ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart22c10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF098329.1|AF098329 Drosophila virilis eyeless protein gene; ... 44 0.081
2emb|AL450333.13| Human DNA sequence from clone RP11-25O6 on chro... 42 0.32
3gb|AC064802.4| Homo sapiens chromosome 8, clone RP11-267L5, comp... 42 0.32
4gb|AC138527.22| Medicago truncatula clone mth2-10a20, complete s... 42 0.32
5gb|AC003105.3| Arabidopsis thaliana chromosome 2 clone F18A8 map... 42 0.32
6emb|CR550305.7| Zebrafish DNA sequence from clone DKEY-205E15 in... 42 0.32
7dbj|AP005623.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 0.32
8gb|AC116413.12| Mus musculus chromosome 8, clone RP24-84J11, com... 40 1.3
9emb|Z68317.1|CET01H3 Caenorhabditis elegans Cosmid T01H3, comple... 40 1.3
10gb|AC124350.4| Mus musculus BAC clone RP24-466K21 from chromosom... 40 1.3
11gb|AC146330.33| Medicago truncatula clone mth2-7g7, complete seq... 40 1.3
12gb|AF003138.2| Caenorhabditis elegans cosmid F12B6, complete seq... 40 1.3
13emb|AL121871.8|HSB258O15 Human DNA sequence from clone RP13-258O... 40 1.3
14emb|CR628339.1| Legionella pneumophila str. Lens plasmid pLPL, c... 40 1.3
15gb|L36901.1|YSCMTCG17 Saccharomyces cerevisiae mitochondrion DNA... 40 1.3
16gb|AC092868.2| Homo sapiens chromosome 15 clone RP11-356M20 map ... 40 1.3
17gb|AC091748.3| Homo sapiens chromosome 15 clone RP11-99L18 map 1... 40 1.3
18gb|AC155912.7| Mus musculus 10 BAC RP24-536C12 (Roswell Park Can... 40 1.3
19gb|AC117427.3| Homo sapiens 3 BAC RP11-66I5 (Roswell Park Cancer... 40 1.3
20gb|AC010874.3|AC010874 Homo sapiens BAC clone RP11-118K2 from Y,... 40 1.3
21gb|AF538053.1|MBREV Monosiga brevicollis mitochondrion, complete... 40 1.3
22gb|AC007533.2|AC007533 Homo sapiens chromosome 16 clone RPCI-11_... 40 1.3
23gb|AF177262.1|AF177262 Bodo saltans clone BM572 mitochondrial mi... 40 1.3
24emb|BX571946.9| Zebrafish DNA sequence from clone DKEY-232H18 in... 40 1.3
25emb|BX649427.7| Zebrafish DNA sequence from clone DKEYP-85D7 in ... 40 1.3
26gb|AY258061.1| Monochamus saltuarius MSLJ1 12S ribosomal RNA gen... 40 1.3
27gb|AY258060.1| Monochamus saltuarius MSL1 12S ribosomal RNA gene... 40 1.3
28emb|AL110500.1|CEY87G2A Caenorhabditis elegans YAC Y87G2A, compl... 40 1.3
29dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full ... 40 1.3
30gb|U58743.1| Caenorhabditis elegans cosmid F39F10, complete sequ... 40 1.3
31gb|AC066595.5| Homo sapiens chromosome 3 clone RP11-385A18 map 3... 40 1.3
32ref|XM_632176.1| Dictyostelium discoideum hypothetical protein (... 38 5.0
33ref|XM_630968.1| Dictyostelium discoideum hypothetical protein (... 38 5.0
34gb|U41021.1| Caenorhabditis elegans cosmid F14D12, complete sequ... 38 5.0
35gb|AC114679.10| Mus musculus chromosome 3, clone RP24-235E22, co... 38 5.0
36gb|AC148244.3| Mus musculus chromosome 9, clone wi1-65440F10, co... 38 5.0
37gb|AE006248.1| Lactococcus lactis subsp. lactis IL1403 section 1... 38 5.0
38gb|AC148997.1| Mus musculus BAC clone RP23-338B6 from chromosome... 38 5.0
39gb|AY818718.1| Reticulomyxa filosa clone B1 beta tubulin gene, p... 38 5.0
40gb|AY818717.1| Reticulomyxa filosa clone B4 beta tubulin gene, p... 38 5.0
41gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, com... 38 5.0
42emb|CR478208.13| Zebrafish DNA sequence from clone CH211-149M3 i... 38 5.0
43gb|AC147148.2| Pan troglodytes BAC clone CH251-267E22 from Y, co... 38 5.0
44gb|AC132594.3| Mus musculus BAC clone RP24-222P6 from chromosome... 38 5.0
45gb|AC127351.3| Mus musculus BAC clone RP23-66K20 from chromosome... 38 5.0
46gb|AC122365.4| Mus musculus BAC clone RP23-447A7 from chromosome... 38 5.0
47gb|AC126680.4| Mus musculus BAC clone RP24-347B21 from chromosom... 38 5.0
48emb|Z27081.1|CEM01A8 Caenorhabditis elegans Cosmid M01A8, comple... 38 5.0
49emb|Z81468.1|CEC13B4 Caenorhabditis elegans Cosmid C13B4, comple... 38 5.0
50emb|CR759753.9| Zebrafish DNA sequence from clone DKEY-11G15 in ... 38 5.0
51ref|XM_645468.1| Entamoeba histolytica HM-1:IMSS zinc finger pro... 38 5.0
52ref|XM_721806.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 38 5.0
53ref|XM_725813.1| Plasmodium yoelii yoelii str. 17XNL protoporphy... 38 5.0
54ref|XM_667156.1| Plasmodium berghei strain ANKA hypothetical pro... 38 5.0
55ref|XM_675325.1| Plasmodium berghei strain ANKA hypothetical pro... 38 5.0
56gb|U70857.2| Caenorhabditis elegans cosmid C10G8, complete sequence 38 5.0
57gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete se... 38 5.0
58gb|AC138016.14| Medicago truncatula clone mth2-34f15, complete s... 38 5.0
59gb|AC140849.8| Medicago truncatula clone mth2-17f20, complete se... 38 5.0
60gb|AF375499.1| Osornophryne sp. QCAZ11471 12S ribosomal RNA gene... 38 5.0
61emb|AL160399.13| Human DNA sequence from clone RP11-161N21 on ch... 38 5.0
62emb|AL157883.15| Human DNA sequence from clone RP11-360J12 on ch... 38 5.0
63gb|AC113054.14| Mus musculus chromosome 15, clone RP23-251L21, c... 38 5.0
64emb|CR936324.2| Medicago truncatula chromosome 5 clone mth2-62a2... 38 5.0
65emb|BX649366.5| Zebrafish DNA sequence from clone DKEY-16I5 in l... 38 5.0
66dbj|BS000668.1| Pan troglodytes chromosome Y clone:PTFY-015J14, ... 38 5.0
67gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 5.0
68gb|AC166091.3| Glycine max clone gmw1-11j16, complete sequence 38 5.0
69gb|AC166092.4| Glycine max clone gmw1-93l19, complete sequence 38 5.0
70gb|AC006929.4| Arabidopsis thaliana chromosome 2 clone T1E2 map ... 38 5.0
71gb|AC005851.3| Arabidopsis thaliana chromosome 2 clone F24D13 ma... 38 5.0
72gb|AC005171.3| Arabidopsis thaliana chromosome 2 clone T4E14 map... 38 5.0
73gb|AC105031.5| Homo sapiens chromosome 8, clone CTD-2272D18, com... 38 5.0
