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||||   ||||||||||| |  ||  |||||||||||| ||||||||||
Sbjct: 833 acccagaaaatccacatgtcatcccaggcatgctctctgttgtagatgatggcggccccc 774

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           || ||||| || |||||||||||||| |||||
Sbjct: 773 agactcctagcagggttgatgccggttccggt 742



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 808 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 749

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           | |||||| ||||| |||||||| ||||||||
Sbjct: 748 aagctcctcgccggattgatgcccgtgccggt 717



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || ||||||||||| || |  | |||| |||| || || || || 
Sbjct: 814 acccagaagatccaatggtcatcccaggctttctgttggttgaagataacagcagctccg 755

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           || |||||||||||||||||||||||||||||
Sbjct: 754 agactcctggccgggttgatgccggtgccggt 723



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                       
Query: 383 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 442
           ||||||||||||||||||||| || || | |||||| |  ||| |||||||||||| |||
Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatgatggc 796

                                               
Query: 443 ggcccccaggctcctggccgggttgatgccggtgcc 478
            || || |||||||| || ||||||||||| |||||
Sbjct: 795 agcgccaaggctcctagctgggttgatgccagtgcc 760



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || |  |||||||||||||| | ||||||||| || ||||| |||
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712

                                  
Query: 450 aggctcctggccgggttgatgcc 472
           || ||||| || |||||||||||
Sbjct: 711 agactcctagcagggttgatgcc 689



to top

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| |||||||||||||| || || |||||| ||||||| || || || 
Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgacagcagcgcca 767

                                  
Query: 450 aggctcctggccgggttgatgcc 472
           | ||||||||| |||||||||||
Sbjct: 766 aagctcctggcagggttgatgcc 744



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 427 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||||||||| ||| || || |||||||| |||||||||||||||||||||||
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggt 603



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 347  ctggtggtggaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 406
            |||||||| || ||| || | ||| |||||||| | ||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 427 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||||||||| ||| || ||||||||||| || ||||||||||||||||||||
Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttgatgccggtgccggt 776



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                         
Query: 408   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
             ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28019 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 27960

                           
Query: 468   atgccggtgccggt 481
             ||||||||||||||
Sbjct: 27959 atgccggtgccggt 27946



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 383   ggggccgacccagaagatccactg 406
             |||||| |||||||||||||||||
Sbjct: 28605 ggggccaacccagaagatccactg 28582



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||||   ||||||||||| |  || |||||||||| || ||||||||||
Sbjct: 841 acccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgatggcggccccc 782

                                     
Query: 450 aggctcctggccgggttgatgccggt 475
           || ||||| || ||||||||||||||
Sbjct: 781 agactcctagcagggttgatgccggt 756



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                            
Query: 408      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
                ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28020793 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 28020734

                              
Query: 468      atgccggtgccggt 481
                ||||||||||||||
Sbjct: 28020733 atgccggtgccggt 28020720



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                            
Query: 408      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
                |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 26074238 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 26074179

                              
Query: 468      atgccggtgccggt 481
                ||||||||||||||
Sbjct: 26074178 atgccggtgccggt 26074165



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                           
Query: 411     tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 470
               ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 8906901 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 8906960

                          
Query: 471     ccggtgccggt 481
               || ||||||||
Sbjct: 8906961 cccgtgccggt 8906971



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                        
Query: 296     gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 352
               |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                            
Query: 326      ggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgatcatggg 385
                ||||| |||||| || | ||||||||||| |  ||| ||||| || |||||||| | |||
Sbjct: 26074829 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 26074770

                                    
Query: 386      gccgacccagaagatccact 405
                 || ||||||||||||||||
Sbjct: 26074769 ccccacccagaagatccact 26074750



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 383      ggggccgacccagaagatccactg 406
                |||||| |||||||||||||||||
Sbjct: 28021379 ggggccaacccagaagatccactg 28021356



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                         
Query: 408   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
             |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 36713 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 36654

                           
Query: 468   atgccggtgccggt 481
             ||||| || |||||
Sbjct: 36653 atgccagtaccggt 36640



