Clone Name | rbart21g09 |
---|---|
Clone Library Name | barley_pub |
>ref|NM_190072.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1260 Score = 99.6 bits (50), Expect = 8e-18 Identities = 110/130 (84%) Strand = Plus / Minus Query: 76 gtcttggtgaaattgaagtggccgcactgggtgaagaagggcagcctgacgaacccgagc 135 ||||||||||||||||||| | |||| ||| |||| |||||||| ||||||||||| Sbjct: 1253 gtcttggtgaaattgaagttactgcacgacgtgtagaacggcagcctcgcgaacccgagc 1194 Query: 136 cgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccctccgatgagc 195 |||||||| || |||||||| ||||| |||||||||||||||||||||||| || | Sbjct: 1193 cgcttcttctccgagtcgaactgcagcaacatgttctccatctggaaccctccgaggatc 1134 Query: 196 accgccggcg 205 |||||||||| Sbjct: 1133 accgccggcg 1124 Score = 58.0 bits (29), Expect = 3e-05 Identities = 53/61 (86%) Strand = Plus / Minus Query: 305 agttcttgccgccgccgagcgtcagcgtcacgcccggcaccaggtagccgatccgcgtgt 364 ||||||| |||||| ||||| ||||| |||| ||||||| | ||||||||||||||||| Sbjct: 1030 agttcttcccgccggcgagcatcagcctcaccgccggcacaaagtagccgatccgcgtgt 971 Query: 365 t 365 | Sbjct: 970 t 970
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 99.6 bits (50), Expect = 8e-18 Identities = 110/130 (84%) Strand = Plus / Plus Query: 76 gtcttggtgaaattgaagtggccgcactgggtgaagaagggcagcctgacgaacccgagc 135 ||||||||||||||||||| | |||| ||| |||| |||||||| ||||||||||| Sbjct: 41134511 gtcttggtgaaattgaagttactgcacgacgtgtagaacggcagcctcgcgaacccgagc 41134570 Query: 136 cgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccctccgatgagc 195 |||||||| || |||||||| ||||| |||||||||||||||||||||||| || | Sbjct: 41134571 cgcttcttctccgagtcgaactgcagcaacatgttctccatctggaaccctccgaggatc 41134630 Query: 196 accgccggcg 205 |||||||||| Sbjct: 41134631 accgccggcg 41134640 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 150 gtcgaactccagcagggtgttctccatctggaaccctccgatgagcaccgccggcg 205 ||||||| ||| |||| ||||||||||||||||||||||||||| | ||||||||| Sbjct: 41131801 gtcgaacaccaccaggttgttctccatctggaaccctccgatgatcgccgccggcg 41131856 Score = 58.0 bits (29), Expect = 3e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 305 agttcttgccgccgccgagcgtcagcgtcacgcccggcaccaggtagccgatccgcgtgt 364 ||||||| |||||| ||||| ||||| |||| ||||||| | ||||||||||||||||| Sbjct: 41134734 agttcttcccgccggcgagcatcagcctcaccgccggcacaaagtagccgatccgcgtgt 41134793 Query: 365 t 365 | Sbjct: 41134794 t 41134794 Score = 48.1 bits (24), Expect = 0.027 Identities = 51/60 (85%) Strand = Plus / Plus Query: 150 gtcgaactccagcagggtgttctccatctggaaccctccgatgagcaccgccggcgcggc 209 ||||||| ||| |||| ||| ||||||||| ||| ||||||| ||||||||||||||| Sbjct: 41118987 gtcgaacaccaccaggttgtcctccatctgatgcccgccgatgatcaccgccggcgcggc 41119046 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 23397179 attactattattattattat 23397198
>dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0504E02 Length = 137468 Score = 99.6 bits (50), Expect = 8e-18 Identities = 110/130 (84%) Strand = Plus / Plus Query: 76 gtcttggtgaaattgaagtggccgcactgggtgaagaagggcagcctgacgaacccgagc 135 ||||||||||||||||||| | |||| ||| |||| |||||||| ||||||||||| Sbjct: 31566 gtcttggtgaaattgaagttactgcacgacgtgtagaacggcagcctcgcgaacccgagc 31625 Query: 136 cgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccctccgatgagc 195 |||||||| || |||||||| ||||| |||||||||||||||||||||||| || | Sbjct: 31626 cgcttcttctccgagtcgaactgcagcaacatgttctccatctggaaccctccgaggatc 31685 Query: 196 accgccggcg 205 |||||||||| Sbjct: 31686 accgccggcg 31695 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 150 gtcgaactccagcagggtgttctccatctggaaccctccgatgagcaccgccggcg 205 ||||||| ||| |||| ||||||||||||||||||||||||||| | ||||||||| Sbjct: 28856 gtcgaacaccaccaggttgttctccatctggaaccctccgatgatcgccgccggcg 28911 Score = 58.0 bits (29), Expect = 3e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 305 agttcttgccgccgccgagcgtcagcgtcacgcccggcaccaggtagccgatccgcgtgt 364 ||||||| |||||| ||||| ||||| |||| ||||||| | ||||||||||||||||| Sbjct: 31789 agttcttcccgccggcgagcatcagcctcaccgccggcacaaagtagccgatccgcgtgt 31848 Query: 365 t 365 | Sbjct: 31849 t 31849 Score = 48.1 bits (24), Expect = 0.027 Identities = 51/60 (85%) Strand = Plus / Plus Query: 150 gtcgaactccagcagggtgttctccatctggaaccctccgatgagcaccgccggcgcggc 209 ||||||| ||| |||| ||| ||||||||| ||| ||||||| ||||||||||||||| Sbjct: 16042 gtcgaacaccaccaggttgtcctccatctgatgcccgccgatgatcaccgccggcgcggc 16101
>dbj|AK105806.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-B07, full insert sequence Length = 1404 Score = 99.6 bits (50), Expect = 8e-18 Identities = 110/130 (84%) Strand = Plus / Minus Query: 76 gtcttggtgaaattgaagtggccgcactgggtgaagaagggcagcctgacgaacccgagc 135 ||||||||||||||||||| | |||| ||| |||| |||||||| ||||||||||| Sbjct: 1265 gtcttggtgaaattgaagttactgcacgacgtgtagaacggcagcctcgcgaacccgagc 1206 Query: 136 cgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccctccgatgagc 195 |||||||| || |||||||| ||||| |||||||||||||||||||||||| || | Sbjct: 1205 cgcttcttctccgagtcgaactgcagcaacatgttctccatctggaaccctccgaggatc 1146 Query: 196 accgccggcg 205 |||||||||| Sbjct: 1145 accgccggcg 1136 Score = 58.0 bits (29), Expect = 3e-05 Identities = 53/61 (86%) Strand = Plus / Minus Query: 305 agttcttgccgccgccgagcgtcagcgtcacgcccggcaccaggtagccgatccgcgtgt 364 ||||||| |||||| ||||| ||||| |||| ||||||| | ||||||||||||||||| Sbjct: 1042 agttcttcccgccggcgagcatcagcctcaccgccggcacaaagtagccgatccgcgtgt 983 Query: 365 t 365 | Sbjct: 982 t 982
>ref|NM_190071.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1275 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Minus Query: 150 gtcgaactccagcagggtgttctccatctggaaccctccgatgagcaccgccggcg 205 ||||||| ||| |||| ||||||||||||||||||||||||||| | ||||||||| Sbjct: 1188 gtcgaacaccaccaggttgttctccatctggaaccctccgatgatcgccgccggcg 1133
>emb|AJ581529.1|HVU581529 Hordeum vulgare xi gene for xylanase inhibitor Length = 1255 Score = 71.9 bits (36), Expect = 2e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 115 ggcagcctgacgaacccgagccgcttcttggccatgtcgaactccagcagggtgttctcc 174 |||||||||| ||||||||||||||||| |||||||||| || |||| | || |||| Sbjct: 1193 ggcagcctgataaacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctcc 1134 Query: 175 atctggaaccctccgatgagcaccgccggcgc 206 |||||| |||||||| || |||||||||||| Sbjct: 1133 atctgggcccctccgaggatcaccgccggcgc 1102 Score = 48.1 bits (24), Expect = 0.027 Identities = 36/40 (90%) Strand = Plus / Minus Query: 242 cgaacgccaggcacgccgtcccgggcttgatgtccaccat 281 ||||||| | |||||||||||| ||||||| ||||||||| Sbjct: 1075 cgaacgcaacgcacgccgtccccggcttgacgtccaccat 1036 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 447 ctgcgccgtcagggccctggcgaacgcgt 475 |||||||| ||||||| |||||||||||| Sbjct: 870 ctgcgccgccagggccttggcgaacgcgt 842
>emb|AJ697851.1| Triticum aestivum xi-IB gene for xylanase inhibitor precursor, exon 1 Length = 1206 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 115 ggcagcctgacgaacccgagccgcttcttggccatgtcgaactccagcagggtgttctcc 174 |||||||||| ||||||||||||||||| |||||||||| || |||| | || |||| Sbjct: 1181 ggcagcctgagaaacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctcc 1122 Query: 175 atctggaaccctccgatgagcaccgccggcgc 206 |||||| ||||||| || |||||||||||| Sbjct: 1121 atctgggctcctccgaggatcaccgccggcgc 1090 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 362 tgttggccagcgaccgcgcgtcgtagcaccgctcgaagggcggcactggcttcacccggc 421 ||||| |||||||| || ||||||||| ||||||| |||| ||| |||||||| || Sbjct: 934 tgttgcccagcgacttcgtgtcgtagcagagctcgaacggcgccacaggcttcacggcgc 875 Query: 422 gcgccacgggc 432 ||||||||||| Sbjct: 874 gcgccacgggc 864