74gb|U55364.1| Caenorhabditis elegans cosmid F21C10, complete sequ... 38 5.0
75gb|AC090095.7| Homo sapiens, clone RP11-296C13, complete sequence 38 5.0
76gb|AC098575.6| Drosophila melanogaster X BAC RP98-3D13 (Roswell ... 38 5.0
77gb|AC020556.7| Homo sapiens BAC clone RP11-507B10 from 4, comple... 38 5.0
78gb|AC079140.6| Homo sapiens BAC clone RP11-478C6 from 4, complet... 38 5.0
79gb|DQ277619.1| Drosophila melanogaster isolate sim locus 233 gen... 38 5.0
80gb|DQ277618.1| Drosophila melanogaster isolate mz42 locus 233 ge... 38 5.0
81gb|DQ277617.1| Drosophila melanogaster isolate mz41 locus 233 ge... 38 5.0
82gb|DQ277616.1| Drosophila melanogaster isolate mz36 locus 233 ge... 38 5.0
83gb|DQ277615.1| Drosophila melanogaster isolate mz35 locus 233 ge... 38 5.0
84gb|DQ277614.1| Drosophila melanogaster isolate mz22 locus 233 ge... 38 5.0
85gb|DQ277613.1| Drosophila melanogaster isolate mz21 locus 233 ge... 38 5.0
86gb|DQ277612.1| Drosophila melanogaster isolate mz20 locus 233 ge... 38 5.0
87gb|DQ277611.1| Drosophila melanogaster isolate mz18 locus 233 ge... 38 5.0
88gb|DQ277610.1| Drosophila melanogaster isolate mz15 locus 233 ge... 38 5.0
89gb|DQ277609.1| Drosophila melanogaster isolate mz13 locus 233 ge... 38 5.0
90gb|DQ277608.1| Drosophila melanogaster isolate mz10 locus 233 ge... 38 5.0
91gb|DQ277607.1| Drosophila melanogaster isolate mz07 locus 233 ge... 38 5.0
92gb|DQ277606.1| Drosophila melanogaster isolate mb77 locus 233 ge... 38 5.0
93gb|DQ277605.1| Drosophila melanogaster isolate mb56 locus 233 ge... 38 5.0
94gb|DQ277604.1| Drosophila melanogaster isolate mb52 locus 233 ge... 38 5.0
95gb|DQ277603.1| Drosophila melanogaster isolate mb44 locus 233 ge... 38 5.0
96gb|DQ277602.1| Drosophila melanogaster isolate mb39 locus 233 ge... 38 5.0
97gb|DQ277601.1| Drosophila melanogaster isolate mb36 locus 233 ge... 38 5.0
98gb|DQ277600.1| Drosophila melanogaster isolate mb30 locus 233 ge... 38 5.0
99gb|DQ277599.1| Drosophila melanogaster isolate mb22 locus 233 ge... 38 5.0
100gb|DQ277598.1| Drosophila melanogaster isolate mb18 locus 233 ge... 38 5.0
101gb|DQ277597.1| Drosophila melanogaster isolate mb15 locus 233 ge... 38 5.0
102gb|DQ277596.1| Drosophila melanogaster isolate mb12 locus 233 ge... 38 5.0
103gb|DQ277595.1| Drosophila melanogaster isolate mb05 locus 233 ge... 38 5.0
104gb|DQ277594.1| Drosophila melanogaster isolate me68 locus 233 ge... 38 5.0
105gb|DQ277593.1| Drosophila melanogaster isolate me66 locus 233 ge... 38 5.0
106gb|DQ277592.1| Drosophila melanogaster isolate me54 locus 233 ge... 38 5.0
107gb|DQ277591.1| Drosophila melanogaster isolate me46 locus 233 ge... 38 5.0
108gb|DQ277590.1| Drosophila melanogaster isolate me38 locus 233 ge... 38 5.0
109gb|DQ277589.1| Drosophila melanogaster isolate me31 locus 233 ge... 38 5.0
110gb|DQ277588.1| Drosophila melanogaster isolate me27 locus 233 ge... 38 5.0
111gb|DQ277587.1| Drosophila melanogaster isolate me26 locus 233 ge... 38 5.0
112gb|DQ277586.1| Drosophila melanogaster isolate me20 locus 233 ge... 38 5.0
113gb|DQ277585.1| Drosophila melanogaster isolate me17 locus 233 ge... 38 5.0
114gb|DQ277584.1| Drosophila melanogaster isolate me13 locus 233 ge... 38 5.0
115gb|DQ277583.1| Drosophila melanogaster isolate me08 locus 233 ge... 38 5.0
116emb|BX323878.10| Zebrafish DNA sequence from clone CH211-57E23 i... 38 5.0
117gb|AF267204.1| Candidatus Carsonella ruddii natural-host Cacopsy... 38 5.0
118gb|AC018443.9|AC018443 Homo sapiens chromosome 8, clone RP11-674... 38 5.0
119ref|NM_001027512.2| Caenorhabditis elegans M01A8.2b (M01A8.2) mR... 38 5.0
120gb|AC006762.2| Caenorhabditis elegans cosmid Y42G9A, complete se... 38 5.0
121dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 38 5.0
122gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, com... 38 5.0
123dbj|AB164640.1| Marsupenaeus japonicus CRP-2 mRNA for cortical r... 38 5.0
124dbj|AB164639.1| Marsupenaeus japonicus CRP mRNA for cortical rod... 38 5.0
125gb|AC018799.8| Homo sapiens BAC clone RP11-125N8 from 2, complet... 38 5.0
126gb|AC011810.8|AC011810 Arabidopsis thaliana chromosome I BAC T6J... 38 5.0
127gb|AC027134.4|AC027134 Arabidopsis thaliana chromosome I BAC F13... 38 5.0
128gb|AC147927.3| Ovis aries clone CH243-129I22, complete sequence 38 5.0
129dbj|AP005245.3| Oryza sativa (japonica cultivar-group) genomic D... 38 5.0
130gb|AF130815.1|AF130815 Buchnera aphidicola natural-host Melaphis... 38 5.0
131gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome 38 5.0
132gb|AY258062.1| Monochamus urussovi MURP2 12S ribosomal RNA gene,... 38 5.0
133gb|AY258059.1| Monochamus sutor MSU1 12S ribosomal RNA gene, par... 38 5.0
134gb|AY258058.1| Monochamus sartor MSA2 12S ribosomal RNA gene, pa... 38 5.0
135gb|AY258057.1| Monochamus sartor MSA1 12S ribosomal RNA gene, pa... 38 5.0
136gb|AY258056.1| Monochamus sartor MSAE 12S ribosomal RNA gene, pa... 38 5.0
137gb|AY258055.1| Monochamus galloprovincialis pistor MGPV2 12S rib... 38 5.0
138gb|AY258054.1| Monochamus galloprovincialis pistor MGP 12S ribos... 38 5.0
139gb|AY258053.1| Monochamus galloprovincialis galloprovincialis MG... 38 5.0
140gb|AE003426.3| Drosophila melanogaster chromosome X, section 10 ... 38 5.0
141emb|BX072581.5| Zebrafish DNA sequence from clone DKEY-14K7 in l... 38 5.0
142gb|AC121845.3| Mus musculus BAC clone RP24-82B23 from 5, complet... 38 5.0
143emb|BX897740.7| Zebrafish DNA sequence from clone CH211-257M21 i... 38 5.0
144dbj|AB232773.1| Ipomoea nil InMYB1 gene for R2R3-MYB transcripti... 38 5.0
145dbj|AB232772.1| Ipomoea nil InMYB1 gene for R2R3-MYB transcripti... 38 5.0
146dbj|AB232771.1| Ipomoea nil InMYB1 gene for R2R3-MYB transcripti... 38 5.0

