ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart22a01 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_506982.1| PREDICTED Oryza sativa (japonica cultivar-group), P0627E03.33 mRNA Length = 1676 Score = 133 bits (67), Expect = 6e-28 Identities = 196/239 (82%) Strand = Plus / Minus Query: 206 tcgaagttgcggtgagatgaaccgccgggcttggtggccttggccgctttctccctccac 265 ||||||||||||||||| || ||||||||||| | ||| || ||| |||||||||||| Sbjct: 1494 tcgaagttgcggtgagacgagccgccgggcttagccgccctgatcgccttctccctccac 1435 Query: 266 tcgtgtgccttcttcttcatcaccttgccattttccccctccatgatctctgtgataagg 325 || | |||||| || ||||| |||| || || | || ||||||| ||| | ||| ||| Sbjct: 1434 tcctccgccttcctcctcatctccttccccttctgaccttccatgagctcagcgatgagg 1375 Query: 326 cgtgcgacggcatcacgccgaacgtcgctatcgatctccatgccgacgccccattcagtg 385 | |||||||| | ||| |||| ||| ||||||||||||||||||||||| || || Sbjct: 1374 cacgcgacggcgccgcgcttgacgttgctgtcgatctccatgccgacgccccactcgttg 1315 Query: 386 cattggtatcggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcac 444 || ||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||| Sbjct: 1314 cactggtaccggcagttcgtctgctggtcggcgaagaatggccagctgatgacgggcac 1256
>ref|XM_467869.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1659 Score = 133 bits (67), Expect = 6e-28 Identities = 196/239 (82%) Strand = Plus / Minus Query: 206 tcgaagttgcggtgagatgaaccgccgggcttggtggccttggccgctttctccctccac 265 ||||||||||||||||| || ||||||||||| | ||| || ||| |||||||||||| Sbjct: 1497 tcgaagttgcggtgagacgagccgccgggcttagccgccctgatcgccttctccctccac 1438 Query: 266 tcgtgtgccttcttcttcatcaccttgccattttccccctccatgatctctgtgataagg 325 || | |||||| || ||||| |||| || || | || ||||||| ||| | ||| ||| Sbjct: 1437 tcctccgccttcctcctcatctccttccccttctgaccttccatgagctcagcgatgagg 1378 Query: 326 cgtgcgacggcatcacgccgaacgtcgctatcgatctccatgccgacgccccattcagtg 385 | |||||||| | ||| |||| ||| ||||||||||||||||||||||| || || Sbjct: 1377 cacgcgacggcgccgcgcttgacgttgctgtcgatctccatgccgacgccccactcgttg 1318 Query: 386 cattggtatcggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcac 444 || ||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||| Sbjct: 1317 cactggtaccggcagttcgtctgctggtcggcgaagaatggccagctgatgacgggcac 1259
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 133 bits (67), Expect = 6e-28 Identities = 196/239 (82%) Strand = Plus / Minus Query: 206 tcgaagttgcggtgagatgaaccgccgggcttggtggccttggccgctttctccctccac 265 ||||||||||||||||| || ||||||||||| | ||| || ||| |||||||||||| Sbjct: 31826131 tcgaagttgcggtgagacgagccgccgggcttagccgccctgatcgccttctccctccac 31826072 Query: 266 tcgtgtgccttcttcttcatcaccttgccattttccccctccatgatctctgtgataagg 325 || | |||||| || ||||| |||| || || | || ||||||| ||| | ||| ||| Sbjct: 31826071 tcctccgccttcctcctcatctccttccccttctgaccttccatgagctcagcgatgagg 31826012 Query: 326 cgtgcgacggcatcacgccgaacgtcgctatcgatctccatgccgacgccccattcagtg 385 | |||||||| | ||| |||| ||| ||||||||||||||||||||||| || || Sbjct: 31826011 cacgcgacggcgccgcgcttgacgttgctgtcgatctccatgccgacgccccactcgttg 31825952 Query: 386 cattggtatcggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcac 444 || ||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||| Sbjct: 31825951 cactggtaccggcagttcgtctgctggtcggcgaagaatggccagctgatgacgggcac 31825893 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 22250439 cggcagttggtctgctgctcggcgaagaacggccagc 22250403 Score = 44.1 bits (22), Expect = 0.42 Identities = 70/86 (81%) Strand = Plus / Plus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcactccgccgcac 454 |||||||||||| ||| || |||||||| ||||||| ||| || ||||| ||| ||| Sbjct: 31806191 cggcagttggtcatctgctcggcgaagaacggccagcagatcatcggcacgccggcgctt 31806250 Query: 455 atgctttccaatgccgagttccagcc 480 ||||| |||| | |||||||||||| Sbjct: 31806251 atgctctccagcgtcgagttccagcc 31806276 Score = 40.1 bits (20), Expect = 6.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 400 gttggtctgctggtccgcgaagaatggccagc 431 |||||||||||| || |||||||| ||||||| Sbjct: 22235986 gttggtctgctgctcggcgaagaagggccagc 22235955
>dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0627E03 Length = 159861 Score = 133 bits (67), Expect = 6e-28 Identities = 196/239 (82%) Strand = Plus / Minus Query: 206 tcgaagttgcggtgagatgaaccgccgggcttggtggccttggccgctttctccctccac 265 ||||||||||||||||| || ||||||||||| | ||| || ||| |||||||||||| Sbjct: 121929 tcgaagttgcggtgagacgagccgccgggcttagccgccctgatcgccttctccctccac 121870 Query: 266 tcgtgtgccttcttcttcatcaccttgccattttccccctccatgatctctgtgataagg 325 || | |||||| || ||||| |||| || || | || ||||||| ||| | ||| ||| Sbjct: 121869 tcctccgccttcctcctcatctccttccccttctgaccttccatgagctcagcgatgagg 121810 Query: 326 cgtgcgacggcatcacgccgaacgtcgctatcgatctccatgccgacgccccattcagtg 385 | |||||||| | ||| |||| ||| ||||||||||||||||||||||| || || Sbjct: 121809 cacgcgacggcgccgcgcttgacgttgctgtcgatctccatgccgacgccccactcgttg 121750 Query: 386 cattggtatcggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcac 444 || ||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||| Sbjct: 121749 cactggtaccggcagttcgtctgctggtcggcgaagaatggccagctgatgacgggcac 121691 Score = 44.1 bits (22), Expect = 0.42 Identities = 70/86 (81%) Strand = Plus / Plus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcactccgccgcac 454 |||||||||||| ||| || |||||||| ||||||| ||| || ||||| ||| ||| Sbjct: 101989 cggcagttggtcatctgctcggcgaagaacggccagcagatcatcggcacgccggcgctt 102048 Query: 455 atgctttccaatgccgagttccagcc 480 ||||| |||| | |||||||||||| Sbjct: 102049 atgctctccagcgtcgagttccagcc 102074
>dbj|AK104985.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-F12, full insert sequence Length = 1677 Score = 133 bits (67), Expect = 6e-28 Identities = 196/239 (82%) Strand = Plus / Minus Query: 206 tcgaagttgcggtgagatgaaccgccgggcttggtggccttggccgctttctccctccac 265 ||||||||||||||||| || ||||||||||| | ||| || ||| |||||||||||| Sbjct: 1494 tcgaagttgcggtgagacgagccgccgggcttagccgccctgatcgccttctccctccac 1435 Query: 266 tcgtgtgccttcttcttcatcaccttgccattttccccctccatgatctctgtgataagg 325 || | |||||| || ||||| |||| || || | || ||||||| ||| | ||| ||| Sbjct: 1434 tcctccgccttcctcctcatctccttccccttctgaccttccatgagctcagcgatgagg 1375 Query: 326 cgtgcgacggcatcacgccgaacgtcgctatcgatctccatgccgacgccccattcagtg 385 | |||||||| | ||| |||| ||| ||||||||||||||||||||||| || || Sbjct: 1374 cacgcgacggcgccgcgcttgacgttgctgtcgatctccatgccgacgccccactcgttg 1315 Query: 386 cattggtatcggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcac 444 || ||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||| Sbjct: 1314 cactggtaccggcagttcgtctgctggtcggcgaagaatggccagctgatgacgggcac 1256
>dbj|AK073587.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033052B15, full insert sequence Length = 1659 Score = 133 bits (67), Expect = 6e-28 Identities = 196/239 (82%) Strand = Plus / Minus Query: 206 tcgaagttgcggtgagatgaaccgccgggcttggtggccttggccgctttctccctccac 265 ||||||||||||||||| || ||||||||||| | ||| || ||| |||||||||||| Sbjct: 1497 tcgaagttgcggtgagacgagccgccgggcttagccgccctgatcgccttctccctccac 1438 Query: 266 tcgtgtgccttcttcttcatcaccttgccattttccccctccatgatctctgtgataagg 325 || | |||||| || ||||| |||| || || | || ||||||| ||| | ||| ||| Sbjct: 1437 tcctccgccttcctcctcatctccttccccttctgaccttccatgagctcagcgatgagg 1378 Query: 326 cgtgcgacggcatcacgccgaacgtcgctatcgatctccatgccgacgccccattcagtg 385 | |||||||| | ||| |||| ||| ||||||||||||||||||||||| || || Sbjct: 1377 cacgcgacggcgccgcgcttgacgttgctgtcgatctccatgccgacgccccactcgttg 1318 Query: 386 cattggtatcggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcac 444 || ||||| |||||||| ||||||||||| |||||||||||||||||||||| |||||| Sbjct: 1317 cactggtaccggcagttcgtctgctggtcggcgaagaatggccagctgatgacgggcac 1259
>emb|AJ438336.1|TAE438336 Triticum aestivum partial mRNA for glucosyltransferase (GbssI gene), clone ugt4i13e Length = 592 Score = 85.7 bits (43), Expect = 1e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 406 ctgctggtccgcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaa 465 ||||||||| ||||||| ||||||||||||| |||||| |||||||||||||| |||| Sbjct: 592 ctgctggtcgccgaagaagggccagctgatgacgggcacgccgccgcacatgctctccag 533 Query: 466 tgccgagttccagcc 480 || |||||||||||| Sbjct: 532 tgtcgagttccagcc 518
>dbj|AK068176.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013132G13, full insert sequence Length = 1759 Score = 81.8 bits (41), Expect = 2e-12 Identities = 104/125 (83%) Strand = Plus / Minus Query: 356 tcgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtcc 415 |||||||||||| |||||||||| || ||||| ||| |||| |||||||||||| ||| Sbjct: 1430 tcgatctccatggcgacgccccactcggtgcagctgtaccggcggttggtctgctgctcc 1371 Query: 416 gcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaatgccgagttc 475 |||||||||||||||| | || ||||| |||||||| | ||| |||| | ||||||| Sbjct: 1370 gcgaagaatggccagcacagcatcggcaccccgccgcagaggctctccaccgtcgagttc 1311 Query: 476 cagcc 480 ||||| Sbjct: 1310 cagcc 1306