>emb|AJ581532.1|SCE581532 Secale cereale xi-II/III gene for xylanase inhibitor Length = 1245 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 127 aacccgagccgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccct 186 ||||||||||||||||| |||||||||| || |||| | || |||||||||| |||| Sbjct: 1159 aacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctccatctgggcccct 1100 Query: 187 ccgatgagcaccgccggcgc 206 |||| || |||||||||||| Sbjct: 1099 ccgaggatcaccgccggcgc 1080
>emb|AJ581531.1|SCE581531 Secale cereale partial xi-IV gene for xylanase inhibitor Length = 737 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 127 aacccgagccgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccct 186 ||||||||||||||||| |||||||||| || |||| | || |||||||||| |||| Sbjct: 551 aacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctccatctgggcccct 492 Query: 187 ccgatgagcaccgccggcgc 206 |||| || |||||||||||| Sbjct: 491 ccgaggatcaccgccggcgc 472 Score = 40.1 bits (20), Expect = 6.5 Identities = 35/40 (87%) Strand = Plus / Minus Query: 242 cgaacgccaggcacgccgtcccgggcttgatgtccaccat 281 ||||||| | |||||||||||| ||| ||| ||||||||| Sbjct: 436 cgaacgcaacgcacgccgtccccggcctgacgtccaccat 397
>dbj|AB178471.1| Triticum aestivum Taxi-III gene for xylanase inhibitor, complete cds, upstream region Length = 2322 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 115 ggcagcctgacgaacccgagccgcttcttggccatgtcgaactccagcagggtgttctcc 174 |||||||||| ||||||||||||||||| |||||||||| || |||| | || |||| Sbjct: 2257 ggcagcctgagaaacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctcc 2198 Query: 175 atctggaaccctccgatgagcaccgccggcgc 206 |||||| ||||||| || |||||||||||| Sbjct: 2197 atctgggctcctccgaggatcaccgccggcgc 2166 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 362 tgttggccagcgaccgcgcgtcgtagcaccgctcgaagggcggcactggcttcacccggc 421 ||||| |||||||| || ||||||||| ||||||| |||| ||| |||||||| || Sbjct: 2010 tgttgcccagcgacttcgtgtcgtagcagagctcgaacggcgccacaggcttcacggcgc 1951 Query: 422 gcgccacgggc 432 ||||||||||| Sbjct: 1950 gcgccacgggc 1940
>dbj|AB114627.1| Triticum aestivum Taxi-III mRNA for xylanase inhibitor TAXI-III, complete cds Length = 1411 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 115 ggcagcctgacgaacccgagccgcttcttggccatgtcgaactccagcagggtgttctcc 174 |||||||||| ||||||||||||||||| |||||||||| || |||| | || |||| Sbjct: 1260 ggcagcctgagaaacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctcc 1201 Query: 175 atctggaaccctccgatgagcaccgccggcgc 206 |||||| ||||||| || |||||||||||| Sbjct: 1200 atctgggctcctccgaggatcaccgccggcgc 1169 Score = 46.1 bits (23), Expect = 0.11 Identities = 59/71 (83%) Strand = Plus / Minus Query: 362 tgttggccagcgaccgcgcgtcgtagcaccgctcgaagggcggcactggcttcacccggc 421 ||||| |||||||| || ||||||||| ||||||| |||| ||| |||||||| || Sbjct: 1013 tgttgcccagcgacttcgtgtcgtagcagagctcgaacggcgccacaggcttcacggcgc 954 Query: 422 gcgccacgggc 432 ||||||||||| Sbjct: 953 gcgccacgggc 943
>dbj|AB114626.1| Triticum aestivum taxi-I mRNA for xylanase inhibitor TAXI-I, complete cds Length = 1374 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 127 aacccgagccgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccct 186 ||||||||||||||||| |||||||||| || |||| | || |||||||||| |||| Sbjct: 1227 aacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctccatctgggcccct 1168 Query: 187 ccgatgagcaccgccggcgc 206 |||| || |||||||||||| Sbjct: 1167 ccgaggatcaccgccggcgc 1148 Score = 44.1 bits (22), Expect = 0.42 Identities = 55/66 (83%) Strand = Plus / Minus Query: 242 cgaacgccaggcacgccgtcccgggcttgatgtccaccattgagctcagcccgttcatgg 301 ||||||| | |||||||||||| |||||| ||||||||| ||| || |||| |||| | Sbjct: 1112 cgaacgcaacgcacgccgtcccttgcttgacgtccaccatcgagttcttcccggtcatcg 1053 Query: 302 tccagt 307 |||||| Sbjct: 1052 tccagt 1047
>emb|AJ438880.1|TAE438880 Triticum aestivum xiI gene for xylanase inhibitor Length = 1298 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 127 aacccgagccgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccct 186 ||||||||||||||||| |||||||||| || |||| | || |||||||||| |||| Sbjct: 1219 aacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctccatctgggcccct 1160 Query: 187 ccgatgagcaccgccggcgc 206 |||| || |||||||||||| Sbjct: 1159 ccgaggatcaccgccggcgc 1140 Score = 44.1 bits (22), Expect = 0.42 Identities = 55/66 (83%) Strand = Plus / Minus Query: 242 cgaacgccaggcacgccgtcccgggcttgatgtccaccattgagctcagcccgttcatgg 301 ||||||| | |||||||||||| |||||| ||||||||| ||| || |||| |||| | Sbjct: 1104 cgaacgcaacgcacgccgtcccttgcttgacgtccaccatcgagttcttcccggtcatcg 1045 Query: 302 tccagt 307 |||||| Sbjct: 1044 tccagt 1039
>emb|AJ697850.1| Triticum aestivum partial xi-IIB gene for xylanase inhibitor precursor, exon 1 Length = 1170 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 127 aacccgagccgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccct 186 ||||||||||||||||| |||||||||| || |||| | || |||||||||| ||| Sbjct: 1112 aacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctccatctgggctcct 1053 Query: 187 ccgatgagcaccgccggcgc 206 |||| || |||||||||||| Sbjct: 1052 ccgaggatcaccgccggcgc 1033 Score = 46.1 bits (23), Expect = 0.11 Identities = 83/103 (80%) Strand = Plus / Minus Query: 381 gtcgtagcaccgctcgaagggcggcactggcttcacccggcgcgccacgggcccgccctg 440 ||||||||| ||||||| |||| ||| |||||||| ||||||||||||| | || | Sbjct: 858 gtcgtagcagagctcgaacggcgccacaggcttcacggcgcgcgccacgggcgctccgtt 799 Query: 441 cgctccctgcgccgtcagggccctggcgaacgcgtacacgaac 483 || |||||||| ||||||| ||| |||||||| ||||||| Sbjct: 798 ggcaggctgcgccgccagggccttggtgaacgcgtccacgaac 756
>emb|AJ697849.1| Triticum aestivum partial xi-IIA gene for xylanase inhibitor precursor, exon 1 Length = 1170 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 115 ggcagcctgacgaacccgagccgcttcttggccatgtcgaactccagcagggtgttctcc 174 |||||||||| ||||||||||||||||| |||||||||| || |||| | || |||| Sbjct: 1124 ggcagcctgagaaacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctcc 1065 Query: 175 atctggaaccctccgatgagcaccgccggcgc 206 |||||| ||||| | || |||||||||||| Sbjct: 1064 atctgggctcctcccaggatcaccgccggcgc 1033 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 242 cgaacgccaggcacgccgtcccgggcttgatgtccaccattgag 285 ||||||| | |||||||||||| ||||||| ||||||||||||| Sbjct: 997 cgaacgcaacgcacgccgtccccggcttgacgtccaccattgag 954
>gb|BT009260.1| Triticum aestivum clone wlk4.pk0017.d2:fis, full insert mRNA sequence Length = 1343 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 242 cgaacgccaggcacgccgtcccgggcttgatgtccaccattgag 285 ||||||| | |||||||||||| ||||||| ||||||||||||| Sbjct: 291 cgaacgcaacgcacgccgtccccggcttgacgtccaccattgag 334 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 115 ggcagcctgacgaacccgagccgcttcttggccatgtcgaactccagcagggtgttctcc 174 |||||||||| ||||||||||||||||| |||||||||| || |||| | || |||| Sbjct: 164 ggcagcctgagaaacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctcc 223 Query: 175 atctgg 180 |||||| Sbjct: 224 atctgg 229
