>gb|AE013066.1| Thermoanaerobacter tengcongensis MB4, section 93 of 244 of the
            complete genome
          Length = 10816

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 20   ctcccatatatggaccaaataat 42
            |||||||||||| ||||||||||
Sbjct: 7578 ctcccatatatgaaccaaataat 7600

>dbj|AK113079.1| Ciona intestinalis cDNA, clone:ciad005a18, full insert sequence
          Length = 2703

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 29  atggaccaaataattgagt 47
           |||||||||||||||||||
Sbjct: 650 atggaccaaataattgagt 668

>emb|CT010433.6| Mouse DNA sequence from clone RP23-239M23 on chromosome 17, complete
              sequence
          Length = 154367

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 29     atggaccaaataattgag 46
              ||||||||||||||||||
Sbjct: 102716 atggaccaaataattgag 102699

>gb|AC126942.4| Mus musculus BAC clone RP23-174P9 from chromosome 17, complete sequence
          Length = 182423

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 12     tcaggaacctcccatatatgga 33
              |||||||||||||| |||||||
Sbjct: 120569 tcaggaacctcccacatatgga 120548

>dbj|AK033993.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330136K24
           product:unclassifiable, full insert sequence
          Length = 2479

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 29  atggaccaaataattgag 46
           ||||||||||||||||||
Sbjct: 620 atggaccaaataattgag 637

>ref|XM_223116.3| PREDICTED: Rattus norvegicus similar to 6820428L09 protein
            (predicted) (LOC305101), mRNA
          Length = 5220

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 14   aggaacctcccatatatg 31
            ||||||||||||||||||
Sbjct: 4958 aggaacctcccatatatg 4975

>gb|AF289667.1|AF289667 Mus musculus GTF2IRD1 and CYLN2 genes, complete cds
          Length = 201605

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     cttcaggaacctcccata 27
              ||||||||||||||||||
Sbjct: 131770 cttcaggaacctcccata 131787

>gb|AF289664.1|AF289664 Mus musculus CYLN2, RFC2, WBSCR15, and EIF4H genes, complete cds
          Length = 161852

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 10   cttcaggaacctcccata 27
            ||||||||||||||||||
Sbjct: 7285 cttcaggaacctcccata 7302

>gb|AC166938.5| Mus musculus BAC clone RP23-85H24 from chromosome 5, complete sequence
          Length = 231866

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     cttcaggaacctcccata 27
              ||||||||||||||||||
Sbjct: 220825 cttcaggaacctcccata 220808

>gb|AC167419.4| Mus musculus BAC clone RP24-359H20 from chromosome 5, complete sequence
          Length = 179790

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     cttcaggaacctcccata 27
              ||||||||||||||||||
Sbjct: 172614 cttcaggaacctcccata 172631


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 255,412
Number of Sequences: 3902068
Number of extensions: 255412
Number of successful extensions: 62750
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62738
Number of HSP's gapped (non-prelim): 12
length of query: 53
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 33
effective length of database: 17,155,003,908
effective search space: 566115128964
effective search space used: 566115128964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)