>gb|AF098329.1|AF098329 Drosophila virilis eyeless protein gene; exons 2 and 3, partial
            sequence; intron 2, complete sequence; and partial cds
          Length = 5597

 Score = 44.1 bits (22), Expect = 0.081
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 11   ccttttattccaacaccaaata 32
            ||||||||||||||||||||||
Sbjct: 1255 ccttttattccaacaccaaata 1276



to top

>emb|AL450333.13| Human DNA sequence from clone RP11-25O6 on chromosome 6, complete
             sequence
          Length = 156964

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 81    attaaaatttattaaaaattgagct 105
             |||||| ||||||||||||||||||
Sbjct: 90329 attaaattttattaaaaattgagct 90305



to top

>gb|AC064802.4| Homo sapiens chromosome 8, clone RP11-267L5, complete sequence
          Length = 181079

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 81     attaaaatttattaaaaattg 101
              |||||||||||||||||||||
Sbjct: 151552 attaaaatttattaaaaattg 151532



to top

>gb|AC138527.22| Medicago truncatula clone mth2-10a20, complete sequence
          Length = 115023

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 80     gattaaaatttattaaaaatt 100
              |||||||||||||||||||||
Sbjct: 105907 gattaaaatttattaaaaatt 105927



to top

>gb|AC003105.3| Arabidopsis thaliana chromosome 2 clone F18A8 map B68, complete
             sequence
          Length = 95167

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 79    cgattaaaatttattaaaaat 99
             |||||||||||||||||||||
Sbjct: 65648 cgattaaaatttattaaaaat 65668



to top

>emb|CR550305.7| Zebrafish DNA sequence from clone DKEY-205E15 in linkage group 11,
              complete sequence
          Length = 159061

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 80     gattaaaatttattaaaaatt 100
              |||||||||||||||||||||
Sbjct: 105867 gattaaaatttattaaaaatt 105887



to top

>dbj|AP005623.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1311A1, complete
              sequence
          Length = 187346

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 81     attaaaatttattaaaaattg 101
              |||||||||||||||||||||
Sbjct: 144482 attaaaatttattaaaaattg 144502



to top

>gb|AC116413.12| Mus musculus chromosome 8, clone RP24-84J11, complete sequence
          Length = 210471

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 83    taaaatttattaaaaattga 102
             ||||||||||||||||||||
Sbjct: 77079 taaaatttattaaaaattga 77098



to top

>emb|Z68317.1|CET01H3 Caenorhabditis elegans Cosmid T01H3, complete sequence
          Length = 21870

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 79   cgattaaaatttattaaaaa 98
            ||||||||||||||||||||
Sbjct: 2099 cgattaaaatttattaaaaa 2080



to top

>gb|AC124350.4| Mus musculus BAC clone RP24-466K21 from chromosome 8, complete sequence
          Length = 160905