>emb|AJ581530.1|SCE581530 Secale cereale partial xi-I gene for xylanase inhibitor Length = 578 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 127 aacccgagccgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccct 186 ||||||||||||||||| |||||||||| || |||| | || ||||||||| |||| Sbjct: 551 aacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctccatctgtgcccct 492 Query: 187 ccgatgagcaccgccggcgc 206 |||| || |||||||||||| Sbjct: 491 ccgaggatcaccgccggcgc 472
>dbj|AB114628.1| Triticum aestivum Taxi-IV mRNA for xylanase inhibitor TAXI-IV, complete cds Length = 1387 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 127 aacccgagccgcttcttggccatgtcgaactccagcagggtgttctccatctggaaccct 186 ||||||||||||||||| |||||||||| || |||| | || |||||||||| ||| Sbjct: 1220 aacccgagccgcttcttctccatgtcgaagtcgagcacgaagtcctccatctgggctcct 1161 Query: 187 ccgatgagcaccgccggcgc 206 |||| || |||||||||||| Sbjct: 1160 ccgaggatcaccgccggcgc 1141 Score = 46.1 bits (23), Expect = 0.11 Identities = 83/103 (80%) Strand = Plus / Minus Query: 381 gtcgtagcaccgctcgaagggcggcactggcttcacccggcgcgccacgggcccgccctg 440 ||||||||| ||||||| |||| ||| |||||||| ||||||||||||| | || | Sbjct: 966 gtcgtagcagagctcgaacggcgccacaggcttcacggcgcgcgccacgggcgctccgtt 907 Query: 441 cgctccctgcgccgtcagggccctggcgaacgcgtacacgaac 483 || |||||||| ||||||| ||| |||||||| ||||||| Sbjct: 906 ggcaggctgcgccgccagggccttggtgaacgcgtccacgaac 864
>ref|XM_640667.1| Dictyostelium discoideum hypothetical protein (DDB0202749), partial mRNA Length = 216 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 12 atattgattactattattattatta 36 ||||||||||||||||||||||||| Sbjct: 141 atattgattactattattattatta 117
>gb|DQ219479.1| wheat putative xylanase inhibitor mRNA, partial cds Length = 347 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 167 tgttctccatctggaaccctccgat 191 ||||||||||||||||||||||||| Sbjct: 201 tgttctccatctggaaccctccgat 177
>ref|XM_630267.1| Dictyostelium discoideum hypothetical protein (DDB0189261), partial mRNA Length = 2817 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 attgattactattattattattat 37 |||||||||||||||||||||||| Sbjct: 1363 attgattactattattattattat 1340
>ref|XM_630367.1| Dictyostelium discoideum hypothetical protein (DDB0219636), partial mRNA Length = 6120 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 14 attgattactattattattattat 37 |||||||||||||||||||||||| Sbjct: 5446 attgattactattattattattat 5423
>ref|NM_190067.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1305 Score = 48.1 bits (24), Expect = 0.027 Identities = 51/60 (85%) Strand = Plus / Minus Query: 150 gtcgaactccagcagggtgttctccatctggaaccctccgatgagcaccgccggcgcggc 209 ||||||| ||| |||| ||| ||||||||| ||| ||||||| ||||||||||||||| Sbjct: 1197 gtcgaacaccaccaggttgtcctccatctgatgcccgccgatgatcaccgccggcgcggc 1138
>emb|BX936293.11| Platypus DNA sequence from clone XX-516O5, complete sequence Length = 178175 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 14 attgattactattattattattat 37 |||||||||||||||||||||||| Sbjct: 50672 attgattactattattattattat 50695
>emb|AL035477.6|PFMAL4P4 Plasmodium falciparum MAL4P4 Length = 272698 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Minus Query: 10 acatattgattactattattattattat 37 |||||||||||| ||||||||||||||| Sbjct: 3238 acatattgattattattattattattat 3211 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 109155 attactattattattattat 109136 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 108336 attactattattattattat 108317 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 85630 attactattattattattat 85649
>gb|AY791967.1| Macrobrachium rosenbergii clone Mr-70 microsatellite sequence Length = 239 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 10 acatattgattactattattattattat 37 |||||||||||| ||||||||||||||| Sbjct: 44 acatattgattattattattattattat 71
>dbj|AK073591.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033051M04, full insert sequence Length = 1520 Score = 48.1 bits (24), Expect = 0.027 Identities = 51/60 (85%) Strand = Plus / Minus Query: 150 gtcgaactccagcagggtgttctccatctggaaccctccgatgagcaccgccggcgcggc 209 ||||||| ||| |||| ||| ||||||||| ||| ||||||| ||||||||||||||| Sbjct: 1211 gtcgaacaccaccaggttgtcctccatctgatgcccgccgatgatcaccgccggcgcggc 1152
>ref|XM_632615.1| Dictyostelium discoideum hypothetical protein (DDB0186929), partial mRNA Length = 2865 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ttgattactattattattattat 37 ||||||||||||||||||||||| Sbjct: 2592 ttgattactattattattattat 2570
>ref|XM_632583.1| Dictyostelium discoideum hypothetical protein (DDB0218841), partial mRNA Length = 13779 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattatc 38 |||||||||| |||||||||||||||| Sbjct: 11688 atattgattattattattattattatc 11662
>ref|XM_634213.1| Dictyostelium discoideum histidine kinase (DDB0191389), partial mRNA Length = 5130 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattatc 38 ||||||||||||||||||||||| Sbjct: 1499 tgattactattattattattatc 1477
>ref|XM_630098.1| Dictyostelium discoideum hypothetical protein (DDB0183872), partial mRNA Length = 12408 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ttgattactattattattattat 37 ||||||||||||||||||||||| Sbjct: 4815 ttgattactattattattattat 4793
>gb|AY812545.1| Schistosoma japonicum SJCHGC08268 protein mRNA, partial cds Length = 689 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattatc 38 |||||||||| |||||||||||||||| Sbjct: 650 atattgattattattattattattatc 624
>gb|AE014817.1| Plasmodium falciparum 3D7 chromosome 14 section 2 of 13 of the complete sequence Length = 254449 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 11 catattgattactattattattattat 37 ||||||||||| ||||||||||||||| Sbjct: 75849 catattgattattattattattattat 75875 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Plus Query: 9 aacatattgattactattattattattatc 38 |||||||| |||| |||||||||||||||| Sbjct: 26603 aacatatttattattattattattattatc 26632 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 86881 attactattattattattat 86900
>emb|CR628389.9| Zebrafish DNA sequence from clone DKEYP-81A1 in linkage group 21, complete sequence Length = 197111 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ttgattactattattattattat 37 ||||||||||||||||||||||| Sbjct: 168249 ttgattactattattattattat 168227 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 167829 attactattattattattatc 167809
>emb|CR932801.1| Mus musculus chromosome 2, clone RPCI-21-331C08 strain 129/Sv, complete sequence Length = 107646 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 18 attactattattattattatcca 40 ||||||||||||||||||||||| Sbjct: 8390 attactattattattattatcca 8412
>emb|CR932799.1| Mus musculus chromosome 2, clone RPCI-22-207E02 strain 129/Sv, complete sequence Length = 151675 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 18 attactattattattattatcca 40 ||||||||||||||||||||||| Sbjct: 134693 attactattattattattatcca 134715
>emb|CR932797.1| Mus musculus chromosome 2, clone RPCI-22-255I01 and RPCI-22-91F12 strain 129/Sv, complete sequence Length = 122877 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 18 attactattattattattatcca 40 ||||||||||||||||||||||| Sbjct: 43696 attactattattattattatcca 43718