>emb|AJ438331.1|TAE438331 Triticum aestivum partial mRNA for glucosyltransferase (GbssI gene), clone ugt3i11b Length = 922 Score = 77.8 bits (39), Expect = 3e-11 Identities = 67/75 (89%), Gaps = 1/75 (1%) Strand = Plus / Minus Query: 406 ctgctggtccgcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaa 465 ||||||||| ||||||| ||||||||||||| |||||| |||||||||||||| ||| | Sbjct: 922 ctgctggtcgccgaagaagggccagctgatgacgggcacgccgccgcacatgctctcc-a 864 Query: 466 tgccgagttccagcc 480 || |||||||||||| Sbjct: 863 tgtcgagttccagcc 849
>ref|XM_472671.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1476 Score = 73.8 bits (37), Expect = 5e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 356 tcgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtcc 415 |||||||||||| |||||||||| || ||||| ||| |||| |||||||||||| ||| Sbjct: 1280 tcgatctccatggcgacgccccactcggtgcagctgtaccggcggttggtctgctgctcc 1221 Query: 416 gcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaatgccgagttc 475 |||||||| ||||||| | || ||||| |||||||| | ||| |||| | ||||||| Sbjct: 1220 gcgaagaacggccagcacagcatcggcaccccgccgcagaggctctccaccgtcgagttc 1161 Query: 476 cagcc 480 ||||| Sbjct: 1160 cagcc 1156
>emb|AL606615.4|OSJN00048 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0086B14, complete sequence Length = 175698 Score = 73.8 bits (37), Expect = 5e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 356 tcgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtcc 415 |||||||||||| |||||||||| || ||||| ||| |||| |||||||||||| ||| Sbjct: 61327 tcgatctccatggcgacgccccactcggtgcagctgtaccggcggttggtctgctgctcc 61268 Query: 416 gcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaatgccgagttc 475 |||||||| ||||||| | || ||||| |||||||| | ||| |||| | ||||||| Sbjct: 61267 gcgaagaacggccagcacagcatcggcaccccgccgcagaggctctccaccgtcgagttc 61208 Query: 476 cagcc 480 ||||| Sbjct: 61207 cagcc 61203
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 73.8 bits (37), Expect = 5e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 356 tcgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtcc 415 |||||||||||| |||||||||| || ||||| ||| |||| |||||||||||| ||| Sbjct: 22457572 tcgatctccatggcgacgccccactcggtgcagctgtaccggcggttggtctgctgctcc 22457513 Query: 416 gcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaatgccgagttc 475 |||||||| ||||||| | || ||||| |||||||| | ||| |||| | ||||||| Sbjct: 22457512 gcgaagaacggccagcacagcatcggcaccccgccgcagaggctctccaccgtcgagttc 22457453 Query: 476 cagcc 480 ||||| Sbjct: 22457452 cagcc 22457448 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || |||| | ||| |||||||| |||||||| |||| Sbjct: 15163643 cgatctccatcccgacgccccactccgtgcgcttgtaccggcagttcgtctgctgctccg 15163702 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 15163703 cgaagaacggccagct 15163718 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Plus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 15151026 cgatctccatcccgacgccccactccgtccgcttgtaccggcagttcgtctgctgctccg 15151085 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 15151086 cgaagaacggccagct 15151101 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 14736859 cgatctccatcccgacgccccactccgtccgcttgtaccggcagttcgtctgctgctccg 14736800 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 14736799 cgaagaacggccagct 14736784 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || |||| | ||| |||||||| |||||||| || | Sbjct: 14724330 cgatctccatcccgacgccccactccgtgcgcttgtaccggcagttcgtctgctgctcgg 14724271 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 14724270 cgaagaagggccagct 14724255 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| |||| |||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 15014196 cgatctccatcccgatgccccactccgtcctcttgtaccggcagttcgtctgctgctccg 15014137 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 15014136 cgaagaagggccagct 15014121 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Plus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| |||| |||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 14364366 cgatctccatcccgatgccccactccgtcctcttgtaccggcagttcgtctgctgctccg 14364425 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 