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 83     taaaatttattaaaaattga 102
              ||||||||||||||||||||
Sbjct: 160670 taaaatttattaaaaattga 160689



to top

>gb|AC146330.33| Medicago truncatula clone mth2-7g7, complete sequence
          Length = 117139

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    acaccaaatacaaaatgaaa 42
             ||||||||||||||||||||
Sbjct: 88162 acaccaaatacaaaatgaaa 88181



to top

>gb|AF003138.2| Caenorhabditis elegans cosmid F12B6, complete sequence
          Length = 29268

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    cgattaaaatttattaaaaattga 102
             |||||||||||| |||||||||||
Sbjct: 12108 cgattaaaattttttaaaaattga 12131



to top

>emb|AL121871.8|HSB258O15 Human DNA sequence from clone RP13-258O15 on chromosome X Contains a
              ribosomal protein L26 pseudogene, complete sequence
          Length = 183876

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 82     ttaaaatttattaaaaattg 101
              ||||||||||||||||||||
Sbjct: 102097 ttaaaatttattaaaaattg 102078



to top

>emb|CR628339.1| Legionella pneumophila str. Lens plasmid pLPL, complete sequence
          Length = 59832

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    aatttattaaaaattgagct 105
             ||||||||||||||||||||
Sbjct: 42133 aatttattaaaaattgagct 42114



to top

>gb|L36901.1|YSCMTCG17 Saccharomyces cerevisiae mitochondrion DNA segment
          Length = 1748

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 81  attaaaatttattaaaaatt 100
           ||||||||||||||||||||
Sbjct: 546 attaaaatttattaaaaatt 565



to top

>gb|AC092868.2| Homo sapiens chromosome 15 clone RP11-356M20 map 15q21.3, complete
             sequence
          Length = 157533

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    tttattaaaaattgagctgg 107
             ||||||||||||||||||||
Sbjct: 49676 tttattaaaaattgagctgg 49657



to top

>gb|AC091748.3| Homo sapiens chromosome 15 clone RP11-99L18 map 15q21.3, complete
             sequence
          Length = 150294

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    tttattaaaaattgagctgg 107
             ||||||||||||||||||||
Sbjct: 21355 tttattaaaaattgagctgg 21336



to top

>gb|AC155912.7| Mus musculus 10 BAC RP24-536C12 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 141692

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     ccctgcttccttttattcca 22
             ||||||||||||||||||||
Sbjct: 33360 ccctgcttccttttattcca 33379



to top

>gb|AC117427.3| Homo sapiens 3 BAC RP11-66I5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 86087

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 81    attaaaatttattaaaaatt 100
             ||||||||||||||||||||
Sbjct: 78637 attaaaatttattaaaaatt 78618



to top

>gb|AC010874.3|AC010874 Homo sapiens BAC clone RP11-118K2 from Y, complete sequence
          Length = 114045

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    ttaaaatttattaaaaattg 101
             ||||||||||||||||||||
Sbjct: 73119 ttaaaatttattaaaaattg 73100



to top

>gb|AF538053.1|MBREV Monosiga brevicollis mitochondrion, complete genome
          Length = 76568

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 81    attaaaatttattaaaaatt 100
             ||||||||||||||||||||
Sbjct: 32317 attaaaatttattaaaaatt 32298



 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 66860 attaaaatttattaaaaat 66842



to top

>gb|AC007533.2|AC007533 Homo sapiens chromosome 16 clone RPCI-11_474B12, complete sequence
          Length = 153053

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 83    taaaatttattaaaaattga 102
             ||||||||||||||||||||
Sbjct: 80258 taaaatttattaaaaattga 80277



to top

>gb|AF177262.1|AF177262 Bodo saltans clone BM572 mitochondrial minicircle fragment
          Length = 402

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  attaaaatttattaaaaatt 100
           ||||||||||||||||||||
Sbjct: 253 attaaaatttattaaaaatt 234



to top

>emb|BX571946.9| Zebrafish DNA sequence from clone DKEY-232H18 in linkage group 22,
              complete sequence
          Length = 179796

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 89     ttattaaaaattgagctggg 108
              ||||||||||||||||||||
Sbjct: 124292 ttattaaaaattgagctggg 124311



to top

>emb|BX649427.7| Zebrafish DNA sequence from clone DKEYP-85D7 in linkage group 22,
             complete sequence
          Length = 45587

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 89    ttattaaaaattgagctggg 108
             ||||||||||||||||||||
Sbjct: 17600 ttattaaaaattgagctggg 17581



to top

>gb|AY258061.1| Monochamus saltuarius MSLJ1 12S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 344

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  attaaaatttattaaaaatt 100
           ||||||||||||||||||||
Sbjct: 323 attaaaatttattaaaaatt 304



to top

>gb|AY258060.1| Monochamus saltuarius MSL1 12S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 344

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  attaaaatttattaaaaatt 100
           ||||||||||||||||||||
Sbjct: 323 attaaaatttattaaaaatt 304



to top

>emb|AL110500.1|CEY87G2A Caenorhabditis elegans YAC Y87G2A, complete sequence
          Length = 123091

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 81    attaaaatttattaaaaatt 100
             ||||||||||||||||||||
Sbjct: 99163 attaaaatttattaaaaatt 99144



to top

>dbj|AK113726.1| Ciona intestinalis cDNA, clone:cicl006j12, full insert sequence
          Length = 1703

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 29   aatacaaaatgaaacgattg 48
            ||||||||||||||||||||
Sbjct: 1599 aatacaaaatgaaacgattg 1580



to top

>gb|U58743.1| Caenorhabditis elegans cosmid F39F10, complete sequence
          Length = 25370

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 81  attaaaatttattaaaaatt 100
           ||||||||||||||||||||
Sbjct: 671 attaaaatttattaaaaatt 690



to top

>gb|AC066595.5| Homo sapiens chromosome 3 clone RP11-385A18 map 3p, complete sequence
          Length = 172123

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 81     attaaaatttattaaaaatt 100
              ||||||||||||||||||||
Sbjct: 116696 attaaaatttattaaaaatt 116715



to top

>ref|XM_632176.1| Dictyostelium discoideum hypothetical protein (DDB0187449),
          partial mRNA
          Length = 981

