ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart22e04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, com... 280 3e-72
2gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds 258 1e-65
3gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds 256 5e-65
4emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansi... 170 2e-39
5gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds 170 2e-39
6gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, com... 145 1e-31
7gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds 145 1e-31
8ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-exp... 135 1e-28
9gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete... 135 1e-28
10gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 geno... 135 1e-28
11dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 135 1e-28
12dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 1e-28
13dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 1e-28
14dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 1e-28
15dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 1e-28
16dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 1e-28
17gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 135 1e-28
18gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence 125 1e-25
19gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, co... 125 1e-25
20gb|AY111405.1| Zea mays CL5426_1 mRNA sequence 119 7e-24
21gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence 117 3e-23
22gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, pa... 117 3e-23
23gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, co... 107 3e-20
24ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-exp... 101 2e-18
25gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete... 101 2e-18
26gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 gen... 101 2e-18
27dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
28dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
29dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
30dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
31gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, pa... 100 7e-18
32emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansi... 98 3e-17
33gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete... 92 2e-15
34gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, co... 92 2e-15
35gb|AY104151.1| Zea mays PCO112411 mRNA sequence 92 2e-15
36dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 6e-15
37gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 88 3e-14
38gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare str... 88 3e-14
39gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare str... 88 3e-14
40dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
41gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence 88 3e-14
42dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
43gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, pa... 86 1e-13
44ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-exp... 84 4e-13
45gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete... 84 4e-13
46dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 4e-13
47dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 4e-13
48gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds 78 2e-11
49gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds 70 6e-09
50emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 prote... 70 6e-09
51gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence 66 9e-08
52gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 ge... 66 9e-08
53gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 ge... 66 9e-08
54gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 ge... 66 9e-08
55gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 ge... 66 9e-08
56gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 ge... 66 9e-08
57gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 ge... 66 9e-08
58gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 ge... 66 9e-08
59gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 ge... 66 9e-08
60gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 ge... 66 9e-08
61gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 ge... 66 9e-08
62gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 ge... 66 9e-08
63gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 ge... 66 9e-08
64gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 ge... 66 9e-08
65gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 ge... 66 9e-08
66gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 ge... 66 9e-08
67gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 ge... 66 9e-08
68gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 geno... 66 9e-08
69gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, parti... 66 9e-08
70gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, com... 64 4e-07
71dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 1e-06
72gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, com... 58 2e-05
73gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, com... 54 4e-04
74gb|U91981.1|TAU91981 Triticum aestivum pollen allergen homolog m... 54 4e-04
75gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds 54 4e-04
76gb|AF220610.1| Oryza sativa pollen allergen mRNA, complete cds 52 0.001
77ref|NM_197637.1| Oryza sativa (japonica cultivar-group) beta-exp... 52 0.001
78gb|AF261277.1| Oryza sativa beta-expansin (EXPB9) mRNA, complete... 52 0.001
79gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, c... 52 0.001
80gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, c... 52 0.001
81gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 geno... 52 0.001
82dbj|AK099112.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
83dbj|AK070187.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
84gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, c... 50 0.006
85gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, c... 50 0.006
86gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, p... 50 0.006
87gb|AY197353.1| Zea mays clone pJR9 beta-expansin 1 protein (EXPB... 50 0.006
88gb|AF332174.1|AF332174 Zea mays beta-expansin 1 (expB1) mRNA, co... 50 0.006
89gb|AY103636.1| Zea mays PCO124530 mRNA sequence 50 0.006
90ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-exp... 46 0.087
91dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.087
92dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.087
93dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.087
94dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, parti... 44 0.34
95gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 42 1.4
96gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete se... 42 1.4
97gb|AY197352.1| Zea mays clone pJR11 beta-expansin 9 protein (EXP... 42 1.4
98emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome... 42 1.4
99emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 42 1.4
100gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complet... 42 1.4
101gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, co... 42 1.4
102gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds 42 1.4
103gb|L14271.1|MZEPOLPI Zea mays Zea mI gene, complete cds 42 1.4
104gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 5.4
105gb|AY172516.1| Rhizobium etli transcription repair coupling fact... 40 5.4
106gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 5.4
107gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 5.4
108gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, comp... 40 5.4
109gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 5.4
110emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in ... 40 5.4
111gb|AY112069.1| Zea mays CL35761_1 mRNA sequence 40 5.4
112gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, co... 40 5.4
113gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 ... 40 5.4
114gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-... 40 5.4
115gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-... 40 5.4
116gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 5.4
117gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type... 40 5.4 
>gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, complete cds
          Length = 897

 Score =  280 bits (141), Expect = 3e-72
 Identities = 181/194 (93%), Gaps = 9/194 (4%)
 Strand = Plus / Minus

                                                                       
Query: 216 gataccaaatctagccaatgtatgcatatgattccaaatgatga-------tgagttcag 268
           ||||||||||| |||||||| ||||||  |||||||||||||||       | |||||||
Sbjct: 895 gataccaaatcaagccaatgcatgcat--gattccaaatgatgagttcggttcagttcag 838

                                                                       
Query: 269 cagcttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccggg 328
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 837 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 778

                                                                       
Query: 329 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 388
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 777 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 718

                         
Query: 389 gcctggaggcggtg 402
           ||||||||||||||
Sbjct: 717 gcctggaggcggtg 704
to top
>gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds
          Length = 810