14364426 cgaagaagggccagct 14364441 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 14832196 cggcagttggtctgctgctcggcgaagaacggccagc 14832160 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 397 gcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||| || |||||||| ||||||| Sbjct: 14785870 gcagttggtctgctgctcggcgaagaacggccagc 14785904 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagct 432 |||||||| |||||||| ||||||||||| ||||||| Sbjct: 15031712 cggcagttcgtctgctgctccgcgaagaacagccagct 15031675 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagct 432 |||||||| |||||||| ||||||||||| ||||||| Sbjct: 14355230 cggcagttcgtctgctgctccgcgaagaacagccagct 14355267
>dbj|AK061024.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-F02, full insert sequence Length = 1647 Score = 73.8 bits (37), Expect = 5e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 356 tcgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtcc 415 |||||||||||| |||||||||| || ||||| ||| |||| |||||||||||| ||| Sbjct: 1365 tcgatctccatggcgacgccccactcggtgcagctgtaccggcggttggtctgctgctcc 1306 Query: 416 gcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaatgccgagttc 475 |||||||| ||||||| | || ||||| |||||||| | ||| |||| | ||||||| Sbjct: 1305 gcgaagaacggccagcacagcatcggcaccccgccgcagaggctctccaccgtcgagttc 1246 Query: 476 cagcc 480 ||||| Sbjct: 1245 cagcc 1241
>ref|XM_471860.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1479 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || |||| | ||| |||||||| |||||||| |||| Sbjct: 1261 cgatctccatcccgacgccccactccgtgcgcttgtaccggcagttcgtctgctgctccg 1202 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 1201 cgaagaacggccagct 1186
>emb|AL731634.4|OSJN00276 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0033P05, complete sequence Length = 120635 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || |||| | ||| |||||||| |||||||| |||| Sbjct: 56538 cgatctccatcccgacgccccactccgtgcgcttgtaccggcagttcgtctgctgctccg 56597 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 56598 cgaagaacggccagct 56613 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Plus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 43921 cgatctccatcccgacgccccactccgtccgcttgtaccggcagttcgtctgctgctccg 43980 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 43981 cgaagaacggccagct 43996
>ref|XM_471859.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1491 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 1279 cgatctccatcccgacgccccactccgtccgcttgtaccggcagttcgtctgctgctccg 1220 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 1219 cgaagaacggccagct 1204
>ref|XM_471822.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1431 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || |||| | ||| |||||||| |||||||| || | Sbjct: 1213 cgatctccatcccgacgccccactccgtgcgcttgtaccggcagttcgtctgctgctcgg 1154 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 1153 cgaagaagggccagct 1138
>ref|XM_471823.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1491 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 1279 cgatctccatcccgacgccccactccgtccgcttgtaccggcagttcgtctgctgctccg 1220 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 1219 cgaagaacggccagct 1204
>emb|AJ438332.1|TAE438332 Triticum aestivum partial mRNA for glucosyltransferase (GbssI gene), clone ugt3i11e Length = 922 Score = 63.9 bits (32), Expect = 4e-07 Identities = 57/64 (89%), Gaps = 1/64 (1%) Strand = Plus / Minus Query: 417 cgaagaatggccagctgatgatgggcactccgccgcacatgctttccaatgccgagttcc 476 ||||||| ||||| ||||||| |||||| |||||||||||||| ||| ||| |||||||| Sbjct: 911 cgaagaagggccaactgatgacgggcacgccgccgcacatgctctcc-atgtcgagttcc 853 Query: 477 agcc 480 |||| Sbjct: 852 agcc 849
>gb|AY111701.1| Zea mays CL51835_1 mRNA sequence Length = 745 Score = 63.9 bits (32), Expect = 4e-07 Identities = 56/64 (87%) Strand = Plus / Plus Query: 368 ccgacgccccattcagtgcattggtatcggcagttggtctgctggtccgcgaagaatggc 427 |||| |||||| || ||||| | ||||||||||||||||||||| || |||||||| ||| Sbjct: 458 ccgatgccccactcggtgcacttgtatcggcagttggtctgctgctcggcgaagaagggc 517 Query: 428 cagc 431 |||| Sbjct: 518 cagc 521