>emb|AL772279.7| Zebrafish DNA sequence from clone CH211-191N13 in linkage group 7 Contains a putative novel gene, a novel retrotransposon and eight CpG islands, complete sequence Length = 146786 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ttgattactattattattattat 37 ||||||||||||||||||||||| Sbjct: 65717 ttgattactattattattattat 65739 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 84674 attactattattattattat 84693
>emb|AL845351.6| Zebrafish DNA sequence from clone DKEYP-44A9 in linkage group 20, complete sequence Length = 160701 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 ttgattactattattattattat 37 ||||||||||||||||||||||| Sbjct: 138963 ttgattactattattattattat 138941
>gb|AC084880.12| Homo sapiens 12 BAC RP11-64B16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 110001 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 18 attactattattattattatcca 40 ||||||||||||||||||||||| Sbjct: 16868 attactattattattattatcca 16846 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 37632 attactattattattattat 37613
>gb|AF362373.2| Dictyostelium discoideum histidine kinase DhkL (dhkL) gene, complete cds Length = 5729 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattatc 38 ||||||||||||||||||||||| Sbjct: 1583 tgattactattattattattatc 1561
>gb|AC051663.9|AC051663 Homo sapiens BAC clone RP11-475P15 from Y, complete sequence Length = 94414 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 ttgattactattattattattat 37 ||||||||||||||||||||||| Sbjct: 35050 ttgattactattattattattat 35072
>emb|BX571892.9| Mouse DNA sequence from clone RP23-207B21 on chromosome 2, complete sequence Length = 170046 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 18 attactattattattattatcca 40 ||||||||||||||||||||||| Sbjct: 165010 attactattattattattatcca 165032
>dbj|AK111477.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-185-A02, full insert sequence Length = 1075 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 167 tgttctccatctggaaccctccgatga 193 |||||||||||||||| |||||||||| Sbjct: 184 tgttctccatctggaaacctccgatga 210
>emb|BX649327.17| Zebrafish DNA sequence from clone CH211-197G15 in linkage group 22, complete sequence Length = 206348 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattatc 38 ||||||||||||||||||||||| Sbjct: 86598 tgattactattattattattatc 86620
>dbj|AK063356.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-C06, full insert sequence Length = 1372 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 167 tgttctccatctggaaccctccgatga 193 |||||||||||||||| |||||||||| Sbjct: 1218 tgttctccatctggaaacctccgatga 1192
>gb|M97348.1|RABH19MYOH Oryctolagus cuniculus H19/myoH mRNA sequence Length = 1842 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 433 ccgccctgcgctccctgcgccgt 455 ||||||||||||||||||||||| Sbjct: 380 ccgccctgcgctccctgcgccgt 358
>ref|XM_633408.1| Dictyostelium discoideum hypothetical protein (DDB0186081), partial mRNA Length = 993 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 384 atattgattattattattattattat 359
>ref|XM_633309.1| Dictyostelium discoideum hypothetical protein (DDB0186189), partial mRNA Length = 1680 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1118 tgattactattattattattat 1097
>ref|XM_632053.1| Dictyostelium discoideum hypothetical protein (DDB0220512), partial mRNA Length = 1788 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 ttgattactattattattatta 36 |||||||||||||||||||||| Sbjct: 1668 ttgattactattattattatta 1647
>ref|XM_641932.1| Dictyostelium discoideum hypothetical protein (DDB0202359), partial mRNA Length = 1482 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1076 tgattactattattattattat 1055
>ref|XM_641894.1| Dictyostelium discoideum hypothetical protein (DDB0190057), partial mRNA Length = 2880 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||| ||||||||||||||||| Sbjct: 924 atattgatcactattattattattat 899
>ref|XM_641464.1| Dictyostelium discoideum hypothetical protein (DDB0191425), partial mRNA Length = 4107 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||||||| |||||||||||||||| Sbjct: 2637 atattgattgctattattattattat 2612 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 696 attactattattattattat 677
>ref|XM_640791.1| Dictyostelium discoideum hypothetical protein (DDB0190182), partial mRNA Length = 1845 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 417 atattgattattattattattattat 392
>ref|XM_640659.1| Dictyostelium discoideum hypothetical protein (DDB0216824), partial mRNA Length = 2118 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||||||||| ||||||||| Sbjct: 153 atattgattactattagtattattat 128
>ref|XM_640635.1| Dictyostelium discoideum hypothetical protein (DDB0202782), partial mRNA Length = 1923 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||||||||||| |||||||||||| Sbjct: 168 atattgattactagtattattattat 143
>ref|XM_640634.1| Dictyostelium discoideum hypothetical protein (DDB0216813), partial mRNA Length = 1929 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||||||||||| |||||||||||| Sbjct: 147 atattgattactagtattattattat 122
>ref|XM_638728.1| Dictyostelium discoideum PI3kinase (DDB0185203), partial mRNA Length = 5094 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 18 attactattattattattatcc 39 |||||||||||||||||||||| Sbjct: 5058 attactattattattattatcc 5037 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 1080 attactattattattattat 1061
>ref|XM_637513.1| Dictyostelium discoideum development protein (DDB0220029), partial mRNA Length = 2142 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1544 tgattactattattattattat 1523
>ref|XM_637073.1| Dictyostelium discoideum hypothetical protein (DDB0218063), partial mRNA Length = 1941 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1331 tgattactattattattattat 1310
>ref|XM_635347.1| Dictyostelium discoideum hypothetical protein (DDB0205122), partial mRNA Length = 5256 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 2558 tgattactattattattattat 2537
>ref|XM_634808.1| Dictyostelium discoideum hypothetical protein (DDB0186229), partial mRNA Length = 3186 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 314 tgattactattattattattat 293 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 294 attactattattattattat 275
>ref|XM_629173.1| Dictyostelium discoideum hypothetical protein (DDB0191890), partial mRNA Length = 3084 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 18 attactattattattattatccaaag 43 |||| ||||||||||||||||||||| Sbjct: 2697 attattattattattattatccaaag 2672 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 1896 attactattattattattat 1877
>gb|AC104272.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete sequence Length = 143130 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 122403 tgattactattattattattat 122382
>gb|AE014827.1| Plasmodium falciparum 3D7 chromosome 14 section 12 of 13 of the complete sequence Length = 254436 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 10 acatattgattactattattattatt 35 ||||||| |||||||||||||||||| Sbjct: 173825 acatatttattactattattattatt 173850 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 9 aacatattgattactattattattattat 37 |||||||| |||| ||||||||||||||| Sbjct: 231561 aacatatttattattattattattattat 231533 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 203093 attactattattattattat 203074 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 27404 attactattattattattat 27423