 Score =  258 bits (130), Expect = 1e-65
 Identities = 133/134 (99%)
 Strand = Plus / Minus

                                                                       
Query: 269 cagcttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccggg 328
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 810 cagcttcagctgtactggacgatggagcggtagaaggtgctgggcgcccagttggccggg 751

                                                                       
Query: 329 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 388
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 750 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 691

                         
Query: 389 gcctggaggcggtg 402
           ||||||||||||||
Sbjct: 690 gcctggaggcggtg 677
to top
>gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds
          Length = 834

 Score =  256 bits (129), Expect = 5e-65
 Identities = 138/141 (97%)
 Strand = Plus / Minus

                                                                       
Query: 262 agttcagcagcttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagtt 321
           ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 823 agttcagcagcttcagctgtactggacgatggaacggtagaaggtgctgggcgcccagtt 764

                                                                       
Query: 322 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatgga 381
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 763 ggccgggatgaccttgtcggccaccagcgacttgccggactcgttggtgatgcgcatgga 704

                                
Query: 382 gaagggcgcctggaggcggtg 402
           |||||||||||||||||||||
Sbjct: 703 gaagggcgcctggaggcggtg 683
to top
>emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansin B3 (expB3 gene)
          Length = 1219

 Score =  170 bits (86), Expect = 2e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                       
Query: 269 cagcttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccggg 328
           |||| ||||||| |||||||||||||||||||  ||| |||||| ||||| |||||||||
Sbjct: 911 cagcctcagctgaactggacgatggagcggtaggaggcgctgggggcccaattggccggg 852

                                                                       
Query: 329 atgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 388
           |||| ||||||||| || |||  |||||||||||||||||||||||||||||||||||||
Sbjct: 851 atgatcttgtcggcgacgagctgcttgccggactcgttggtgatgcgcatggagaagggc 792

                         
Query: 389 gcctggaggcggtg 402
           ||||||||||||||
Sbjct: 791 gcctggaggcggtg 778



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 43/48 (89%), Gaps = 4/48 (8%)
 Strand = Plus / Minus

                                                            
Query: 109  tattcaagacacacatgca----cgacgacgcctacatgacacccgac 152
            |||| ||||||||||||||    |||||||||||||||||||||||||
Sbjct: 1072 tattgaagacacacatgcaggatcgacgacgcctacatgacacccgac 1025



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 5    acacacaaacagtaataacttatgat 30
            |||||||||| |||||||||||||||
Sbjct: 1186 acacacaaactgtaataacttatgat 1161
to top
>gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds
          Length = 948

 Score =  170 bits (86), Expect = 2e-39
 Identities = 119/130 (91%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| ||||||||| |||||| |||||  |||||||||||||||||
Sbjct: 882 ttcagctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatga 823

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||| ||| || |||||||||||||||||||||  |||||| ||||||||||||||||
Sbjct: 822 ccttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcgcct 763

                     
Query: 393 ggaggcggtg 402
           ||||||||||
Sbjct: 762 ggaggcggtg 753
to top
>gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, complete cds
          Length = 1013

 Score =  145 bits (73), Expect = 1e-31
 Identities = 115/129 (89%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgac 333
           ||||||| ||||||||| |||||||||   |||| |||||  ||||||||||||||||||
Sbjct: 859 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 800

                                                                       
Query: 334 cttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
            |||| |||||||||| |||||||||| ||| ||||||||||||||||||||||| ||||
Sbjct: 799 attgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctg 740

                    
Query: 394 gaggcggtg 402
           |||||||||
Sbjct: 739 gaggcggtg 731
to top
>gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds
          Length = 1056

 Score =  145 bits (73), Expect = 1e-31
 Identities = 115/129 (89%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgac 333
           ||||||| ||||||||| |||||||||   |||| |||||  ||||||||||||||||||
Sbjct: 891 tcagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgac 832

                                                                       
Query: 334 cttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
            |||| |||||||||| |||||||||| ||| ||||||||||||||||||||||| ||||
Sbjct: 831 attgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctg 772

                    
Query: 394 gaggcggtg 402
           |||||||||
Sbjct: 771 gaggcggtg 763
to top
>ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB4
           (OSJNBa0010C11.2), mRNA
          Length = 1340

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 969 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 910

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 909 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 850

               
Query: 393 ggag 396
           ||||
Sbjct: 849 ggag 846
to top
>gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete cds
          Length = 1249

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 925 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 866

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 865 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 806

               
Query: 393 ggag 396
           ||||
Sbjct: 805 ggag 802
to top
>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete
             sequence
          Length = 147117

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                         
Query: 273   ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
             |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 16771 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 16712

                                                                         
Query: 333   ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
             | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 16711 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 16652

                 
Query: 393   ggag 396
             ||||
Sbjct: 16651 ggag 16648



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                        
Query: 277  gctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacctt 336
            ||||||||||||||  || ||||| | ||   |||| |||||||||||||||||||||| 
Sbjct: 4068 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 4127

                                                                        
Query: 337  gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
            |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 4128 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 4187

                  
Query: 397  gcggtg 402
            ||||||
Sbjct: 4188 gcggtg 4193
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                            
Query: 273      ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
                |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 21341758 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21341699

                                                                            
Query: 333      ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
                | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 21341698 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 21341639