>emb|AL606443.3|OSJN00008 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0026L04, complete sequence Length = 129563 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 76513 cgatctccatcccgacgccccactccgtccgcttgtaccggcagttcgtctgctgctccg 76454 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 76453 cgaagaacggccagct 76438 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| ||||||||||| || |||| | ||| |||||||| |||||||| || | Sbjct: 63984 cgatctccatcccgacgccccactccgtgcgcttgtaccggcagttcgtctgctgctcgg 63925 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 63924 cgaagaagggccagct 63909 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 397 gcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||| || |||||||| ||||||| Sbjct: 125524 gcagttggtctgctgctcggcgaagaacggccagc 125558
>emb|AJ438335.1|TAE438335 Triticum aestivum partial mRNA for glucosyltransferase (GbssI gene), clone ugt4i13c Length = 583 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 410 tggtccgcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaatgcc 469 ||||| |||||||||||||||||||| | ||||| |||||||||| ||| || | ||| Sbjct: 579 tggtctgcgaagaatggccagctgatcaccggcacgccgccgcacaagctctcgagggcc 520 Query: 470 gagttccagcc 480 ||||||||||| Sbjct: 519 gagttccagcc 509
>emb|AJ438333.1|TAE438333 Triticum aestivum partial mRNA for glucosyltransferase (GbssI gene), clone ugt4i13b Length = 583 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 410 tggtccgcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaatgcc 469 ||||| |||||||||||||||||||| | ||||| |||||||||| ||| || | ||| Sbjct: 579 tggtctgcgaagaatggccagctgatcaccggcacgccgccgcacaagctctcgagggcc 520 Query: 470 gagttccagcc 480 ||||||||||| Sbjct: 519 gagttccagcc 509
>ref|XM_471848.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1512 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| |||| |||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 1291 cgatctccatcccgatgccccactccgtcctcttgtaccggcagttcgtctgctgctccg 1232 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 1231 cgaagaagggccagct 1216
>ref|XM_471795.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1473 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| |||| |||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 1252 cgatctccatcccgatgccccactccgtcctcttgtaccggcagttcgtctgctgctccg 1193 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 1192 cgaagaagggccagct 1177
>emb|AL663022.4|OSJN00222 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0054D14, complete sequence Length = 160587 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| |||| |||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 30657 cgatctccatcccgatgccccactccgtcctcttgtaccggcagttcgtctgctgctccg 30598 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 30597 cgaagaagggccagct 30582 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagct 432 |||||||| |||||||| ||||||||||| ||||||| Sbjct: 48173 cggcagttcgtctgctgctccgcgaagaacagccagct 48136
>emb|AL662986.3|OSJN00187 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0087H01, complete sequence Length = 166906 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Plus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| |||| |||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 97286 cgatctccatcccgatgccccactccgtcctcttgtaccggcagttcgtctgctgctccg 97345 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 97346 cgaagaagggccagct 97361 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagct 432 |||||||| |||||||| ||||||||||| ||||||| Sbjct: 88150 cggcagttcgtctgctgctccgcgaagaacagccagct 88187
>dbj|AK106366.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-B11, full insert sequence Length = 1457 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Plus Query: 357 cgatctccatgccgacgccccattcagtgcattggtatcggcagttggtctgctggtccg 416 |||||||||| |||| |||||| || || | | ||| |||||||| |||||||| |||| Sbjct: 61 cgatctccatcccgatgccccactccgtcctcttgtaccggcagttcgtctgctgctccg 120 Query: 417 cgaagaatggccagct 432 ||||||| |||||||| Sbjct: 121 cgaagaagggccagct 136
>emb|AJ438330.1|TAE438330 Triticum aestivum partial mRNA for glucosyltransferase (GbssI gene), clone ugt3i11a Length = 922 Score = 54.0 bits (27), Expect = 4e-04 Identities = 64/75 (85%), Gaps = 1/75 (1%) Strand = Plus / Minus Query: 406 ctgctggtccgcgaagaatggccagctgatgatgggcactccgccgcacatgctttccaa 465 |||||| || |||||||| ||||| ||||| | |||||| |||||||||||||| | | | Sbjct: 922 ctgctgatcggcgaagaagggccaactgataacgggcacgccgccgcacatgctct-cga 864 Query: 466 tgccgagttccagcc 480 || |||||||||||| Sbjct: 863 tgtcgagttccagcc 849