>gb|AC163331.8| Mus musculus chromosome 5, clone RP23-50G20, complete sequence Length = 257982 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 12356 tgattactattattattattat 12377
>gb|AE014852.2| Plasmodium falciparum 3D7 chromosome 12, section 9 of 9 of the complete sequence Length = 260929 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||| |||||||||||||||||||| Sbjct: 93446 atatttattactattattattattat 93421 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 tattattattattatccaaa 42 |||||||||||||||||||| Sbjct: 167595 tattattattattatccaaa 167576 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 14581 attactattattattattat 14600
>gb|U23181.2| Caenorhabditis elegans cosmid ZK84, complete sequence Length = 26759 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 13462 tgattactattattattattat 13483
>gb|AC111058.10| Mus musculus chromosome 7, clone RP24-562C11, complete sequence Length = 211691 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 10 acatattgattactattattattatt 35 ||||||| |||||||||||||||||| Sbjct: 163286 acatatttattactattattattatt 163261
>gb|AC185978.2| Pan troglodytes BAC clone CH251-508B17 from chromosome 4, complete sequence Length = 198914 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||| |||||||||||||||||||| Sbjct: 17802 atatttattactattattattattat 17777
>gb|AY808831.1| Schistosoma japonicum SJCHGC06375 protein mRNA, partial cds Length = 649 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 450 tgattactattattattattat 429
>ref|XM_715699.1| Candida albicans SC5314 hypothetical protein (CaO19_13816), mRNA Length = 870 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 432 atattgattattattattattattat 407
>gb|AC136999.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009L15, complete sequence Length = 137570 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 40954 tgattactattattattattat 40933
>gb|AC127303.3| Mus musculus BAC clone RP23-280E20 from chromosome X, complete sequence Length = 212318 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 183633 tgattactattattattattat 183612
>gb|AC117081.2| Dictyostelium discoideum chromosome 2 map 5862124-6045772 strain AX4, complete sequence Length = 183648 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 27813 tgattactattattattattat 27792 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 180210 attactattattattattat 180191 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 180135 attactattattattattat 180116 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 180096 attactattattattattat 180077 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 attgattactattattatta 33 |||||||||||||||||||| Sbjct: 86362 attgattactattattatta 86381 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 85190 attactattattattattat 85209 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 49522 attactattattattattat 49541 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 45752 attactattattattattat 45771 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 34065 attactattattattattat 34046 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 9277 attactattattattattat 9258 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 2675 attactattattattattat 2656
>gb|AC146247.3| Pan troglodytes BAC clone RP43-27N23 from 7, complete sequence Length = 157530 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 104457 tgattactattattattattat 104478
>gb|AY319528.1| Mimulus guttatus isolate BCR4 cycloidea-like protein A (CYCA) gene, partial cds Length = 565 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 18 attactattattattattatccaaag 43 |||||||||||||||||||| ||||| Sbjct: 307 attactattattattattattcaaag 282
>emb|CR790378.10| Zebrafish DNA sequence from clone DKEY-112E17 in linkage group 5, complete sequence Length = 160791 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 138598 tgattactattattattattat 138619 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 67644 attactattattattattat 67663
>ref|XM_883776.1| Candida albicans SC5314 hypothetical protein (CaJ7.0293) partial mRNA Length = 792 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 363 atattgattattattattattattat 338
>emb|CR954193.3| Medicago truncatula chromosome 5 clone mth2-27a1, COMPLETE SEQUENCE Length = 127717 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 86294 atattgattattattattattattat 86269 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 54077 attactattattattattat 54058 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 54059 attactattattattattat 54040 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 54041 attactattattattattat 54022
>ref|XM_716208.1| Candida albicans SC5314 hypothetical protein (CaO19.6458) partial mRNA Length = 792 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 363 atattgattattattattattattat 338
>gb|AC146786.1| Pan troglodytes BAC clone RP43-34C4 from UL, complete sequence Length = 167484 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 14 attgattactattattattatt 35 |||||||||||||||||||||| Sbjct: 149396 attgattactattattattatt 149417
>ref|XM_722050.1| Plasmodium yoelii yoelii str. 17XNL ATPase class II type 9A (PY06483) partial mRNA Length = 4272 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 936 atattgattattattattattattat 911
>gb|AC096562.1| Homo sapiens BAC clone RP11-261E4 from 7, complete sequence Length = 138224 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 101935 tgattactattattattattat 101956
>gb|AC158113.7| Mus musculus chromosome 7, clone RP23-227N6, complete sequence Length = 159400 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 10 acatattgattactattattattatt 35 ||||||| |||||||||||||||||| Sbjct: 90202 acatatttattactattattattatt 90227
>gb|AC149304.11| Medicago truncatula clone mth2-76g4, complete sequence Length = 114831 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 92546 atattgattattattattattattat 92571
>emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitochondrial genome Length = 85779 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 12979 atattgattattattattattattat 12954
>emb|CR450692.5| Zebrafish DNA sequence from clone CH211-198J13 in linkage group 2, complete sequence Length = 180976 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 126707 tgattactattattattattat 126728
>emb|CR391937.10| Zebrafish DNA sequence from clone CH211-175G6 in linkage group 16, complete sequence Length = 224481 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 145358 tgattactattattattattat 145337
>emb|AL606477.11| Human DNA sequence from clone RP11-190H11 on chromosome 1 Contains the 5' end of the gene for HP1-BP74, the 3' end of the EIF4G3 gene for eukaryotic translation initiation factor 4 gamma, 3 and three CpG islands, complete sequence Length = 139961 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 2298 tgattactattattattattat 2319