                    
Query: 393      ggag 396
                ||||
Sbjct: 21341638 ggag 21341635



 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Plus

                                                                            
Query: 276      agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
                ||||| |||||||||||||||||||   || | |||| | |||||| ||||||||||| |
Sbjct: 21311303 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21311362

                                                                            
Query: 336      tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
                ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 21311363 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 21311422

                       
Query: 396      ggcggtg 402
                |||||||
Sbjct: 21311423 ggcggtg 21311429



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                            
Query: 277      gctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacctt 336
                ||||||||||||||  || ||||| | ||   |||| |||||||||||||||||||||| 
Sbjct: 21329054 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21329113

                                                                            
Query: 337      gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
                |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 21329114 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 21329173

                      
Query: 397      gcggtg 402
                ||||||
Sbjct: 21329174 gcggtg 21329179



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 351      tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
                |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 20947292 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 20947251



 Score = 46.1 bits (23), Expect = 0.087
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                            
Query: 316      ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
                |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 21317205 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 21317264

                                           
Query: 376      catggagaagggcgcctggaggcggtg 402
                 | |||||||||  |||||||||||||
Sbjct: 21317265 gagggagaaggggccctggaggcggtg 21317291
to top
>dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-F12, full
           insert sequence
          Length = 1290

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 982 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 923

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 922 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 863

               
Query: 393 ggag 396
           ||||
Sbjct: 862 ggag 859
to top
>dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D11, full
           insert sequence
          Length = 1266

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 975 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 916

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 915 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 856

               
Query: 393 ggag 396
           ||||
Sbjct: 855 ggag 852
to top
>dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033066K12, full
            insert sequence
          Length = 1883

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                        
Query: 273  ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
            |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 1559 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1500

                                                                        
Query: 333  ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
            | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 1499 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 1440

                
Query: 393  ggag 396
            ||||
Sbjct: 1439 ggag 1436
to top
>dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033035B15, full
            insert sequence
          Length = 1475

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                        
Query: 273  ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
            |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 1163 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 1104

                                                                        
Query: 333  ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
            | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 1103 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 1044

                
Query: 393  ggag 396
            ||||
Sbjct: 1043 ggag 1040
to top
>dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G02, full
           insert sequence
          Length = 1293

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
           |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 981 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 922

                                                                       
Query: 333 ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 921 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 862

               
Query: 393 ggag 396
           ||||
Sbjct: 861 ggag 858
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  135 bits (68), Expect = 1e-28
 Identities = 110/124 (88%)
 Strand = Plus / Minus

                                                                            
Query: 273      ttcagctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatga 332
                |||||||||||||||||| ||||||||| || ||| |||||  |||||||||||||||||
Sbjct: 21353021 ttcagctgtactggacgaaggagcggtagaatgtgttgggcctccagttggccgggatga 21352962

                                                                            
Query: 333      ccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
                | |||| ||| || |||||||||||||||||||||  |||||| ||||||||||| ||||
Sbjct: 21352961 cgttgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcct 21352902

                    
Query: 393      ggag 396
                ||||
Sbjct: 21352901 ggag 21352898



 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Plus

                                                                            
Query: 276      agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
                ||||| |||||||||||||||||||   || | |||| | |||||| ||||||||||| |
Sbjct: 21322567 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 21322626

                                                                            
Query: 336      tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
                ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 21322627 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 21322686

                       
Query: 396      ggcggtg 402
                |||||||
Sbjct: 21322687 ggcggtg 21322693



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                            
Query: 277      gctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacctt 336
                ||||||||||||||  || ||||| | ||   |||| |||||||||||||||||||||| 
Sbjct: 21340318 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 21340377

                                                                            
Query: 337      gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
                |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 21340378 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 21340437

                      
Query: 397      gcggtg 402
                ||||||
Sbjct: 21340438 gcggtg 21340443



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 351      tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
                |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 20958556 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 20958515



 Score = 46.1 bits (23), Expect = 0.087
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                            
Query: 316      ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
                |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 21328469 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 21328528

                                           
Query: 376      catggagaagggcgcctggaggcggtg 402
                 | |||||||||  |||||||||||||
Sbjct: 21328529 gagggagaaggggccctggaggcggtg 21328555
to top
>gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence
          Length = 832

 Score =  125 bits (63), Expect = 1e-25
 Identities = 111/127 (87%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| ||||||||| |||||| ||||   |||||||||||||||||| |
Sbjct: 303 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 244

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 243 tgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgca 184

                  
Query: 396 ggcggtg 402
            ||||||
Sbjct: 183 tgcggtg 177
to top
>gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, complete cds
          Length = 1479

 Score =  125 bits (63), Expect = 1e-25
 Identities = 111/127 (87%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| ||||||||| |||||| ||||   |||||||||||||||||| |
Sbjct: 939 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 880

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 879 tgttggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgca 820

                  
Query: 396 ggcggtg 402
            ||||||
Sbjct: 819 tgcggtg 813
to top
>gb|AY111405.1| Zea mays CL5426_1 mRNA sequence
          Length = 528

 Score =  119 bits (60), Expect = 7e-24
 Identities = 87/96 (90%)
 Strand = Plus / Plus

                                                                       
Query: 280 gtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           |||||||| |||||| |||||  ||||| ||||  ||||||||||||||||||||| || 
Sbjct: 263 gtactggatgatggaacggtagtaggtgttgggaacccagttggccgggatgacctggtt 322