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 81 attaaaatttattaaaaat 99
          |||||||||||||||||||
Sbjct: 54 attaaaatttattaaaaat 36



to top

>ref|XM_630968.1| Dictyostelium discoideum hypothetical protein (DDB0188523), partial
           mRNA
          Length = 672

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 80  gattaaaatttattaaaaa 98
           |||||||||||||||||||
Sbjct: 130 gattaaaatttattaaaaa 112



to top

>gb|U41021.1| Caenorhabditis elegans cosmid F14D12, complete sequence
          Length = 40901

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 82    ttaaaatttattaaaaatt 100
             |||||||||||||||||||
Sbjct: 30594 ttaaaatttattaaaaatt 30612



to top

>gb|AC114679.10| Mus musculus chromosome 3, clone RP24-235E22, complete sequence
          Length = 157152

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 73     tacgggcgattaaaattta 91
              |||||||||||||||||||
Sbjct: 144722 tacgggcgattaaaattta 144704



to top

>gb|AC148244.3| Mus musculus chromosome 9, clone wi1-65440F10, complete sequence
          Length = 41220

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 82    ttaaaatttattaaaaatt 100
             |||||||||||||||||||
Sbjct: 29000 ttaaaatttattaaaaatt 29018



to top

>gb|AE006248.1| Lactococcus lactis subsp. lactis IL1403 section 10 of 218 of the
            complete genome
          Length = 10813

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1682 attaaaatttattaaaaat 1700



to top

>gb|AC148997.1| Mus musculus BAC clone RP23-338B6 from chromosome 7, complete sequence
          Length = 232770

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 4      cctgcttccttttattcca 22
              |||||||||||||||||||
Sbjct: 204037 cctgcttccttttattcca 204019



to top

>gb|AY818718.1| Reticulomyxa filosa clone B1 beta tubulin gene, partial cds
          Length = 1060

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 131 attaaaatttattaaaaat 113



to top

>gb|AY818717.1| Reticulomyxa filosa clone B4 beta tubulin gene, partial cds
          Length = 1058

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 130 attaaaatttattaaaaat 112



to top

>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence
          Length = 170236

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 80345 attaaaatttattaaaaat 80363



to top

>emb|CR478208.13| Zebrafish DNA sequence from clone CH211-149M3 in linkage group 16,
             complete sequence
          Length = 195111

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    caccaaatacaaaatgaaa 42
             |||||||||||||||||||
Sbjct: 11392 caccaaatacaaaatgaaa 11374



to top

>gb|AC147148.2| Pan troglodytes BAC clone CH251-267E22 from Y, complete sequence
          Length = 151370

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 82     ttaaaatttattaaaaatt 100
              |||||||||||||||||||
Sbjct: 143806 ttaaaatttattaaaaatt 143788



to top

>gb|AC132594.3| Mus musculus BAC clone RP24-222P6 from chromosome 7, complete sequence
          Length = 162814

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 4     cctgcttccttttattcca 22
             |||||||||||||||||||
Sbjct: 65723 cctgcttccttttattcca 65705



to top

>gb|AC127351.3| Mus musculus BAC clone RP23-66K20 from chromosome 5, complete sequence
          Length = 238781

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    gattaaaatttattaaaaa 98
             |||||||||||||||||||
Sbjct: 60602 gattaaaatttattaaaaa 60584



to top

>gb|AC122365.4| Mus musculus BAC clone RP23-447A7 from chromosome 5, complete sequence
          Length = 195492

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     gattaaaatttattaaaaa 98
              |||||||||||||||||||
Sbjct: 155824 gattaaaatttattaaaaa 155806



to top

>gb|AC126680.4| Mus musculus BAC clone RP24-347B21 from chromosome 7, complete
            sequence
          Length = 161973

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 4    cctgcttccttttattcca 22
            |||||||||||||||||||
Sbjct: 1717 cctgcttccttttattcca 1699



to top

>emb|Z27081.1|CEM01A8 Caenorhabditis elegans Cosmid M01A8, complete sequence
          Length = 19001

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 83   taaaatttattaaaaattg 101
            |||||||||||||||||||
Sbjct: 3983 taaaatttattaaaaattg 4001



to top

>emb|Z81468.1|CEC13B4 Caenorhabditis elegans Cosmid C13B4, complete sequence
          Length = 24187

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 25   accaaatacaaaatgaaac 43
            |||||||||||||||||||
Sbjct: 9069 accaaatacaaaatgaaac 9051



to top

>emb|CR759753.9| Zebrafish DNA sequence from clone DKEY-11G15 in linkage group 7, complete
              sequence
          Length = 203801

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 86     aatttattaaaaattgagc 104
              |||||||||||||||||||
Sbjct: 103783 aatttattaaaaattgagc 103765



to top

>ref|XM_645468.1| Entamoeba histolytica HM-1:IMSS zinc finger protein (211.t00003)
           partial mRNA
          Length = 1077

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 80  gattaaaatttattaaaaa 98
           |||||||||||||||||||
Sbjct: 599 gattaaaatttattaaaaa 617



to top

>ref|XM_721806.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00782)
           partial mRNA
          Length = 576

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 141 attaaaatttattaaaaat 123



to top

>ref|XM_725813.1| Plasmodium yoelii yoelii str. 17XNL protoporphyrinogen oxidase
           (PY02951) partial mRNA
          Length = 1740

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 849 attaaaatttattaaaaat 867



to top

>ref|XM_667156.1| Plasmodium berghei strain ANKA hypothetical protein (PB301225.00.0)
           partial mRNA
          Length = 477

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 141 attaaaatttattaaaaat 123



to top

>ref|XM_675325.1| Plasmodium berghei strain ANKA hypothetical protein (PB000983.00.0)
           partial mRNA
          Length = 711

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 141 attaaaatttattaaaaat 123



to top

>gb|U70857.2| Caenorhabditis elegans cosmid C10G8, complete sequence
          Length = 30826

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 84   aaaatttattaaaaattgagctg 106
            |||||||||| ||||||||||||
Sbjct: 7750 aaaatttattcaaaattgagctg 7772



to top

>gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete sequence
          Length = 122251