>emb|AL365273.25| Human DNA sequence from clone RP11-429G19 on chromosome 10 Contains the 3' end of the ENTPD1 gene for ectonucleoside triphosphate diphosphohydrolase 1, a novel gene, the 3' end of two novel genes (FLJ34077, FLJ39150), complete sequence Length = 191942 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 166451 tgattactattattattattat 166430
>gb|AE014837.1| Plasmodium falciparum 3D7 chromosome 11 section 2 of 8 of the complete sequence Length = 257757 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 52510 tgattactattattattattat 52531 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 79928 attactattattattattat 79947 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 50247 attactattattattattat 50266
>emb|CR450789.9| Zebrafish DNA sequence from clone DKEY-7P12 in linkage group 8, complete sequence Length = 144569 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 129608 tgattactattattattattat 129629
>emb|CR376771.10| Zebrafish DNA sequence from clone DKEY-160I7 in linkage group 1, complete sequence Length = 178445 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 105306 tgattactattattattattat 105285
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence Length = 2331000 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 gaacatattgattactattatt 29 |||||||||||||||||||||| Sbjct: 1061388 gaacatattgattactattatt 1061409
>emb|X14910.1|MISCOXI3 Yeast mitochondrial oxi3 gene exon 1 for cytochrome c oxidase subunit I Length = 1181 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 169 atattgattattattattattattat 144
>emb|AL031745.8|PFMAL1P2 Plasmodium falciparum DNA from MAL1P2 Length = 384550 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||| |||||||||||||||||||| Sbjct: 381340 atattcattactattattattattat 381315 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 383533 attactattattattattat 383514 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 371897 attactattattattattat 371878 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 273336 attactattattattattat 273317 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 79946 attactattattattattat 79965 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 49424 attactattattattattat 49443
>emb|CR339061.13| Zebrafish DNA sequence from clone CH211-235P24 in linkage group 7, complete sequence Length = 111333 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 108567 atattgattattattattattattat 108592
>emb|CR382342.5| Zebrafish DNA sequence from clone DKEY-208E17 in linkage group 14, complete sequence Length = 67870 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||| |||||||||||||||||||| Sbjct: 21174 atattaattactattattattattat 21149
>emb|BX927100.9| Zebrafish DNA sequence from clone CH211-108G16 in linkage group 1, complete sequence Length = 67582 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 56896 tgattactattattattattat 56875
>emb|BX323820.4| Zebrafish DNA sequence from clone CH211-251K4 in linkage group 4 Contains the gene for a novel protein similar to vertebrate calcium channel voltage-dependent alpha 2/delta subunit 1 (CACNA2D1) and a CpG island, complete sequence Length = 172228 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 46050 tgattactattattattattat 46029
>emb|BX322643.8| Zebrafish DNA sequence from clone CH211-281E1 in linkage group 21, complete sequence Length = 153972 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 71295 atattgattattattattattattat 71270
>emb|BX510348.6| Zebrafish DNA sequence from clone CH211-157E20 in linkage group 6, complete sequence Length = 169275 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 11881 atattgattattattattattattat 11906 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 130643 attactattattattattat 130624
>emb|BX511108.6| Zebrafish DNA sequence from clone DKEY-18F15 in linkage group 11, complete sequence Length = 139640 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 130804 tgattactattattattattat 130825
>gb|AF429353.1| Equine infectious anemia virus strain 599D-C1 glycoprotein gp90 gene, partial cds Length = 1295 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1076 tgattactattattattattat 1055
>gb|AF429352.1| Equine infectious anemia virus strain 599D-C10 glycoprotein gp90 gene, partial cds Length = 1293 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1076 tgattactattattattattat 1055
>gb|AF429351.1| Equine infectious anemia virus strain 599D-C2 glycoprotein gp90 gene, partial cds Length = 1295 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1076 tgattactattattattattat 1055
>gb|AF429350.1| Equine infectious anemia virus strain 599D-C3 glycoprotein gp90 gene, partial cds Length = 1296 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1079 tgattactattattattattat 1058
>gb|AF429349.1| Equine infectious anemia virus strain 599D-C5 glycoprotein gp90 gene, partial cds Length = 1296 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1079 tgattactattattattattat 1058
>gb|AF429348.1| Equine infectious anemia virus strain 599D-C6 glycoprotein gp90 gene, partial cds Length = 1296 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1079 tgattactattattattattat 1058
>gb|AF429347.1| Equine infectious anemia virus strain 599D-C7 glycoprotein gp90 gene, partial cds Length = 1296 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1079 tgattactattattattattat 1058
>gb|AF429346.1| Equine infectious anemia virus strain 599D-C8 glycoprotein gp90 gene, partial cds Length = 1296 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1079 tgattactattattattattat 1058
>gb|AF429345.1| Equine infectious anemia virus strain 599D-C9 glycoprotein gp90 gene, partial cds Length = 1296 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1079 tgattactattattattattat 1058
>gb|AF429325.1| Equine infectious anemia virus strain 672-C1 glycoprotein gp90 gene, partial cds Length = 1293 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1076 tgattactattattattattat 1055
>gb|AF429321.1| Equine infectious anemia virus strain 672P-C4 glycoprotein gp90 gene, partial cds Length = 1293 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 1076 tgattactattattattattat 1055
>gb|AY191013.1| Dictyostelium discoideum autophagy protein 6 (apg6) gene, complete cds Length = 4348 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||||||| |||||||||||||||| Sbjct: 2878 atattgattgctattattattattat 2853 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 696 attactattattattattat 677
>gb|AC026884.7| Homo sapiens chromosome 10 clone RP11-123G9, complete sequence Length = 142093 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 18 attactattattattattatcc 39 |||||||||||||||||||||| Sbjct: 107878 attactattattattattatcc 107899
>gb|AC093840.4| Homo sapiens BAC clone RP11-433O3 from 4, complete sequence Length = 173814 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 14 attgattactattattattatt 35 |||||||||||||||||||||| Sbjct: 143743 attgattactattattattatt 143722
>gb|L36896.1|YSCMTCG12 Saccharomyces cerevisiae mitochondrion origin of replication (ori8) Length = 1497 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 844 atattgattattattattattattat 819