>ref|XM_482293.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1494 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 1274 cggcagttggtctgctgctcggcgaagaacggccagc 1238
>ref|XM_471830.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1428 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 1208 cggcagttggtctgctgctcggcgaagaacggccagc 1172
>ref|XM_466413.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1764 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 1387 cggcagttggtctgctgctcggcgaagaacggccagc 1351
>ref|NM_186853.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1716 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 |||| |||| ||||||||||||||||||| ||||||| Sbjct: 1454 cggctgttgatctgctggtccgcgaagaagggccagc 1418
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 19287448 cggcagttggtctgctgctcggcgaagaacggccagc 19287412
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 |||| |||| ||||||||||||||||||| ||||||| Sbjct: 8380138 cggctgttgatctgctggtccgcgaagaagggccagc 8380174
>emb|AL663021.4|OSJN00218 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0041M06, complete sequence Length = 107014 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 86134 cggcagttggtctgctgctcggcgaagaacggccagc 86098 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 397 gcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||| || |||||||| ||||||| Sbjct: 39808 gcagttggtctgctgctcggcgaagaacggccagc 39842
>dbj|AP006161.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1267B06 Length = 156989 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 9083 cggcagttggtctgctgctcggcgaagaacggccagc 9047
>dbj|AP005183.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0021G06 Length = 137678 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 |||| |||| ||||||||||||||||||| ||||||| Sbjct: 85236 cggctgttgatctgctggtccgcgaagaagggccagc 85272
>dbj|AP006070.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1342F01 Length = 153287 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 146283 cggcagttggtctgctgctcggcgaagaacggccagc 146247 Score = 40.1 bits (20), Expect = 6.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 400 gttggtctgctggtccgcgaagaatggccagc 431 |||||||||||| || |||||||| ||||||| Sbjct: 131830 gttggtctgctgctcggcgaagaagggccagc 131799
>dbj|AP004636.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0685B10 Length = 148544 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 16891 cggcagttggtctgctgctcggcgaagaacggccagc 16855
>dbj|AP003872.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1118_A03 Length = 109873 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 60461 cggcagttggtctgctgctcggcgaagaacggccagc 60425
>dbj|AP005178.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0056I06 Length = 138653 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 |||| |||| ||||||||||||||||||| ||||||| Sbjct: 11731 cggctgttgatctgctggtccgcgaagaagggccagc 11767
>emb|AJ234486.1|HVU234486 Hordeum vulgare genomic DNA fragment; clone MWG0527 Length = 580 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 |||| ||||||||||||||| |||||||| ||||||| Sbjct: 143 cggctgttggtctgctggtcggcgaagaagggccagc 107
>dbj|AK105275.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-A04, full insert sequence Length = 1764 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||||| || |||||||| ||||||| Sbjct: 1387 cggcagttggtctgctgctcggcgaagaacggccagc 1351
>ref|XM_471827.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1494 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 397 gcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||| || |||||||| ||||||| Sbjct: 1272 gcagttggtctgctgctcggcgaagaacggccagc 1238
>dbj|AK119530.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C07, full insert sequence Length = 1673 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 397 gcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||| || |||||||| ||||||| Sbjct: 1367 gcagttggtctgctgctcggcgaagaacggccagc 1333
>emb|AJ438337.1|TAE438337 Triticum aestivum partial mRNA for glucosyltransferase (GbssI gene), clone ugt4ni13a Length = 602 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggcca 429 ||||||||||||||||| ||||| ||||| ||||| Sbjct: 600 cggcagttggtctgctgctccgcaaagaagggcca 566