                                               
Query: 340 ggccaccagcgtcttgccggactcgttggtgatgcg 375
           ||||||||||||||||||||||||||||||||||||
Sbjct: 323 ggccaccagcgtcttgccggactcgttggtgatgcg 358
to top
>gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence
          Length = 1044

 Score =  117 bits (59), Expect = 3e-23
 Identities = 110/127 (86%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| ||||||||| |||||| ||||   |||||||||||||||||| |
Sbjct: 564 agctgtactggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgt 505

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || ||||||||| |||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 504 tgttggcgacgagcgtcttggcggactcgttgcggatgcggatggagaagggcggctgca 445

                  
Query: 396 ggcggtg 402
            ||||||
Sbjct: 444 tgcggtg 438
to top
>gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, partial cds
          Length = 907

 Score =  117 bits (59), Expect = 3e-23
 Identities = 110/127 (86%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||||||||||||| ||||||||| |||||| |||||  |||||||||||||||||| |
Sbjct: 526 agctgtactggacgaaggagcggtagaaggtgttgggcctccagttggccgggatgacgt 467

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           |   ||| || |||||||||||||||||||||  |||||| ||||||||||||| ||| |
Sbjct: 466 tcctggcgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgca 407

                  
Query: 396 ggcggtg 402
            ||||||
Sbjct: 406 tgcggtg 400
to top
>gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, complete cds
          Length = 1173

 Score =  107 bits (54), Expect = 3e-20
 Identities = 96/110 (87%)
 Strand = Plus / Minus

                                                                       
Query: 281 tactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcg 340
           ||||||||||| || |||||  ||||| ||||| |||||||||| |||||||| | ||| 
Sbjct: 867 tactggacgatagaacggtagtaggtgttgggcacccagttggcggggatgacatggtca 808

                                                             
Query: 341 gccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgc 390
           |||||||||||||||||||||||||| || ||||||| |||||| |||||
Sbjct: 807 gccaccagcgtcttgccggactcgttcgtaatgcgcagggagaatggcgc 758
to top
>ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB6
           (OSJNBb0014I11.3), mRNA
          Length = 1240

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| |||||||||||||||||||   || | |||| | |||||| ||||||||||| |
Sbjct: 922 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 863

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 862 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 803

                  
Query: 396 ggcggtg 402
           |||||||
Sbjct: 802 ggcggtg 796
to top
>gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete cds
          Length = 1250

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| |||||||||||||||||||   || | |||| | |||||| ||||||||||| |
Sbjct: 915 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 856

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 855 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 796

                  
Query: 396 ggcggtg 402
           |||||||
Sbjct: 795 ggcggtg 789
to top
>gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 genomic sequence, complete
             sequence
          Length = 135510

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                         
Query: 276   agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
             ||||| |||||||||||||||||||   || | |||| | |||||| ||||||||||| |
Sbjct: 23056 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 22997

                                                                         
Query: 336   tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
             ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 22996 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 22937

                    
Query: 396   ggcggtg 402
             |||||||
Sbjct: 22936 ggcggtg 22930



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                        
Query: 277  gctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacctt 336
            ||||||||||||||  || ||||| | ||   |||| |||||||||||||||||||||| 
Sbjct: 5305 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 5246

                                                                        
Query: 337  gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
            |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 5245 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 5186

                  
Query: 397  gcggtg 402
            ||||||
Sbjct: 5185 gcggtg 5180



 Score = 46.1 bits (23), Expect = 0.087
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                         
Query: 316   ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
             |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 17154 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 17095

                                        
Query: 376   catggagaagggcgcctggaggcggtg 402
              | |||||||||  |||||||||||||
Sbjct: 17094 gagggagaaggggccctggaggcggtg 17068
to top
>dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A09, full
           insert sequence
          Length = 1257

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| |||||||||||||||||||   || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 816

                  
Query: 396 ggcggtg 402
           |||||||
Sbjct: 815 ggcggtg 809
to top
>dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A02, full
           insert sequence
          Length = 1257

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| |||||||||||||||||||   || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 816

                  
Query: 396 ggcggtg 402
           |||||||
Sbjct: 815 ggcggtg 809
to top
>dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061F13, full
           insert sequence
          Length = 1263

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| |||||||||||||||||||   || | |||| | |||||| ||||||||||| |
Sbjct: 941 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 882

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 881 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 822

                  
Query: 396 ggcggtg 402
           |||||||
Sbjct: 821 ggcggtg 815
to top
>dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D06, full
           insert sequence
          Length = 1259

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacct 335
           ||||| |||||||||||||||||||   || | |||| | |||||| ||||||||||| |
Sbjct: 935 agctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgt 876

                                                                       
Query: 336 tgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctgga 395
           ||| ||| || |||||||||||||| ||| ||  |||||| | |||||||||||||||||
Sbjct: 875 tgttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctgga 816

                  
Query: 396 ggcggtg 402
           |||||||
Sbjct: 815 ggcggtg 809
to top
>gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, partial cds
          Length = 650

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 98/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           |||||| | ||||||||||||  ||||| |||||||||||||||| |||||||||     
Sbjct: 529 gtactgaatgatggagcggtagtaggtgttgggcgcccagttggcagggatgacccgagt 470

                                                                 
Query: 340 ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
           |||||||||| || |||||||||||||||||| |||||  ||||||||||||||
Sbjct: 469 ggccaccagcttcctgccggactcgttggtgacgcgcagcgagaagggcgcctg 416
to top
>emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansin B2 (expB2 gene)
          Length = 1194