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 37231 attaaaatttattaaaaat 37213



to top

>gb|AC138016.14| Medicago truncatula clone mth2-34f15, complete sequence
          Length = 116164

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 74552 attaaaatttattaaaaat 74570



to top

>gb|AC140849.8| Medicago truncatula clone mth2-17f20, complete sequence
          Length = 136131

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 32948 attaaaatttattaaaaat 32966



to top

>gb|AF375499.1| Osornophryne sp. QCAZ11471 12S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 922

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttaaaatttattaaaaatt 100
           |||||||||||||||||||
Sbjct: 844 ttaaaatttattaaaaatt 826



to top

>emb|AL160399.13| Human DNA sequence from clone RP11-161N21 on chromosome 6, complete
              sequence
          Length = 126595

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 15     ttattccaacaccaaatacaaaa 37
              ||||||| |||||||||||||||
Sbjct: 111982 ttattcccacaccaaatacaaaa 112004



to top

>emb|AL157883.15| Human DNA sequence from clone RP11-360J12 on chromosome 9q21.12-21.32
              Contains an orthodenticle homolog 2 (Drosophila) (OTX2)
              pseudogene, complete sequence
          Length = 176870

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 84     aaaatttattaaaaattga 102
              |||||||||||||||||||
Sbjct: 108021 aaaatttattaaaaattga 108003



to top

>gb|AC113054.14| Mus musculus chromosome 15, clone RP23-251L21, complete sequence
          Length = 179314

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    ttttattccaacaccaaat 31
             |||||||||||||||||||
Sbjct: 96868 ttttattccaacaccaaat 96850



to top

>emb|CR936324.2| Medicago truncatula chromosome 5 clone mth2-62a22, COMPLETE SEQUENCE
          Length = 121881

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 35395 attaaaatttattaaaaat 35377



to top

>emb|BX649366.5| Zebrafish DNA sequence from clone DKEY-16I5 in linkage group 12, complete
              sequence
          Length = 222310

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 81     attaaaatttattaaaaat 99
              |||||||||||||||||||
Sbjct: 217625 attaaaatttattaaaaat 217643



to top

>dbj|BS000668.1| Pan troglodytes chromosome Y clone:PTFY-015J14, complete sequences
          Length = 38005

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 82   ttaaaatttattaaaaatt 100
            |||||||||||||||||||
Sbjct: 9288 ttaaaatttattaaaaatt 9306



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 82   ttaaaatttattaaaaatt 100
            |||||||||||||||||||
Sbjct: 7565 ttaaaatttattaaaaatt 7583



to top

>gb|AC166091.3| Glycine max clone gmw1-11j16, complete sequence
          Length = 69947

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 82    ttaaaatttattaaaaatt 100
             |||||||||||||||||||
Sbjct: 13655 ttaaaatttattaaaaatt 13637



to top

>gb|AC166092.4| Glycine max clone gmw1-93l19, complete sequence
          Length = 51037

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 33634 attaaaatttattaaaaat 33616



to top

>gb|AC006929.4| Arabidopsis thaliana chromosome 2 clone T1E2 map mi54, complete
             sequence
          Length = 94884

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 31    tacaaaatgaaacgattgg 49
             |||||||||||||||||||
Sbjct: 16042 tacaaaatgaaacgattgg 16024



to top

>gb|AC005851.3| Arabidopsis thaliana chromosome 2 clone F24D13 map B68, complete
             sequence
          Length = 91261

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 31    tacaaaatgaaacgattgg 49
             |||||||||||||||||||
Sbjct: 80247 tacaaaatgaaacgattgg 80229



to top

>gb|AC005171.3| Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete
              sequence
          Length = 138181

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 82     ttaaaatttattaaaaatt 100
              |||||||||||||||||||
Sbjct: 113537 ttaaaatttattaaaaatt 113519



to top

>gb|AC105031.5| Homo sapiens chromosome 8, clone CTD-2272D18, complete sequence
          Length = 111327

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    gattaaaatttattaaaaa 98
             |||||||||||||||||||
Sbjct: 96807 gattaaaatttattaaaaa 96825



to top

>gb|U55364.1| Caenorhabditis elegans cosmid F21C10, complete sequence
          Length = 41003

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    gattaaaatttattaaaaa 98
             |||||||||||||||||||
Sbjct: 17385 gattaaaatttattaaaaa 17367



to top

>gb|AC090095.7| Homo sapiens, clone RP11-296C13, complete sequence
          Length = 194074

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 80   gattaaaatttattaaaaa 98
            |||||||||||||||||||
Sbjct: 6933 gattaaaatttattaaaaa 6951



to top

>gb|AC098575.6| Drosophila melanogaster X BAC RP98-3D13 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 155685

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 53533 attaaaatttattaaaaat 53551



to top

>gb|AC020556.7| Homo sapiens BAC clone RP11-507B10 from 4, complete sequence
          Length = 186092

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 83     taaaatttattaaaaattg 101
              |||||||||||||||||||
Sbjct: 156636 taaaatttattaaaaattg 156654



to top

>gb|AC079140.6| Homo sapiens BAC clone RP11-478C6 from 4, complete sequence
          Length = 156265

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 14     tttattccaacaccaaata 32
              |||||||||||||||||||
Sbjct: 136249 tttattccaacaccaaata 136231



to top

>gb|DQ277619.1| Drosophila melanogaster isolate sim locus 233 genomic sequence
          Length = 1126

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 948 attaaaatttattaaaaat 930



to top

>gb|DQ277618.1| Drosophila melanogaster isolate mz42 locus 233 genomic sequence
          Length = 1197

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1019 attaaaatttattaaaaat 1001



to top

>gb|DQ277617.1| Drosophila melanogaster isolate mz41 locus 233 genomic sequence
          Length = 1213

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1035 attaaaatttattaaaaat 1017



to top

>gb|DQ277616.1| Drosophila melanogaster isolate mz36 locus 233 genomic sequence
          Length = 1206