>dbj|AK105966.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-E07, full insert sequence Length = 1665 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 397 gcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||| || |||||||| ||||||| Sbjct: 1364 gcagttggtctgctgctcggcgaagaacggccagc 1330
>dbj|AK105783.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-G07, full insert sequence Length = 1640 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 397 gcagttggtctgctggtccgcgaagaatggccagc 431 ||||||||||||||| || |||||||| ||||||| Sbjct: 1308 gcagttggtctgctgctcggcgaagaacggccagc 1274
>ref|XM_471850.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1077 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagct 432 |||||||| |||||||| ||||||||||| ||||||| Sbjct: 332 cggcagttcgtctgctgctccgcgaagaacagccagct 295
>ref|XM_467864.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1597 Score = 44.1 bits (22), Expect = 0.42 Identities = 70/86 (81%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcactccgccgcac 454 |||||||||||| ||| || |||||||| ||||||| ||| || ||||| ||| ||| Sbjct: 1247 cggcagttggtcatctgctcggcgaagaacggccagcagatcatcggcacgccggcgctt 1188 Query: 455 atgctttccaatgccgagttccagcc 480 ||||| |||| | |||||||||||| Sbjct: 1187 atgctctccagcgtcgagttccagcc 1162
>ref|XM_471794.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1023 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagct 432 |||||||| |||||||| ||||||||||| ||||||| Sbjct: 314 cggcagttcgtctgctgctccgcgaagaacagccagct 277
>dbj|AK066301.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013059M20, full insert sequence Length = 1596 Score = 44.1 bits (22), Expect = 0.42 Identities = 70/86 (81%) Strand = Plus / Minus Query: 395 cggcagttggtctgctggtccgcgaagaatggccagctgatgatgggcactccgccgcac 454 |||||||||||| ||| || |||||||| ||||||| ||| || ||||| ||| ||| Sbjct: 1246 cggcagttggtcatctgctcggcgaagaacggccagcagatcatcggcacgccggcgctt 1187 Query: 455 atgctttccaatgccgagttccagcc 480 ||||| |||| | |||||||||||| Sbjct: 1186 atgctctccagcgtcgagttccagcc 1161
>ref|NM_119391.1| Arabidopsis thaliana organic anion transporter AT4G32390 mRNA, complete cds Length = 1053 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 274 cttcttcttcatcaccttgc 293 |||||||||||||||||||| Sbjct: 988 cttcttcttcatcaccttgc 969
>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence Length = 1395069 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 332 acggcatcacgccgaacgtc 351 |||||||||||||||||||| Sbjct: 427496 acggcatcacgccgaacgtc 427477
>ref|XM_466409.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1464 Score = 40.1 bits (20), Expect = 6.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 400 gttggtctgctggtccgcgaagaatggccagc 431 |||||||||||| || |||||||| ||||||| Sbjct: 1224 gttggtctgctgctcggcgaagaagggccagc 1193
>ref|XM_466410.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1506 Score = 40.1 bits (20), Expect = 6.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 400 gttggtctgctggtccgcgaagaatggccagc 431 |||||||||||| || |||||||| ||||||| Sbjct: 137 gttggtctgctgctcggcgaagaagggccagc 168
>gb|AE008988.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 14 of 256 of the complete sequence Length = 7214 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 457 gctttccaatgccgagttcc 476 |||||||||||||||||||| Sbjct: 6091 gctttccaatgccgagttcc 6110
>ref|XM_848754.1| PREDICTED: Canis familiaris similar to Histone H1.4 (Histone H1b) (LOC611113), mRNA Length = 873 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 240 tggccttggccgctttctcc 259 |||||||||||||||||||| Sbjct: 712 tggccttggccgctttctcc 693
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence Length = 2580084 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 395 cggcagttggtctgctggtc 414 |||||||||||||||||||| Sbjct: 1941691 cggcagttggtctgctggtc 1941710
>gb|AC126032.4| Mus musculus BAC clone RP24-94B12 from chromosome 1, complete sequence Length = 207475 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 ctaatttatttgattgtatt 31 |||||||||||||||||||| Sbjct: 54326 ctaatttatttgattgtatt 54345
>emb|AL161581.2|ATCHRIV77 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 77 Length = 197252 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 274 cttcttcttcatcaccttgc 293 |||||||||||||||||||| Sbjct: 51546 cttcttcttcatcaccttgc 51527