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 103/121 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 actggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
           ||||||||| |||||||||   |||| |||||  |||||||||||||||||  |||| ||
Sbjct: 884 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgatgttgttgg 825

                                                                       
Query: 342 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 401
           | || |||  ||||||||| ||| ||||||||||||||||||| ||||||||||| ||||
Sbjct: 824 cgacgagctgcttgccggagtcgctggtgatgcgcatggagaatggcgcctggagacggt 765

            
Query: 402 g 402
           |
Sbjct: 764 g 764
to top
>gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete cds
          Length = 1210

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                        
Query: 282  actggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
            ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 1026 actggacgatggagctgtaracggtgttgggctgccagtcggcggggatgacctgatcgg 967

                                                                
Query: 342  ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
            | |  || |||||||||||||||||||||||||| | |||||||||| ||||
Sbjct: 966  cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctg 915
to top
>gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, complete cds
          Length = 1142

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                       
Query: 318 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgca 377
           |||||||||||||||| || | ||||||||||  | ||||||||||||||||||||||||
Sbjct: 873 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgca 814

                     
Query: 378 tggagaaggg 387
           ||||||||||
Sbjct: 813 tggagaaggg 804
to top
>gb|AY104151.1| Zea mays PCO112411 mRNA sequence
          Length = 1171

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                       
Query: 318 agttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgca 377
           |||||||||||||||| || | ||||||||||  | ||||||||||||||||||||||||
Sbjct: 882 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgca 823

                     
Query: 378 tggagaaggg 387
           ||||||||||
Sbjct: 822 tggagaaggg 813
to top
>dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-H01, full
           insert sequence
          Length = 1794

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           ||||| |||||||||||| |||| ||| || |||||||||||||||||||||  ||||||
Sbjct: 938 ccagtaggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 879

                                
Query: 376 catggagaagggcgcctggag 396
            ||||||||||| ||||||||
Sbjct: 878 gatggagaagggggcctggag 858
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                          
Query: 282    actggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
              ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                                                  
Query: 342    ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
              | |  || |||||||||||||||||||||||||| | |||||||||| ||||
Sbjct: 169362 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctg 169311



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 100/123 (81%)
 Strand = Plus / Plus

                                                                          
Query: 280    gtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtc 339
              ||||||||||| ||| ||||| |||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                                                          
Query: 340    ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
               ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 157726 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 157785

                 
Query: 400    gtg 402
              |||
Sbjct: 157786 gtg 157788
to top
>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
            OSJNBb0080O10, from chromosome 3, complete sequence
          Length = 127917

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                        
Query: 282  actggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
            ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 6489 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 6430

                                                                
Query: 342  ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
            | |  || |||||||||||||||||||||||||| | |||||||||| ||||
Sbjct: 6429 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctg 6378
to top
>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNAb0079B22, from chromosome 3, complete sequence
          Length = 156933

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                          
Query: 282    actggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
              ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 103422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 103363

                                                                  
Query: 342    ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
              | |  || |||||||||||||||||||||||||| | |||||||||| ||||
Sbjct: 103362 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctg 103311



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 100/123 (81%)
 Strand = Plus / Plus

                                                                         
Query: 280   gtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtc 339
             ||||||||||| ||| ||||| |||||| |||||| |||||||   |||||||| | |  
Sbjct: 91666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 91725

                                                                         
Query: 340   ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
              ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 91726 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 91785

                
Query: 400   gtg 402
             |||
Sbjct: 91786 gtg 91788
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                          
Query: 282    actggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
              ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 169422 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 169363

                                                                  
Query: 342    ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
              | |  || |||||||||||||||||||||||||| | |||||||||| ||||
Sbjct: 169362 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctg 169311



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 100/123 (81%)
 Strand = Plus / Plus

                                                                          
Query: 280    gtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtc 339
              ||||||||||| ||| ||||| |||||| |||||| |||||||   |||||||| | |  
Sbjct: 157666 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 157725

                                                                          
Query: 340    ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
               ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 157726 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 157785

                 
Query: 400    gtg 402
              |||
Sbjct: 157786 gtg 157788
to top
>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence
          Length = 162241

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Plus

                                                                         
Query: 282   actggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
             ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 93244 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 93303

                                                                 
Query: 342   ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
             | |  || |||||||||||||||||||||||||| | |||||||||| ||||
Sbjct: 93304 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctg 93355



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                          
Query: 280    gtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtc 339
              ||||||||||| ||| ||||| |||||| |||||| |||||||   |||||||| | |  
Sbjct: 105000 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 104941

                                                                          
Query: 340    ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
               ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 104940 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 104881

                 
Query: 400    gtg 402
              |||
Sbjct: 104880 gtg 104878
to top
>dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-G02, full
           insert sequence
          Length = 1027

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                       
Query: 282 actggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
           ||||||||||||||| ||| | |||| |||||  ||||| ||| ||||||||||  ||||
Sbjct: 834 actggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatcgg 775

                                                               
Query: 342 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctg 393
           | |  || |||||||||||||||||||||||||| | |||||||||| ||||
Sbjct: 774 cgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctg 723
to top
>gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, partial cds
          Length = 788

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 actggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtcgg 341
           ||||||||||||||| ||| | | ||  ||||  |||||  ||||| ||||||| ||| |
Sbjct: 644 actggacgatggagctgtagacgttgtcgggctgccagtctgccggaatgacctggtccg 585