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                          
Query: 408    tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
              |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 118266 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 118207

                            
Query: 468    atgccggtgccggt 481
              ||||| || |||||
Sbjct: 118206 atgccagtaccggt 118193



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                          
Query: 408    tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
              |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 108565 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 108506

                            
Query: 468    atgccggtgccggt 481
              ||||||||||||||
Sbjct: 108505 atgccggtgccggt 108492



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                          
Query: 326    ggcgccggccctgagtatgtactggtggtggaaggccgcgatcgccgcgccgatcatggg 385
              ||||| |||||| || | ||||||||||| |  ||| ||||| || |||||||| | |||
Sbjct: 109156 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 109097

                                  
Query: 386    gccgacccagaagatccact 405
               || ||||||||||||||||
Sbjct: 109096 ccccacccagaagatccact 109077



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || || ||||| ||||  | |||||||||||||| |||||| || 
Sbjct: 859 acccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatgatggcggcgccg 800

                                     
Query: 450 aggctcctggccgggttgatgccggt 475
           |||  ||| |||||||||||||||||
Sbjct: 799 agggacctcgccgggttgatgccggt 774



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| ||||||||||| |||| ||| | |||| ||||||  || || || 
Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatgatagcagctcca 756

                                     
Query: 450 aggctcctggccgggttgatgccggt 475
           ||||||| ||| ||||||||||||||
Sbjct: 755 aggctccgggcggggttgatgccggt 730



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||| ||||| ||||||||||| |||||||| |||||||||||||
Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatga 751



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 384 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 443
           ||||| |||||||||||||| || |||||||| || | ||| |||||| |||||| ||||
Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatgatggcg 807

                                        
Query: 444 gcccccaggctcctggccgggttgatgcc 472
           || || || ||||| |||||||| |||||
Sbjct: 806 gctccaagactccttgccgggttaatgcc 778



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 383 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||| |||||||| ||||| ||||||||||||||  ||||||||||| ||||||
Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttgaagatga 828



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 383 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 442
           ||||||||||||||||||||| || ||   |||||| |  ||| |||||||||||| |||
Sbjct: 280 ggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagatgatggc 221

                                               
Query: 443 ggcccccaggctcctggccgggttgatgccggtgcc 478
            || || |||||||| || ||||||||||| |||||
Sbjct: 220 agcgccaaggctcctagctgggttgatgccagtgcc 185



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                         
Query: 411   tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 470
             ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 91210 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 91269

                        
Query: 471   ccggtgccggt 481
             || ||||||||
Sbjct: 91270 cccgtgccggt 91280



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 296   gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 352
             |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||||||||| || |||||||| |||||||| | |||||| || || || || 
Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagct 750

                                  
Query: 447 cccaggctcctggccgggttgat 469
           || | |||||| |||||||||||
Sbjct: 749 ccaaagctcctagccgggttgat 727



to top

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                       
Query: 391 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 450
           ||||||| ||||||||||||||||| | ||| |  ||||||||||| || ||||| ||||
Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagatcacagcggctccca 422

                                          
Query: 451 ggctcctggccgggttgatgccggtgccggt 481
            ||| | ||||||||| ||||| || |||||
Sbjct: 421 agctacgggccgggttaatgccagttccggt 391



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 372 gcgccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttg 431
           |||||||| | ||||||||||||||||||||| || ||   ||| || |  |||  ||||
Sbjct: 765 gcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatgatcccggttg 706

                                                             
Query: 432 tagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           ||||||| |||||| || ||||||||    ||||||||||||||||||||
Sbjct: 705 tagatgatggcggcgccaaggctcctaaaggggttgatgccggtgccggt 656



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||||||||| || ||||||||||| | |||| ||||||||||||
Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatga 722



to top

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 392 ccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           |||||||||||| || |||||||| || |||||||||||||||||
Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgtagat 724



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| |||||||| ||||||||||| || || || || 
Sbjct: 832 acccagaaaatccattggtcatcccaagccttgtctttgttgtagataacagcagctcca 773