>emb|AL034567.1|ATF8B4 Arabidopsis thaliana DNA chromosome 4, BAC clone F8B4 (ESSA project) Length = 93257 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 274 cttcttcttcatcaccttgc 293 |||||||||||||||||||| Sbjct: 37829 cttcttcttcatcaccttgc 37810
>gb|DQ397862.1| Cenarchaeum symbiosum clone C15G10, complete sequence Length = 33778 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 101 tcgacctcttccaaaaaact 120 |||||||||||||||||||| Sbjct: 26547 tcgacctcttccaaaaaact 26566
>emb|AJ627582.1| Streptomyces somaliensis pld gene for phospholipase D precursor Length = 1836 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 330 cgacggcatcacgccgaacgtcgc 353 |||||||||||||| ||||||||| Sbjct: 712 cgacggcatcacgctgaacgtcgc 735
>ref|NM_142605.2| Drosophila melanogaster CG4936-RA (CG4936), mRNA Length = 1828 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 435 tgatgggcactccgccgcac 454 |||||||||||||||||||| Sbjct: 295 tgatgggcactccgccgcac 276
>gb|AC096952.5| Homo sapiens BAC clone RP11-191J2 from 4, complete sequence Length = 187578 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 254 ttctccctccactcgtgtgc 273 |||||||||||||||||||| Sbjct: 35850 ttctccctccactcgtgtgc 35869
>gb|AC104037.3| Homo sapiens chromosome 8, clone RP11-692P18, complete sequence Length = 152267 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 ttcatactaatttatttgat 25 |||||||||||||||||||| Sbjct: 117315 ttcatactaatttatttgat 117296
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 457 gctttccaatgccgagttcc 476 |||||||||||||||||||| Sbjct: 147430 gctttccaatgccgagttcc 147449
>gb|AC114648.25| Mus musculus chromosome 8, clone RP24-144H17, complete sequence Length = 171191 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 actaatttatttgattgtat 30 |||||||||||||||||||| Sbjct: 90836 actaatttatttgattgtat 90855
>gb|AC104005.3| Homo sapiens chromosome 8, clone RP11-158M23, complete sequence Length = 185231 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 ttcatactaatttatttgat 25 |||||||||||||||||||| Sbjct: 135078 ttcatactaatttatttgat 135097
>dbj|AK162095.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length enriched library, clone:7420409D11 product:BTB and CNC homology 2, full insert sequence Length = 1688 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 418 gaagaatggccagctgatga 437 |||||||||||||||||||| Sbjct: 1134 gaagaatggccagctgatga 1153
>gb|AY061100.1| Drosophila melanogaster LD08906 full length cDNA Length = 1887 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 435 tgatgggcactccgccgcac 454 |||||||||||||||||||| Sbjct: 295 tgatgggcactccgccgcac 276
>dbj|AK064085.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-100-B11, full insert sequence Length = 1505 Score = 40.1 bits (20), Expect = 6.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 400 gttggtctgctggtccgcgaagaatggccagc 431 |||||||||||| || |||||||| ||||||| Sbjct: 137 gttggtctgctgctcggcgaagaagggccagc 168
>emb|AL831746.5| Mouse DNA sequence from clone RP23-67O11 on chromosome 4, complete sequence Length = 239570 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 418 gaagaatggccagctgatga 437 |||||||||||||||||||| Sbjct: 129882 gaagaatggccagctgatga 129901
>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome Length = 4303871 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 286 caccttgccattttccccct 305 |||||||||||||||||||| Sbjct: 1189006 caccttgccattttccccct 1188987
>gb|AC026911.15| Mus musculus chromosome 1, clone RP23-190F21, complete sequence Length = 239743 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 ctaatttatttgattgtatt 31 |||||||||||||||||||| Sbjct: 177696 ctaatttatttgattgtatt 177715 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,862,327 Number of Sequences: 3902068 Number of extensions: 3862327 Number of successful extensions: 83373 Number of sequences better than 10.0: 77 Number of HSP's better than 10.0 without gapping: 80 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 82952 Number of HSP's gapped (non-prelim): 409 length of query: 480 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 458 effective length of database: 17,147,199,772 effective search space: 7853417495576 effective search space used: 7853417495576 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