                                                          
Query: 342 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggc 388
           |||||||||||||||||||||||||||||| |||||  |||||||||
Sbjct: 584 ccaccagcgtcttgccggactcgttggtgacgcgcagcgagaagggc 538
to top
>ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB3
           (OSJNBb0014I11.1), mRNA
          Length = 904

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||| | ||   |||| |||||||||||||||||||||| 
Sbjct: 898 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 839

                                                                       
Query: 337 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 838 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 779

                 
Query: 397 gcggtg 402
           ||||||
Sbjct: 778 gcggtg 773
to top
>gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete cds
          Length = 1319

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||| | ||   |||| |||||||||||||||||||||| 
Sbjct: 897 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 838

                                                                       
Query: 337 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 837 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 778

                 
Query: 397 gcggtg 402
           ||||||
Sbjct: 777 gcggtg 772
to top
>dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-F11, full
           insert sequence
          Length = 1031

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||| | ||   |||| |||||||||||||||||||||| 
Sbjct: 653 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 594

                                                                       
Query: 337 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 593 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 534

                 
Query: 397 gcggtg 402
           ||||||
Sbjct: 533 gcggtg 528
to top
>dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023140O05, full
           insert sequence
          Length = 1313

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 gctgtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgacctt 336
           ||||||||||||||  || ||||| | ||   |||| |||||||||||||||||||||| 
Sbjct: 909 gctgtactggacgaaagaacggtagacggccatgggggcccagttggccgggatgacctg 850

                                                                       
Query: 337 gtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggag 396
           |  ||| || |||  |||||||||||||||||||||||| |  ||||||||||||  |||
Sbjct: 849 gctggcgacgagctgcttgccggactcgttggtgatgcggagcgagaagggcgccgtgag 790

                 
Query: 397 gcggtg 402
           ||||||
Sbjct: 789 gcggtg 784
to top
>gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds
          Length = 1078

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 382
           ||||||||||| |||| |||||| |||||||| ||||| ||| ||||||| |||||||||
Sbjct: 794 gccgggatgacattgttggccacaagcgtcttcccggagtcgctggtgatacgcatggag 735

                      
Query: 383 aagggcgcctg 393
           |||||| ||||
Sbjct: 734 aagggcccctg 724
to top
>gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds
          Length = 933

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 101/123 (82%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           ||||||||||| ||| |||||||||||| |||||| |||||||   |||||||| | |  
Sbjct: 807 gtactggacgaaggaacggtaaaaggtgttgggcgtccagttgagggggatgacgtcggg 748

                                                                       
Query: 340 ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
            ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 747 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 688

              
Query: 400 gtg 402
           |||
Sbjct: 687 gtg 685
to top
>emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 protein precursor
           (expb11 gene), cultivar Wyuna, from endosperm tissue
          Length = 1032

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 326 gggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggagaag 385
           ||||||||||  ||||| || || ||||||||||||||||||||||||||||  ||||| 
Sbjct: 773 gggatgacctgttcggcgacaagtgtcttgccggactcgttggtgatgcgcaacgagaat 714

                  
Query: 386 ggcgcct 392
           |||||||
Sbjct: 713 ggcgcct 707
to top
>gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence
          Length = 477

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 genomic sequence
          Length = 467

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |||  |||||||||||||||||||||
Sbjct: 274 ccagttggccgggatgacgttgctggccaccagcgtcttgccgga 230
to top
>gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, partial cds
          Length = 671

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 315 cccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgc 374
           |||||| ||| ||||||||||  |||||  | ||||||||||||||||||||||| ||||
Sbjct: 327 cccagtcggcggggatgacctgttcggcggcgagcgtcttgccggactcgttggtkatgc 268

                        
Query: 375 gcatggagaaggg 387
            ||  ||||||||
Sbjct: 267 scagcgagaaggg 255
to top
>gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, complete cds
          Length = 1034

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 322 ggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatgga 381
           |||||||||||||| |||||| || |||| | |||||||||||| ||||| |||||  ||
Sbjct: 904 ggccgggatgacctggtcggcgacgagcgacctgccggactcgtcggtgacgcgcagcga 845

                       
Query: 382 gaagggcgcctg 393
           ||||||| ||||
Sbjct: 844 gaagggcccctg 833
to top
>dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069H18, full
           insert sequence
          Length = 1019

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 gtactggacgatggagcggtaaaaggtgctgggcgcccagttggccgggatgaccttgtc 339
           ||||||||||| ||| ||||| |||||| |||||| |||||||   |||||||| | |  
Sbjct: 889 gtactggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcggg 830

                                                                       
Query: 340 ggccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcg 399
            ||||||| |||||||||||| ||| |   |||||| |||||||| |||||| | |||||
Sbjct: 829 tgccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcg 770

              
Query: 400 gtg 402
           |||
Sbjct: 769 gtg 767
to top
>gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, complete cds
          Length = 898

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccgga 360
           |||||||||||||||||| |  | |||||||||||||||||||||
Sbjct: 810 ccagttggccgggatgacttgtttggccaccagcgtcttgccgga 766
to top
>gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, complete cds
          Length = 939

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 382
           ||||||||| | |||| ||||||||||||||| ||||  ||| |||||||||| |||| |
Sbjct: 811 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcg 752