                                        
Query: 450 aggctcctggccgggttgatgccggtgcc 478
           || || || || ||||||||||| |||||
Sbjct: 772 agacttctagcggggttgatgccagtgcc 744



to top

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 392 ccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccag 451
           |||||||||||| || |||||||| || ||||||||||| |||||||| || || || | 
Sbjct: 812 ccagaagatccattggtcatcccaagctttgtccttgttatagatgacagcagctcctaa 753

                                
Query: 452 gctcctggccgggttgatgcc 472
            ||||| || |||||||||||
Sbjct: 752 actcctagcagggttgatgcc 732



to top

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 815 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 756

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 755 aaactcctagccgggttgatgccggttccggt 724



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| |||| ||| |||||||||||||  || || || 
Sbjct: 815 acccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatgatagcagctcca 756

                               
Query: 450 aggctcctggccgggttgat 469
           || |||||||| ||||||||
Sbjct: 755 agactcctggcagggttgat 736



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           ||||| || ||||| || |||||||||| |||||| | |||||||||||| || || || 
Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgacagcagctcca 784

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           | |||||| || ||||||||||| || |||||
Sbjct: 783 aagctcctagcagggttgatgccagttccggt 752



to top

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                               
Query: 450 aggctcctggccgggttgat 469
           | |||||| || ||||||||
Sbjct: 740 aagctcctagcagggttgat 721



to top

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                               
Query: 450 aggctcctggccgggttgat 469
           | |||||| || ||||||||
Sbjct: 740 aagctcctagcagggttgat 721



to top

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| || ||  | |||||| |||| |||||||| || 
Sbjct: 501 acccagaaaatccaatggtcatcccaagcttttccgttgttgaagatcacggcggcgccg 442

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           | |||||| |||||||| || |||||||||||
Sbjct: 441 aagctcctcgccgggttaatcccggtgccggt 410



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                            
Query: 438      acggcggcccccaggctcctggccgggttgatgccggtgccggt 481
                |||||||| || |||||||| |||||||||||||| ||||||||
Sbjct: 21009488 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggt 21009445



to top

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggt 709



to top

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggt 709



to top

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 791 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 732

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 731 aaactcctagccgggttgatgccggttccggt 700



to top

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggt 709



to top

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 740 aaactcctagccgggttgatgccggttccggt 709



to top

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 492 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 433

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 432 aaactcctagccgggttgatgccggttccggt 401



to top

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 801 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 742

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 741 aaactcctagccgggttgatgccggttccggt 710



to top

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 816 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 757

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 756 aaactcctagccgggttgatgccggttccggt 725



to top

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                          
Query: 438    acggcggcccccaggctcctggccgggttgatgccggtgccggt 481
              |||||||| || |||||||| |||||||||||||| ||||||||
Sbjct: 101577 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggt 101534



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || ||||||||||| |    |||||||||||||| ||| || || 
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           || |||||||| ||||||||||| || |||||
Sbjct: 814 agactcctggctgggttgatgccagttccggt 783



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 438 acggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||||| || |||||||| |||||||||||||| ||||||||
Sbjct: 750 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggt 707



to top

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 438 acggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||||| || |||||||| |||||||||||||| ||||||||
Sbjct: 648 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggt 605



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 438 acggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||||| || |||||||| |||||||||||||| ||||||||
Sbjct: 748 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggt 705



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 438 acggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||||| || |||||||| |||||||||||||| ||||||||
Sbjct: 743 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggt 700



to top

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 438   acggcggcccccaggctcctggccgggttgatgccggtgccggt 481
             |||||||| || |||||||| |||||||||||||| ||||||||
Sbjct: 30788 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggt 30745



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || || 
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766

                               
Query: 450 aggctcctggccgggttgat 469
           || |||||||| ||||||||
Sbjct: 765 agactcctggcagggttgat 746



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 838 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 779

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  || || || ||||||||||| ||||||||
Sbjct: 778 aaacttctagctgggttgatgccagtgccggt 747