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1028 attaaaatttattaaaaat 1010



to top

>gb|DQ277615.1| Drosophila melanogaster isolate mz35 locus 233 genomic sequence
          Length = 1197

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1019 attaaaatttattaaaaat 1001



to top

>gb|DQ277614.1| Drosophila melanogaster isolate mz22 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277613.1| Drosophila melanogaster isolate mz21 locus 233 genomic sequence
          Length = 1208

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1030 attaaaatttattaaaaat 1012



to top

>gb|DQ277612.1| Drosophila melanogaster isolate mz20 locus 233 genomic sequence
          Length = 1203

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1025 attaaaatttattaaaaat 1007



to top

>gb|DQ277611.1| Drosophila melanogaster isolate mz18 locus 233 genomic sequence
          Length = 1192

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1014 attaaaatttattaaaaat 996



to top

>gb|DQ277610.1| Drosophila melanogaster isolate mz15 locus 233 genomic sequence
          Length = 1205

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1027 attaaaatttattaaaaat 1009



to top

>gb|DQ277609.1| Drosophila melanogaster isolate mz13 locus 233 genomic sequence
          Length = 1196

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1018 attaaaatttattaaaaat 1000



to top

>gb|DQ277608.1| Drosophila melanogaster isolate mz10 locus 233 genomic sequence
          Length = 1206

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1028 attaaaatttattaaaaat 1010



to top

>gb|DQ277607.1| Drosophila melanogaster isolate mz07 locus 233 genomic sequence
          Length = 1200

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1022 attaaaatttattaaaaat 1004



to top

>gb|DQ277606.1| Drosophila melanogaster isolate mb77 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277605.1| Drosophila melanogaster isolate mb56 locus 233 genomic sequence
          Length = 1196

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1018 attaaaatttattaaaaat 1000



to top

>gb|DQ277604.1| Drosophila melanogaster isolate mb52 locus 233 genomic sequence
          Length = 1206

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1028 attaaaatttattaaaaat 1010



to top

>gb|DQ277603.1| Drosophila melanogaster isolate mb44 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277602.1| Drosophila melanogaster isolate mb39 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277601.1| Drosophila melanogaster isolate mb36 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277600.1| Drosophila melanogaster isolate mb30 locus 233 genomic sequence
          Length = 1204

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1026 attaaaatttattaaaaat 1008



to top

>gb|DQ277599.1| Drosophila melanogaster isolate mb22 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277598.1| Drosophila melanogaster isolate mb18 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277597.1| Drosophila melanogaster isolate mb15 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277596.1| Drosophila melanogaster isolate mb12 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277595.1| Drosophila melanogaster isolate mb05 locus 233 genomic sequence
          Length = 1202

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 1024 attaaaatttattaaaaat 1006



to top

>gb|DQ277594.1| Drosophila melanogaster isolate me68 locus 233 genomic sequence
          Length = 1117

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 983 attaaaatttattaaaaat 965



to top

>gb|DQ277593.1| Drosophila melanogaster isolate me66 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>gb|DQ277592.1| Drosophila melanogaster isolate me54 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>gb|DQ277591.1| Drosophila melanogaster isolate me46 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>gb|DQ277590.1| Drosophila melanogaster isolate me38 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>gb|DQ277589.1| Drosophila melanogaster isolate me31 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>gb|DQ277588.1| Drosophila melanogaster isolate me27 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>gb|DQ277587.1| Drosophila melanogaster isolate me26 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>gb|DQ277586.1| Drosophila melanogaster isolate me20 locus 233 genomic sequence
          Length = 1117

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 983 attaaaatttattaaaaat 965



to top

>gb|DQ277585.1| Drosophila melanogaster isolate me17 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>gb|DQ277584.1| Drosophila melanogaster isolate me13 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>gb|DQ277583.1| Drosophila melanogaster isolate me08 locus 233 genomic sequence
          Length = 1115

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 981 attaaaatttattaaaaat 963



to top

>emb|BX323878.10| Zebrafish DNA sequence from clone CH211-57E23 in linkage group 12,
              complete sequence
          Length = 190541

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 81     attaaaatttattaaaaat 99
              |||||||||||||||||||
Sbjct: 166805 attaaaatttattaaaaat 166787



to top

>gb|AF267204.1| Candidatus Carsonella ruddii natural-host Cacopsylla brunneipennis
           ATP synthase alpha subunit (atpA) gene, partial cds; ATP
           synthase gamma subunit (atpG) gene, complete cds; and
           ATP synthase beta subunit (atpD) gene, partial cds
          Length = 1809

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 910 attaaaatttattaaaaat 928



to top

>gb|AC018443.9|AC018443 Homo sapiens chromosome 8, clone RP11-674A24, complete sequence
          Length = 199810

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    gattaaaatttattaaaaa 98
             |||||||||||||||||||
Sbjct: 39928 gattaaaatttattaaaaa 39946



to top

>ref|NM_001027512.2| Caenorhabditis elegans M01A8.2b (M01A8.2) mRNA, complete cds
          Length = 2974

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 83   taaaatttattaaaaattg 101
            |||||||||||||||||||
Sbjct: 2968 taaaatttattaaaaattg 2950



to top

>gb|AC006762.2| Caenorhabditis elegans cosmid Y42G9A, complete sequence
          Length = 30585

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 82   ttaaaatttattaaaaatt 100
            |||||||||||||||||||
Sbjct: 5564 ttaaaatttattaaaaatt 5546



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 84       aaaatttattaaaaattga 102
                |||||||||||||||||||
Sbjct: 25093264 aaaatttattaaaaattga 25093282



to top

>gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, complete sequence
          Length = 179835

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 81     attaaaatttattaaaaat 99
              |||||||||||||||||||
Sbjct: 154877 attaaaatttattaaaaat 154895



to top

>dbj|AB164640.1| Marsupenaeus japonicus CRP-2 mRNA for cortical rod protein-2,
           complete cds
          Length = 966

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 963 attaaaatttattaaaaat 945



to top

>dbj|AB164639.1| Marsupenaeus japonicus CRP mRNA for cortical rod protein, complete
           cds
          Length = 966