>gb|AC079037.3| Oryza sativa chromosome 10 clone OSJNBa0023I19, complete sequence Length = 157450 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 gaacatattgattactattatt 29 |||||||||||||||||||||| Sbjct: 58841 gaacatattgattactattatt 58862
>emb|BX842696.13| Zebrafish DNA sequence from clone DKEY-165P1 in linkage group 13, complete sequence Length = 216185 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 atattgattactattattattattat 37 ||||| |||||||||||||||||||| Sbjct: 16784 atattaattactattattattattat 16809
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 314 cgccgccgagcgtcagcgtcac 335 |||||||||||||||||||||| Sbjct: 3042156 cgccgccgagcgtcagcgtcac 3042177 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 187 ccgatgagcaccgccggcgcggcg 210 ||||| |||||||||||||||||| Sbjct: 1808247 ccgatcagcaccgccggcgcggcg 1808224
>gb|AF298748.1|AF298748 Equine infectious anemia virus isolate 567V/C4 envelope protein gp90 (env) gene, partial cds Length = 834 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 751 tgattactattattattattat 730
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 gaacatattgattactattatt 29 |||||||||||||||||||||| Sbjct: 1061388 gaacatattgattactattatt 1061409
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 16909917 tgattactattattattattat 16909896 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 150 gtcgaactccagcagggtgttctccatc 177 |||||||||||||||| ||| ||||||| Sbjct: 19495871 gtcgaactccagcaggttgtcctccatc 19495844 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 17677044 attactattattattattat 17677063 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 16755433 attactattattattattat 16755452 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 16249189 attactattattattattat 16249208 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 13294980 attactattattattattat 13294961
>emb|BX005098.11| Zebrafish DNA sequence from clone DKEY-211F22 in linkage group 7, complete sequence Length = 100658 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 67497 tgattactattattattattat 67518
>gb|AC116305.2| Dictyostelium discoideum chromosome 2 map 1005175-1418323 strain AX4, complete sequence Length = 413138 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 18 attactattattattattatcc 39 |||||||||||||||||||||| Sbjct: 132038 attactattattattattatcc 132059 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 329528 attactattattattattatc 329508 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 393059 attactattattattattat 393078 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 390614 attactattattattattat 390633 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 14 attgattactattattattattat 37 |||||||| ||||||||||||||| Sbjct: 330024 attgattattattattattattat 330001 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 280289 attactattattattattat 280270 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 224404 attactattattattattat 224423 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 222438 attactattattattattat 222457 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 217512 attactattattattattat 217531 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 194470 attactattattattattat 194489 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 180439 attactattattattattat 180458 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 136108 attactattattattattat 136127 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 129576 attactattattattattat 129557 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 125227 attactattattattattat 125208 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 121079 attactattattattattat 121060 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 66544 attactattattattattat 66525 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 12773 attactattattattattat 12754 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 10671 attactattattattattat 10652 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 8590 attactattattattattat 8609 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 8202 attactattattattattat 8221
>gb|AE014847.1| Plasmodium falciparum 3D7 chromosome 12, section 4 of 9 of the complete sequence Length = 252650 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||| |||||||||||||||||||| Sbjct: 55104 atattcattactattattattattat 55079 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 154412 attactattattattattat 154393 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 154385 attactattattattattat 154366 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 154367 attactattattattattat 154348 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 136899 attactattattattattat 136880
>gb|AC152723.3| Ornithorhynchus anatinus chromosome UNK clone OABb-121A1, complete sequence Length = 142600 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 10 acatattgattactattattattatt 35 ||||| |||||||||||||||||||| Sbjct: 107441 acataatgattactattattattatt 107466
>gb|AC008498.3|AC008498 Homo sapiens chromosome 5 clone CTC-436P18, complete sequence Length = 217898 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 127564 tgattactattattattattat 127543
>emb|BX004846.8| Zebrafish DNA sequence from clone CH211-172H20, complete sequence Length = 51622 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 2054 atattgattattattattattattat 2079 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 6137 attactattattattattat 6118
>emb|AL954387.17| Zebrafish DNA sequence from clone CH211-288B20 in linkage group 18, complete sequence Length = 125744 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 7960 atattgattattattattattattat 7985 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 22032 attactattattattattat 22013
>emb|AL929225.6| Zebrafish DNA sequence from clone CH211-250A24, complete sequence Length = 151067 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 81429 atattgattattattattattattat 81404
>emb|BX936406.24| Zebrafish DNA sequence from clone DKEY-13K17 in linkage group 17, complete sequence Length = 183483 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 66544 tgattactattattattattat 66565
>emb|CR556723.6| Zebrafish DNA sequence from clone CH211-176K6 in linkage group 13, complete sequence Length = 86020 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 47857 tgattactattattattattat 47878 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 67946 attactattattattattat 67927
>emb|BX901971.15| Zebrafish DNA sequence from clone DKEY-256M21 in linkage group 21, complete sequence Length = 156578 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 30821 atattgattattattattattattat 30796 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 152233 attactattattattattat 152252 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 146624 attactattattattattat 146605 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 96062 attactattattattattat 96043
>emb|CR388073.11| Zebrafish DNA sequence from clone CH211-197K16 in linkage group 25, complete sequence Length = 131786 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 13 tattgattactattattattattatc 38 ||||||||| |||||||||||||||| Sbjct: 107950 tattgattattattattattattatc 107925