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 354 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 295

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  || || || ||||||||||| ||||||||
Sbjct: 294 aaacttctagctgggttgatgccagtgccggt 263



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 390  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
            |||||||| | ||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956

                                            
Query: 450  aggctcctggccgggttgatgccggtgccggt 481
            || |||||||| ||||||||||| || |||||
Sbjct: 955  agactcctggctgggttgatgccagttccggt 924



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||| ||||| || |||||||| ||||||||   |||| | || ||||| |||
Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtcgccgttgaaaatcacggccgcc 769

                                              
Query: 447 cccaggctcctggccgggttgatgccggtgccggt 481
           || |  ||||| ||||||||||| ||||| |||||
Sbjct: 768 ccgaaactcctcgccgggttgattccggtaccggt 734



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 372 gcgccgatcatggggccgacccagaagatccactg 406
           |||||||| | ||||||||||||||||||||||||
Sbjct: 313 gcgccgatgaaggggccgacccagaagatccactg 347



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 372 gcgccgatcatggggccgacccagaagatccactg 406
           |||||||| | ||||||||||||||||||||||||
Sbjct: 464 gcgccgatgaaggggccgacccagaagatccactg 430



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           |||||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || 
Sbjct: 800 ccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagct 741

                                  
Query: 447 cccaggctcctggccgggttgat 469
           || || ||||| || ||||||||
Sbjct: 740 ccaagactccttgctgggttgat 718



to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Minus

                                                                         
Query: 404   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 463
             |||||||||||| ||||| |  ||||||||||||||||| || || |  ||||| |||||
Sbjct: 65646 ctgatcatcccaagccttttgattgttgtagatgacggcagctccaaaactcctagccgg 65587

                            
Query: 464   gttgatgccggtgcc 478
             ||| || ||||||||
Sbjct: 65586 gtttattccggtgcc 65572



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ccgacccagaagatccactg 406
             ||||||||||||||||||||
Sbjct: 65741 ccgacccagaagatccactg 65722



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           |||||||||||||| || |||||||| ||||| || |||||||||||
Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagat 694



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 423   tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgcc 472
             |||||||||||||||| ||| || || || |||||||||||||| |||||
Sbjct: 75489 tccttgttgtagatgatggcagctccgagactcctggccgggttaatgcc 75440



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ccgacccagaagatccactg 406
             ||||||||||||||||||||
Sbjct: 75658 ccgacccagaagatccactg 75639



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 423   tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgcc 472
             |||||||||||||||| ||| || || || |||||||||||||| |||||
Sbjct: 33957 tccttgttgtagatgatggcagctccgagactcctggccgggttaatgcc 33908



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ccgacccagaagatccactg 406
             ||||||||||||||||||||
Sbjct: 34126 ccgacccagaagatccactg 34107



to top

>gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water channel AQP-t1 mRNA,
           complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 375 ccgatcatggggccgacccagaagatccactgat 408
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 375 ccgatcatggggccgacccagaagatccactgat 408
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| ||||||||||| || | | |||||||| ||||||  || || || 
Sbjct: 805 acccagaaaatccagtgatcatcccaagcgtggcccttgttgaagatgatagcagcaccg 746

                                     
Query: 450 aggctcctggccgggttgatgccggt 475
           || ||||| || ||||||||||||||
Sbjct: 745 agactccttgctgggttgatgccggt 720



to top

>ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channel AT3G54820
           (PIP2;5/PIP2D) mRNA, complete cds
          Length = 1229

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 851 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 803



to top

>gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758) putative
           aquaporin/plasma membrane intrinsic protein (At3g54820)
           mRNA, complete cds
          Length = 1143

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 771 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 723



to top

>gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 892

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 755 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 707



to top

>gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 1194

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 850 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 802



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttgaagatga 767



to top

>emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB54ZF09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 897

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 571 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 523



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 426 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgcc 478
           |||||||| ||||| || ||||| | |||||||||||||||||| || |||||
Sbjct: 759 ttgttgtacatgactgcagccccaaagctcctggccgggttgataccagtgcc 707



to top

>gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete sequence
          Length = 1222