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 81  attaaaatttattaaaaat 99
           |||||||||||||||||||
Sbjct: 963 attaaaatttattaaaaat 945



to top

>gb|AC018799.8| Homo sapiens BAC clone RP11-125N8 from 2, complete sequence
          Length = 151107

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 82     ttaaaatttattaaaaatt 100
              |||||||||||||||||||
Sbjct: 117135 ttaaaatttattaaaaatt 117153



to top

>gb|AC011810.8|AC011810 Arabidopsis thaliana chromosome I BAC T6J4 genomic sequence, complete
             sequence
          Length = 103157

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 73128 attaaaatttattaaaaat 73110



to top

>gb|AC027134.4|AC027134 Arabidopsis thaliana chromosome I BAC F13B4 genomic sequence, complete
             sequence
          Length = 102183

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 25821 attaaaatttattaaaaat 25803



to top

>gb|AC147927.3| Ovis aries clone CH243-129I22, complete sequence
          Length = 187152

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     gattaaaatttattaaaaa 98
              |||||||||||||||||||
Sbjct: 135927 gattaaaatttattaaaaa 135945



to top

>dbj|AP005245.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0025J22
          Length = 175355

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 84     aaaatttattaaaaattga 102
              |||||||||||||||||||
Sbjct: 149380 aaaatttattaaaaattga 149398



to top

>gb|AF130815.1|AF130815 Buchnera aphidicola natural-host Melaphis rhois ferredoxin-NADP
            reductase (fpr) gene, partial cds; anthranilate synthase
            large subunit (trpE) and anthranilate synthase small
            subunit (trpG) genes, complete cds; heat shock protein
            HslU (hslU) gene, partial cds; and unknown gene
          Length = 3980

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 84   aaaatttattaaaaattga 102
            |||||||||||||||||||
Sbjct: 1028 aaaatttattaaaaattga 1046



to top

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 85     aaatttattaaaaattgag 103
              |||||||||||||||||||
Sbjct: 977081 aaatttattaaaaattgag 977099



to top

>gb|AY258062.1| Monochamus urussovi MURP2 12S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 344

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttaaaatttattaaaaatt 100
           |||||||||||||||||||
Sbjct: 323 ttaaaatttattaaaaatt 305



to top

>gb|AY258059.1| Monochamus sutor MSU1 12S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 344

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttaaaatttattaaaaatt 100
           |||||||||||||||||||
Sbjct: 323 ttaaaatttattaaaaatt 305



to top

>gb|AY258058.1| Monochamus sartor MSA2 12S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 344

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttaaaatttattaaaaatt 100
           |||||||||||||||||||
Sbjct: 323 ttaaaatttattaaaaatt 305



to top

>gb|AY258057.1| Monochamus sartor MSA1 12S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 344

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttaaaatttattaaaaatt 100
           |||||||||||||||||||
Sbjct: 323 ttaaaatttattaaaaatt 305



to top

>gb|AY258056.1| Monochamus sartor MSAE 12S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 344

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttaaaatttattaaaaatt 100
           |||||||||||||||||||
Sbjct: 323 ttaaaatttattaaaaatt 305



to top

>gb|AY258055.1| Monochamus galloprovincialis pistor MGPV2 12S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 344

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttaaaatttattaaaaatt 100
           |||||||||||||||||||
Sbjct: 323 ttaaaatttattaaaaatt 305



to top

>gb|AY258054.1| Monochamus galloprovincialis pistor MGP 12S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 344

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttaaaatttattaaaaatt 100
           |||||||||||||||||||
Sbjct: 323 ttaaaatttattaaaaatt 305



to top

>gb|AY258053.1| Monochamus galloprovincialis galloprovincialis MGGA 12S ribosomal
           RNA gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 344

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttaaaatttattaaaaatt 100
           |||||||||||||||||||
Sbjct: 323 ttaaaatttattaaaaatt 305



to top

>gb|AE003426.3| Drosophila melanogaster chromosome X, section 10 of 74 of the complete
             sequence
          Length = 396604

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 67727 attaaaatttattaaaaat 67709



to top

>emb|BX072581.5| Zebrafish DNA sequence from clone DKEY-14K7 in linkage group 7, complete
              sequence
          Length = 239497

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 86     aatttattaaaaattgagc 104
              |||||||||||||||||||
Sbjct: 143311 aatttattaaaaattgagc 143293



to top

>gb|AC121845.3| Mus musculus BAC clone RP24-82B23 from 5, complete sequence
          Length = 217530

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    attaaaatttattaaaaat 99
             |||||||||||||||||||
Sbjct: 86751 attaaaatttattaaaaat 86733



to top

>emb|BX897740.7| Zebrafish DNA sequence from clone CH211-257M21 in linkage group 5,
              complete sequence
          Length = 160056

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 15     ttattccaacaccaaatacaaaa 37
              |||||||||||||||||| ||||
Sbjct: 113025 ttattccaacaccaaatataaaa 113003



to top

>dbj|AB232773.1| Ipomoea nil InMYB1 gene for R2R3-MYB transcriptional regulator,
            complete cds, strain:78WWc-1
          Length = 5403

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 4736 attaaaatttattaaaaat 4754



to top

>dbj|AB232772.1| Ipomoea nil InMYB1 gene for R2R3-MYB transcriptional regulator,
            complete cds, strain:KK/ZSK-2
          Length = 5405

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 4738 attaaaatttattaaaaat 4756



to top

>dbj|AB232771.1| Ipomoea nil InMYB1 gene for R2R3-MYB transcriptional regulator,
            complete cds, strain:TKS
          Length = 5412

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 81   attaaaatttattaaaaat 99
            |||||||||||||||||||
Sbjct: 4745 attaaaatttattaaaaat 4763


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,979,529
Number of Sequences: 3902068
Number of extensions: 1979529
Number of successful extensions: 173646
Number of sequences better than 10.0: 146
Number of HSP's better than 10.0 without gapping: 146
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 173156
Number of HSP's gapped (non-prelim): 490
length of query: 110
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 89
effective length of database: 17,151,101,840
effective search space: 1526448063760
effective search space used: 1526448063760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top