Clone Name | rbart22c08 |
---|---|
Clone Library Name | barley_pub |
>gb|AC134822.19| Medicago truncatula clone mth2-15j20, complete sequence Length = 106152 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 263 tcttcatcttctcaaccaaaacc 285 ||||||||||||||||||||||| Sbjct: 41887 tcttcatcttctcaaccaaaacc 41865 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 266 tcatcttctcaaccaaaacc 285 |||||||||||||||||||| Sbjct: 46105 tcatcttctcaaccaaaacc 46086
>gb|AC008911.6| Homo sapiens chromosome 5 clone CTD-2268J5, complete sequence Length = 154963 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 323 cacatctctcttcctttttgt 343 ||||||||||||||||||||| Sbjct: 119656 cacatctctcttcctttttgt 119636
>gb|AC022163.5| Homo sapiens chromosome 5 clone RP11-454F19, complete sequence Length = 165675 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 323 cacatctctcttcctttttgt 343 ||||||||||||||||||||| Sbjct: 85046 cacatctctcttcctttttgt 85066
>gb|AC020939.7| Homo sapiens chromosome 5 clone CTD-2311D2, complete sequence Length = 112595 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 323 cacatctctcttcctttttgt 343 ||||||||||||||||||||| Sbjct: 62374 cacatctctcttcctttttgt 62354
>gb|AC109213.6| Mus musculus chromosome 16, clone RP23-345L20, complete sequence Length = 244558 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 357 gactttcttctgcggtcaaa 376 |||||||||||||||||||| Sbjct: 201469 gactttcttctgcggtcaaa 201450
>emb|AL450364.12| Human DNA sequence from clone RP11-499P20 on chromosome 10 Contains part of the CACNB2 gene for calcium channel voltage-dependent beta 2 subunit and the 3' end of a novel gene, complete sequence Length = 38089 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 gggaggcctatcctgttcct 194 |||||||||||||||||||| Sbjct: 31103 gggaggcctatcctgttcct 31122
>emb|AL449423.14| Human DNA sequence from clone RP11-149I2 on chromosome 9 Contains the CDKN2A gene for cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4), the gene for susceptibility protein NSG-x (LOC51198), the 5' end of a variant of the MTAP gene for methylthioadenosine phosphorylase (MSAP), the 3' end of the CDKN2B gene for cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) and 4 CpG islands, complete sequence Length = 101155 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 catctctcttcctttttgta 344 |||||||||||||||||||| Sbjct: 27730 catctctcttcctttttgta 27711
>emb|AL354856.9| Human DNA sequence from clone RP11-290P3 on chromosome 6, complete sequence Length = 113146 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 316 tgcaactcacatctctcttccttt 339 |||||||||||||| ||||||||| Sbjct: 35392 tgcaactcacatctttcttccttt 35415
>gb|AC102287.16| Mus musculus chromosome 8, clone RP24-345M16, complete sequence Length = 179888 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 197 tatgaaatggttggagaaat 216 |||||||||||||||||||| Sbjct: 18523 tatgaaatggttggagaaat 18542
>gb|AE011657.1| Xanthomonas axonopodis pv. citri str. 306, section 35 of 469 of the complete genome Length = 10222 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 102 caacaacaggcaggccaaca 121 |||||||||||||||||||| Sbjct: 4323 caacaacaggcaggccaaca 4304
>gb|AC018521.8| Homo sapiens chromosome 17, clone RP11-6N17, complete sequence Length = 143494 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 146 gacaaacagcttacaaactg 165 |||||||||||||||||||| Sbjct: 54747 gacaaacagcttacaaactg 54728
>gb|AC000047.6| Combined sequence from cosmids c110 and c20 derived from Homo sapiens Chromosome 9p21, complete sequence Length = 41265 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 catctctcttcctttttgta 344 |||||||||||||||||||| Sbjct: 37053 catctctcttcctttttgta 37034
>gb|AF190641.1|AF190641 Homo sapiens chromosome 21 PAC 704P23131 map 21q22.1, complete sequence Length = 89102 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 20 tggaagaacaattgcatcgaaatc 43 |||||||| ||||||||||||||| Sbjct: 47910 tggaagaaaaattgcatcgaaatc 47933
>dbj|BS000177.1| Pan troglodytes chromosome 22 clone:PTB-118H03, map 22, complete sequences Length = 267172 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 20 tggaagaacaattgcatcgaaatc 43 |||||||| ||||||||||||||| Sbjct: 60397 tggaagaaaaattgcatcgaaatc 60420
>dbj|AP001707.1| Homo sapiens genomic DNA, chromosome 21q, section 51/105 Length = 340000 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 20 tggaagaacaattgcatcgaaatc 43 |||||||| ||||||||||||||| Sbjct: 15956 tggaagaaaaattgcatcgaaatc 15979
>emb|AL772205.12| Mouse DNA sequence from clone RP23-162C3 on chromosome 2, complete sequence Length = 142565 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 11 ttcttctcatggaagaacaa 30 |||||||||||||||||||| Sbjct: 111341 ttcttctcatggaagaacaa 111322
>dbj|AP000390.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone:B347N6, complete sequence Length = 50188 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 20 tggaagaacaattgcatcgaaatc 43 |||||||| ||||||||||||||| Sbjct: 17554 tggaagaaaaattgcatcgaaatc 17577
>dbj|AB060808.1| Homo sapiens gene for p16/CDKN2A, complete cds Length = 250000 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 catctctcttcctttttgta 344 |||||||||||||||||||| Sbjct: 154374 catctctcttcctttttgta 154355 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,418,233 Number of Sequences: 3902068 Number of extensions: 3418233 Number of successful extensions: 69164 Number of sequences better than 10.0: 18 Number of HSP's better than 10.0 without gapping: 18 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 69138 Number of HSP's gapped (non-prelim): 26 length of query: 410 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 388 effective length of database: 17,147,199,772 effective search space: 6653113511536 effective search space used: 6653113511536 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)