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 852 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 804



to top

>emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene), clone pP5L
          Length = 1157

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || ||||||||  | ||||| |||||||||||||| || || || 
Sbjct: 819 acccagaaaatccaatggtcatcccacactttgtcattgttgtagatgacagcagctcca 760

                            
Query: 450 aggctcctggccgggtt 466
           | ||||||||| |||||
Sbjct: 759 aagctcctggctgggtt 743



to top

>emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene), clone pP2L
          Length = 1095

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||| ||||| |||||||||||| | | |||||||||| ||||||
Sbjct: 868 acccagaaaatccaatgatcatcccagccttggtccttgttgaagatga 820



to top

>dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane intrinsic protein,
           complete cds
          Length = 1145

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 426 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgcc 478
           ||||||||||||| ||| ||||| ||||| || || ||||||||||| |||||
Sbjct: 845 ttgttgtagatgatggcagccccaaggcttctagcagggttgatgccagtgcc 793



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||
Sbjct: 815 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatga 767



to top

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           ||||| |||||||| || |||||||||||||| |  | |||||| ||||| || || || 
Sbjct: 848 acccaaaagatccaatggtcatcccaggccttctgttggttgtacatgacagcagctcct 789

                                        
Query: 450 aggctcctggccgggttgatgccggtgcc 478
           |||||||| || ||||| ||||| |||||
Sbjct: 788 aggctcctagcagggttaatgccagtgcc 760



to top

>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA,
           complete cds
          Length = 1143

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||| ||||| |||||
Sbjct: 759 aaactcctagccgggttgataccggttccggt 728



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 857



to top

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           ||||||||||| ||||||||||| ||||||||
Sbjct: 380 aggctcctggcagggttgatgccagtgccggt 349



to top

>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA,
           complete cds
          Length = 889

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 752 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 693

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||| ||||| |||||
Sbjct: 692 aaactcctagccgggttgataccggttccggt 661



to top

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||  || || 
Sbjct: 767 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggacgctccg 708

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||||||||| |||||
Sbjct: 707 aaactcctagccgggttgatgccggttccggt 676



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 763



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 744



to top

>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 2C (At2g37180) mRNA, complete cds
          Length = 1151

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||| ||||| |||||
Sbjct: 759 aaactcctagccgggttgataccggttccggt 728



to top

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 411 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 470
           |||||||||||||| ||||||||||| || || || || ||||| || || ||||| |||
Sbjct: 485 tcccaggccttgtcattgttgtagatcactgcagctccaaggcttcttgctgggtttatg 426

                   
Query: 471 ccggtgcc 478
           || |||||
Sbjct: 425 ccagtgcc 418



to top

>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete
           cds
          Length = 1279

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           ||||| |||||||| || || | ||| || ||||| | |||| |||| ||||| || || 
Sbjct: 797 acccaaaagatccaatggtctttccaagctttgtcttggttgaagataacggcagctcca 738

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           || ||||| || ||||||||||||||||||||
Sbjct: 737 agactccttgctgggttgatgccggtgccggt 706



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 836 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 785



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           ||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || || 
Sbjct: 798 acccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagctcca 739

                               
Query: 450 aggctcctggccgggttgat 469
           || ||||| || ||||||||
Sbjct: 738 agactccttgctgggttgat 719



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 775



to top

>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein
           2;5, complete cds
          Length = 1126

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgta 433
           |||||||||||||| || |||||||| |||||| | ||||||||
Sbjct: 786 acccagaagatccaatggtcatcccaagccttgccattgttgta 743



to top

>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence
          Length = 1060

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||| ||||| |||||
Sbjct: 759 aaactcctagccgggttgataccggttccggt 728



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| ||||||| ||| || |  || ||||||||||||| ||| || || 
Sbjct: 867 acccagaagatccaatgatcattccatgcgtgttcattgttgtagatgatggctgcaccg 808