                      
Query: 383 aagggcgcctg 393
           || ||| ||||
Sbjct: 751 aatggcccctg 741
to top
>gb|U91981.1|TAU91981 Triticum aestivum pollen allergen homolog mRNA, complete cds
          Length = 1232

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 382
           ||||||||| | |||| ||| ||||||||||| ||||  ||| |||||||||| ||||||
Sbjct: 816 gccgggatggcattgttggcgaccagcgtctttccggtatcgctggtgatgcggatggag 757

                      
Query: 383 aagggcgcctg 393
           || ||| ||||
Sbjct: 756 aatggcccctg 746
to top
>gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds
          Length = 1132

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 323 gccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcgcatggag 382
           ||||||||| | |||| ||||||||||||||| ||||  ||| |||||||||| |||| |
Sbjct: 786 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcg 727

                      
Query: 383 aagggcgcctg 393
           || ||| ||||
Sbjct: 726 aatggcccctg 716
to top
>gb|AF220610.1| Oryza sativa pollen allergen mRNA, complete cds
          Length = 1106

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 769 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 728
to top
>ref|NM_197637.1| Oryza sativa (japonica cultivar-group) beta-expansin
           (OSJNBa0082M15.4), mRNA
          Length = 1148

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 784 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 743
to top
>gb|AF261277.1| Oryza sativa beta-expansin (EXPB9) mRNA, complete cds
          Length = 1117

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 784 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 743
to top
>gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, complete cds
          Length = 1216

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 982 tcttgccggactcgctggtgacgcggatggagaagggggcct 941
to top
>gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, complete cds
          Length = 1068

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 747 tcttgccggactcgctggtgacgcggatggagaagggggcct 706
to top
>gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 genomic sequence, complete
              sequence
          Length = 158550

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                        
Query: 351    tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
              |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 117099 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 117140
to top
>dbj|AK099112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023033P05, full
           insert sequence
          Length = 1071

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 800 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 759
to top
>dbj|AK070187.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043G12, full
           insert sequence
          Length = 1121

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 351 tcttgccggactcgttggtgatgcgcatggagaagggcgcct 392
           |||||||||||||| |||||| ||| ||||||||||| ||||
Sbjct: 800 tcttgccggactcggtggtgacgcgaatggagaagggtgcct 759
to top
>gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, complete cds
          Length = 1149

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 351  tcttgccggactcgttggtgatgcgcatggagaaggg 387
            |||||||||||||| |||||| ||| |||||||||||
Sbjct: 1061 tcttgccggactcgctggtgacgcggatggagaaggg 1025
to top
>gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, complete cds
          Length = 1111

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 777 tcttgccggactcgctggtgacgcggatggagaaggg 741
to top
>gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, partial cds
          Length = 496

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 237 tcttgccggactcgctggtgacgcggatggagaaggg 201
to top
>gb|AY197353.1| Zea mays clone pJR9 beta-expansin 1 protein (EXPB1) mRNA, complete
           cds
          Length = 1066

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 764 tcttgccggactcgctggtgaggcggatggagaaggg 728
to top
>gb|AF332174.1|AF332174 Zea mays beta-expansin 1 (expB1) mRNA, complete cds
          Length = 1080

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 764 tcttgccggactcgctggtgaggcggatggagaaggg 728
to top
>gb|AY103636.1| Zea mays PCO124530 mRNA sequence
          Length = 1085

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| |||||||||||
Sbjct: 776 tcttgccggactcgctggtgaggcggatggagaaggg 740
to top
>ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB2
           (OSJNBb0014I11.2), mRNA
          Length = 1262

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 813 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 754

                                      
Query: 376 catggagaagggcgcctggaggcggtg 402
            | |||||||||  |||||||||||||
Sbjct: 753 gagggagaaggggccctggaggcggtg 727
to top
>dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-F04, full
           insert sequence
          Length = 1043

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 812 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 753

                                      
Query: 376 catggagaagggcgcctggaggcggtg 402
            | |||||||||  |||||||||||||
Sbjct: 752 gagggagaaggggccctggaggcggtg 726
to top
>dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C01, full
           insert sequence
          Length = 1259

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 810 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 751

                                      
Query: 376 catggagaagggcgcctggaggcggtg 402
            | |||||||||  |||||||||||||
Sbjct: 750 gagggagaaggggccctggaggcggtg 724
to top
>dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F11, full
           insert sequence
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 803 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 744

                                      
Query: 376 catggagaagggcgcctggaggcggtg 402
            | |||||||||  |||||||||||||
Sbjct: 743 gagggagaaggggccctggaggcggtg 717
to top
>dbj|AB041625.1| Brassica rapa BcSL10 gene for SLG-like 10, partial cds
          Length = 3511

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 240 catatgattccaaatgatgatg 261
           ||||||||||||||||||||||
Sbjct: 108 catatgattccaaatgatgatg 129
to top
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 339     cggccaccagcgtcttgccgg 359
               |||||||||||||||||||||
Sbjct: 1260020 cggccaccagcgtcttgccgg 1260040
to top
>gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete sequence
          Length = 398525

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 253    atgatgatgagttcagcagcttcag 277
              ||||||||||||| |||||||||||
Sbjct: 345505 atgatgatgagttaagcagcttcag 345481
to top
>gb|AY197352.1| Zea mays clone pJR11 beta-expansin 9 protein (EXPB9) mRNA, complete
           cds
          Length = 1088