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           || || | ||||||||| || || ||||||||
Sbjct: 807 agacttcgggccgggttaatacccgtgccggt 776



to top

>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel
           protein
          Length = 1121

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 802 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 743

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  ||||| ||||||||||| ||||| |||||
Sbjct: 742 aaactcctagccgggttgataccggttccggt 711



to top

>gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1237

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgta 433
           |||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 816 acccagaatatccactgatcgtcccaagctttatccttgttgta 773



to top

>emb|AJ605569.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-1 gene),
           clone pR450-8
          Length = 452

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 450
           ||||| ||||||| || ||||||||  | ||||| |||||||||||||| || || || |
Sbjct: 445 cccagtagatccaatggtcatcccacactttgtcattgttgtagatgacagcagctccaa 386

                           
Query: 451 ggctcctggccgggtt 466
            ||||||||| |||||
Sbjct: 385 agctcctggctgggtt 370



to top

>emb|AJ605565.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-2 gene),
           clone pR450-3
          Length = 452

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 401 ccactgatcatcccaggccttgtccttgttgtagat 436
           |||||| |||||||| ||||| ||||||||||||||
Sbjct: 435 ccactggtcatcccatgccttctccttgttgtagat 400



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           || || || || ||||||||||| || |||||
Sbjct: 818 agacttcttgctgggttgatgccagttccggt 787



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           |||||||| || ||||| |||||||||||||||||    ||||||||||| || || || 
Sbjct: 816 ccgacccaaaatatccattgatcatcccaggccttagaattgttgtagataaccgcagct 757

                                           
Query: 447 cccaggctcctggccgggttgatgccggtgcc 478
           || | ||| || || |||||||| ||||||||
Sbjct: 756 ccgaagcttctagcggggttgattccggtgcc 725



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds
          Length = 1049

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||||||||| ||||||||||| |||  ||| | |||| ||||||  || || || 
Sbjct: 797 acccagaagatccagtgatcatcccatgcccggtcttggttgaagatgatagcagctcca 738

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           ||||||| ||| ||| |||| ||||| |||||
Sbjct: 737 aggctccgggcgggggtgataccggttccggt 706



to top

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 788 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcggctccg 729

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  |||||||||||||| || ||||| |||||
Sbjct: 728 aaactcctggccgggttaataccggttccggt 697



to top

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 449
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 789 acccagaaaatccagtggtcatcccacggcttggactcgttgtagataaccgcggctcca 730

                                           
Query: 450 aggctcctggccgggttgatgccggtgccggt 481
           |  |||||||||||||| || ||||| |||||
Sbjct: 729 aaactcctggccgggttaatcccggttccggt 698



to top

>ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3);
           water channel AT4G35100 (PIP3) mRNA, complete cds
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 375 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 434
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                          
Query: 435 atgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           || ||||| || || | ||| |  ||||||||||| ||||| |||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggt 717



to top

>gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence
          Length = 514

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 163 acccaaaagatccaatggtcatcccaagccttctcgttgttgtagat 117



to top

>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA,
           partial cds
          Length = 380

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||| ||||| || || ||||| |  | ||||||||||||||| | |||||| 
Sbjct: 219 ccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgtagataatggcggct 160

                                  
Query: 447 cccaggctcctggccgggttgat 469
           || ||||| || || ||||||||
Sbjct: 159 ccaaggcttctagctgggttgat 137



to top

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 77/95 (81%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 446
           ||||||||||| ||||| || || ||||| ||||||||   |||| | || ||||| |||
Sbjct: 794 ccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttgaaaatcacggccgcc 735

                                              
Query: 447 cccaggctcctggccgggttgatgccggtgccggt 481
           || |  ||||| ||||||||||| ||||| |||||
Sbjct: 734 ccgaaactcctcgccgggttgattccggtaccggt 700



to top

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           |||||||||||||| || |||||||| |||| ||| | |||||||||
Sbjct: 863 acccagaagatccagtggtcatcccatgcctggtcttggttgtagat 817



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 427 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||
Sbjct: 829 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggt 775



to top

>gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic protein (mip2) mRNA,
           partial cds
          Length = 495

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 406 gatcatcccaggccttgtccttgttgtagat 436
           |||| |||||||| |||||||||||||||||
Sbjct: 490 gatcgtcccaggctttgtccttgttgtagat 460



to top

>gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100) mRNA, complete cds
          Length = 946

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 737 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 691



to top

>gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100; M4E13.150) mRNA, complete cds
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 738



to top

>gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 mRNA, complete cds
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds
          Length = 855

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                       
Query: 391 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 450
           ||||||| ||||||||||||||||| | ||| |  |||  |||||| || ||||| ||||
Sbjct: 754 cccagaaaatccactgatcatcccatgtcttttttttgccgtagatcacagcggctccca 695

                                          
Query: 451 ggctcctggccgggttgatgccggtgccggt 481
            ||| | ||||||||| ||||| || |||||
Sbjct: 694 agctacgggccgggttaatgccagttccggt 664



to top

>gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           mRNA, complete cds
          Length = 1030

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 765 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 719



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 427 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||
Sbjct: 820 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggt 766



to top

>emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 777 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 731



to top

>emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB11ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 775 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 729



to top

>emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1019

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 774 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 728



to top

>emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS11ZH09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 769 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 723



to top

>gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mRNA, complete cds
          Length = 1330

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           |||||||| ||||||||||||||||||   || || |||||||||||
Sbjct: 810 acccagaaaatccactgatcatcccagattttttcattgttgtagat 764



to top

>dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane intrinsic protein
           2;2, complete cds
          Length = 1223

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           |||||||| ||||| |||||||||||   ||| ||||||||||||||
Sbjct: 819 acccagaatatccaatgatcatcccaaatcttatccttgttgtagat 773



to top

>dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane intrinsic protein
           2;1, complete cds
          Length = 1235

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 384 gggccgacccagaagatccactgatcatcccaggccttg 422
           ||||| |||||||| ||||| ||||||||||| ||||||
Sbjct: 804 gggccaacccagaaaatccaatgatcatcccaagccttg 766



to top

>gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete sequence
          Length = 1033

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                       
Query: 375 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 434
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                          
Query: 435 atgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           || ||||| || || | ||| |  ||||||||||| ||||| |||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggt 717



to top

>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene),
           clone pR450-4
          Length = 452

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 408 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
           ||||||||||||||||||| |||||| || || || || || |  ||||| || ||||||
Sbjct: 428 tcatcccaggccttgtcctggttgtaaataacagcagctcctaaactccttgctgggttg 369

                      
Query: 468 atgccggtgcc 478
           ||||| |||||
Sbjct: 368 atgccagtgcc 358



to top

>dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds
          Length = 748

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 476 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 430



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 427 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||
Sbjct: 253 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggt 199



to top

>gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrinsic protein PIP3 mRNA,
           complete cds
          Length = 1046

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 436
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 738



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 384 gggccgacccagaagatccactgatcatcccaggccttg 422
           ||||| ||||||||||||||||| || ||||| ||||||
Sbjct: 777 gggccaacccagaagatccactggtcgtcccaagccttg 739



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 440 ggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||| || ||||| | ||| ||||||||||||||||||||
Sbjct: 887 ggcggcgccgaggctgcgggcggggttgatgccggtgccggt 846



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 387 ccgacccagaagatccactgatcatcccaggccttgtccttg 428
           ||||||||||| ||||| || |||||||| ||||| ||||||
Sbjct: 892 ccgacccagaaaatccattggtcatcccatgccttatccttg 851



to top

>gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, complete cds
          Length = 1278

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 439
           |||||||| ||||| || |||| ||| ||||||||||||  |||||||||
Sbjct: 838 acccagaaaatccattggtcattccatgccttgtccttgccgtagatgac 789



to top

>emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative transmembrane channel protein,
           partial
          Length = 634