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| || ||||||||
Sbjct: 738 tcttgccggactcgctggtgaggcggatagagaaggg 702
to top
>emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome; segment 4/13
          Length = 349306

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 339    cggccaccagcgtcttgccgg 359
              |||||||||||||||||||||
Sbjct: 226686 cggccaccagcgtcttgccgg 226706
to top
>emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 4/14
          Length = 327650

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 339    cggccaccagcgtcttgccgg 359
              |||||||||||||||||||||
Sbjct: 274844 cggccaccagcgtcttgccgg 274864
to top
>gb|AC016766.6| Homo sapiens BAC clone RP11-558I6 from 2, complete sequence
          Length = 194374

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 244    tgattccaaatgatgatgagt 264
              |||||||||||||||||||||
Sbjct: 177950 tgattccaaatgatgatgagt 177930
to top
>gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, complete cds
          Length = 999

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 70/87 (80%)
 Strand = Plus / Minus

                                                                       
Query: 316 ccagttggccgggatgaccttgtcggccaccagcgtcttgccggactcgttggtgatgcg 375
           |||||||||||||||||||| || ||| |  |  |||| |||||||||| ||   |||||
Sbjct: 813 ccagttggccgggatgacctggtgggcgatgacggtctggccggactcgctgaccatgcg 754

                                      
Query: 376 catggagaagggcgcctggaggcggtg 402
            | ||| |||||  |||||||||||||
Sbjct: 753 gagggakaaggggccctggaggcggtg 727
to top
>gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds
          Length = 960

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           ||||||||| |||| |||||| ||| |||||||||||
Sbjct: 730 tcttgccgggctcgctggtgacgcggatggagaaggg 694
to top
>gb|L14271.1|MZEPOLPI Zea mays Zea mI gene, complete cds
          Length = 827

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 351 tcttgccggactcgttggtgatgcgcatggagaaggg 387
           |||||||||||||| |||||| ||| || ||||||||
Sbjct: 499 tcttgccggactcgctggtgaggcggatagagaaggg 463
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 340     ggccaccagcgtcttgccgg 359
               ||||||||||||||||||||
Sbjct: 2016483 ggccaccagcgtcttgccgg 2016464
to top
>gb|AY172516.1| Rhizobium etli transcription repair coupling factor (mfd) gene,
            partial cds; recombination and repair protein (recG)
            gene, complete cds; and unknown gene
          Length = 6176

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  gccaccagcgtcttgccgga 360
            ||||||||||||||||||||
Sbjct: 4669 gccaccagcgtcttgccgga 4650
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 341     gccaccagcgtcttgccgga 360
               ||||||||||||||||||||
Sbjct: 2190610 gccaccagcgtcttgccgga 2190629
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 302     aaggtgctgggcgcccagttggcc 325
               |||||||||| |||||||||||||
Sbjct: 2061004 aaggtgctggtcgcccagttggcc 2060981
to top
>gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, complete sequence
          Length = 177317

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      gcacacacaaacagtaataa 22
              ||||||||||||||||||||
Sbjct: 120092 gcacacacaaacagtaataa 120073
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 337     gtcggccaccagcgtcttgc 356
               ||||||||||||||||||||
Sbjct: 4141074 gtcggccaccagcgtcttgc 4141055
to top
>emb|BX649380.7| Zebrafish DNA sequence from clone CH211-87P6 in linkage group 4, complete
              sequence
          Length = 172167

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 240    catatgattccaaatgatgatgagttca 267
              |||||||||| ||||| |||||||||||
Sbjct: 166340 catatgattctaaatggtgatgagttca 166367
to top
>gb|AY112069.1| Zea mays CL35761_1 mRNA sequence
          Length = 631

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 347 agcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggtg 402
           |||||||||||||| ||| ||  | |||| ||||||||||| | ||| ||||||||
Sbjct: 167 agcgtcttgccggagtcggtgcgggtgcggatggagaagggtggctgcaggcggtg 222
to top
>gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, complete sequence
          Length = 182865

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    gcacacacaaacagtaataa 22
            ||||||||||||||||||||
Sbjct: 7061 gcacacacaaacagtaataa 7080
to top
>gb|AF107020.1|AF107020 Actinomyces naeslundii strain LY7 type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AF107019.1|AF107019 Actinomyces naeslundii strain P-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AF106035.1|AF106035 Actinomyces naeslundii strain B-1-K type-1 fimbrial major subunit
           precursor (fimP) gene, complete cds
          Length = 1622

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 485 ggccgggatgaccttgtcgg 466
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 307    gctgggcgcccagttggccgggat 330
              ||||||||||||||| ||||||||
Sbjct: 594398 gctgggcgcccagtttgccgggat 594375
to top
>gb|M32067.1|ACYFIMBA A.viscosus fimbrial structural protein type 1 subunit gene,
           complete cds
          Length = 1850

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 322 ggccgggatgaccttgtcgg 341
           ||||||||||||||||||||
Sbjct: 588 ggccgggatgaccttgtcgg 569


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,325,864
Number of Sequences: 3902068
Number of extensions: 3325864
Number of successful extensions: 61867
Number of sequences better than 10.0: 117
Number of HSP's better than 10.0 without gapping: 117
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61320
Number of HSP's gapped (non-prelim): 505
length of query: 402
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 380
effective length of database: 17,147,199,772
effective search space: 6515935913360
effective search space used: 6515935913360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top