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 390 acccagaagatccactgatcatccca 415
           |||||||||||||| |||||||||||
Sbjct: 269 acccagaagatccaatgatcatccca 244



to top

>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete
             sequence
          Length = 80736

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                         
Query: 408   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 467
             |||||||| | ||||  |||||| ||||| ||||| || || |  ||||| |||||||||
Sbjct: 25113 tcatcccatggcttgctcttgttatagattacggcagctccgaaactcctagccgggttg 25054

                           
Query: 468   atgccggtgccggt 481
             |||||||| |||||
Sbjct: 25053 atgccggttccggt 25040



to top

>gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRNA, complete cds
          Length = 1108

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 428 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||| |||| ||||| || || || ||||| ||||||||||| |||||||||||
Sbjct: 742 gttgaagataacggcagcgccaagactcctagccgggttgattccggtgccggt 689



to top

>gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA, complete cds
          Length = 819

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 375 ccgatcatggggccgacccagaagatccactgat 408
           |||||||| || ||||||||||||||||| ||||
Sbjct: 662 ccgatcatcggaccgacccagaagatccagtgat 629



to top

>gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP1;1 (PIP1;1) mRNA,
           complete cds
          Length = 1244

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 390 acccagaagatccactgatcatccca 415
           |||||||||||||| |||||||||||
Sbjct: 845 acccagaagatccagtgatcatccca 820



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 440   ggcggcccccaggctcctggccgggttgatgccggtgccggt 481
             |||||| || ||||| | ||| ||||||||||||||||||||
Sbjct: 29597 ggcggcgccgaggctgcgggcggggttgatgccggtgccggt 29556



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
           insert sequence
          Length = 1318

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 440 ggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||| || ||||| | ||| ||||||||||||||||||||
Sbjct: 886 ggcggcgccgaggctgcgggcggggttgatgccggtgccggt 845



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 440  ggcggcccccaggctcctggccgggttgatgccggtgccggt 481
            |||||| || ||||| | ||| ||||||||||||||||||||
Sbjct: 4551 ggcggcgccgaggctgcgggcggggttgatgccggtgccggt 4510



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 440 ggcggcccccaggctcctggccgggttgatgccggtgccggt 481
           |||||| || ||||| | ||| ||||||||||||||||||||
Sbjct: 864 ggcggcgccgaggctgcgggcggggttgatgccggtgccggt 823



to top

>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 918 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 870



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 361     ccgcgatcgccgcgccgatcatggg 385
               ||||||||||||||||||| |||||
Sbjct: 2960721 ccgcgatcgccgcgccgatgatggg 2960697



to top

>gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic protein PIP1-1 mRNA,
           complete cds
          Length = 1174

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           |||||||| ||||| ||||| ||||| || | ||| |||||||||||||
Sbjct: 801 acccagaatatccaatgatcgtcccatgcgtggtctttgttgtagatga 753



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 361   ccgcgatcgccgcgccgatcatggg 385
             ||||||||||||||||||| |||||
Sbjct: 88152 ccgcgatcgccgcgccgatgatggg 88128



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 359     ggccgcgatcgccgcgccgatcatg 383
               |||||||||||| ||||||||||||
Sbjct: 2316707 ggccgcgatcgcggcgccgatcatg 2316731



to top

>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 838 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 790



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgtt 430
           |||||||||| ||| || |||||||| || |||||||||||
Sbjct: 816 acccagaagacccaatggtcatcccaagcgttgtccttgtt 776



to top

>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 779 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 731



to top

>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 833 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 785



to top

>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 390 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 438
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 839 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 791


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,008,766
Number of Sequences: 3902068
Number of extensions: 4008766
Number of successful extensions: 73123
Number of sequences better than 10.0: 330
Number of HSP's better than 10.0 without gapping: 322
Number of HSP's successfully gapped in prelim test: 11
Number of HSP's that attempted gapping in prelim test: 71581
Number of HSP's gapped (non-prelim): 1528
length of query: 481
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 459
effective length of database: 17,147,199,772
effective search space: 7870564695348
effective search space used: 7870564695348
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top