>gb|AC006211.1|AC006211 Homo sapiens chromosome 18, clone hRPK.537_E_1, complete sequence Length = 217421 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 157949 tgattactattattattattat 157928
>emb|CR846100.11| Zebrafish DNA sequence from clone DKEYP-94B4, complete sequence Length = 172492 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 25594 tgattactattattattattat 25573
>dbj|AP002472.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-710M11, complete sequence Length = 109000 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 21235 tgattactattattattattat 21256
>gb|AF005144.1|AF005144 Equine infectious anemia virus strain 564V/C9 envelope protein (env) mRNA, partial cds Length = 854 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 748 tgattactattattattattat 727
>gb|AF005143.1|AF005143 Equine infectious anemia virus strain 564V/C8 envelope protein (env) mRNA, partial cds Length = 854 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 748 tgattactattattattattat 727
>gb|AF005141.1|AF005141 Equine infectious anemia virus strain 564V/C7 envelope protein (env) mRNA, partial cds Length = 854 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 748 tgattactattattattattat 727
>gb|AF005140.1|AF005140 Equine infectious anemia virus strain 564V/C60 envelope protein (env) mRNA, partial cds Length = 854 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 748 tgattactattattattattat 727
>gb|AF005137.1|AF005137 Equine infectious anemia virus strain 564V/C2 envelope protein (env) mRNA, partial cds Length = 854 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 748 tgattactattattattattat 727
>gb|AF005136.1|AF005136 Equine infectious anemia virus strain 564V/C9 envelope protein (env) mRNA, partial cds Length = 854 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 748 tgattactattattattattat 727
>gb|AF005135.1|AF005135 Equine infectious anemia virus strain 564V/C1 envelope protein (env) mRNA, partial cds Length = 854 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 748 tgattactattattattattat 727
>emb|BX649405.13| Zebrafish DNA sequence from clone DKEY-190M16 in linkage group 1, complete sequence Length = 231915 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 18 attactattattattattatccaaag 43 ||||||||||||||||||||| |||| Sbjct: 13656 attactattattattattatcaaaag 13681
>emb|BX072557.8| Mouse DNA sequence from clone RP23-79L4 on chromosome X, complete sequence Length = 198694 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 95956 tgattactattattattattat 95935
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 8 gaacatattgattactattatt 29 |||||||||||||||||||||| Sbjct: 1061385 gaacatattgattactattatt 1061406
>emb|CT573284.1| Platypus DNA sequence from clone CLM1-349H20, complete sequence Length = 151975 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 18 attactattattattattatcc 39 |||||||||||||||||||||| Sbjct: 10842 attactattattattattatcc 10821
>emb|BX005155.4| Zebrafish DNA sequence from clone CH211-286N5 in linkage group 7, complete sequence Length = 139365 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 77410 tgattactattattattattat 77431
>emb|AL935202.7| Zebrafish DNA sequence from clone CH211-197E11, complete sequence Length = 189096 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 173808 tgattactattattattattat 173787 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 108097 attactattattattattat 108116
>emb|AL844514.12| Zebrafish DNA sequence from clone DKEY-7E20 in linkage group 1, complete sequence Length = 228327 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 33770 tgattactattattattattat 33791
>emb|AL928650.5| Zebrafish DNA sequence from clone CH211-160D14 in linkage group 17, complete sequence Length = 178563 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 18 attactattattattattatccaaag 43 ||||||||||||||||||||| |||| Sbjct: 33983 attactattattattattatcaaaag 34008 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 64568 attactattattattattat 64587
>emb|AL929216.6| Zebrafish DNA sequence from clone CH211-138G9 in linkage group 20, complete sequence Length = 174383 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 137621 tgattactattattattattat 137600 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 32472 attactattattattattat 32491 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 31963 attactattattattattat 31982 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 23268 attactattattattattat 23249
>emb|BX511074.10| Zebrafish DNA sequence from clone CH211-123D3 in linkage group 19, complete sequence Length = 87054 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 ||||| |||||||||||||||||||| Sbjct: 29005 atattaattactattattattattat 28980
>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence Length = 949626 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 541757 atattgattattattattattattat 541732
>gb|U23478.1|DDU23478 Dictyostelium discoideum phosphatidylinositol-4,5-diphosphate 3-kinase (PIK3) mRNA, partial cds Length = 4758 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 18 attactattattattattatcc 39 |||||||||||||||||||||| Sbjct: 4722 attactattattattattatcc 4701 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 744 attactattattattattat 725
>emb|X00418.1|SCCOX1 Yeast cytochrome c oxidase transcription initiation region subunit 1 (COX1) from mitochondrial DNA Length = 825 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 172 atattgattattattattattattat 147
>emb|AL138784.30| Human DNA sequence from clone RP5-1102M4 on chromosome 1, complete sequence Length = 150434 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 109155 tgattactattattattattat 109176
>emb|AL928546.5| Mouse DNA sequence from clone RP23-412C22 on chromosome 2, complete sequence Length = 193834 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 16 tgattactattattattattat 37 |||||||||||||||||||||| Sbjct: 29070 tgattactattattattattat 29049
>gb|K00920.1|PARMTDI8A paramecium species 8,299 mt dna dimer: replication init. region Length = 821 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 12 atattgattactattattattattat 37 |||||||||| ||||||||||||||| Sbjct: 273 atattgattattattattattattat 298
>gb|AC102159.10| Mus musculus chromosome 19, clone RP23-398L11, complete sequence Length = 197134 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 13 tattgattactattattattattat 37 ||||||||| ||||||||||||||| Sbjct: 156749 tattgattattattattattattat 156725
>ref|NM_129863.3| Arabidopsis thaliana amine oxidase/ oxidoreductase AT2G43020 mRNA, complete cds Length = 2110 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 gattactattattattattat 37 ||||||||||||||||||||| Sbjct: 391 gattactattattattattat 371
>ref|XM_633528.1| Dictyostelium discoideum hypothetical protein (DDB0218604), partial mRNA Length = 1104 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 453 attactattattattattatc 433
>ref|XM_633206.1| Dictyostelium discoideum hypothetical protein (DDB0186417), partial mRNA Length = 2595 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 9 aacatattgattactattattatta 33 ||||||||||||| ||||||||||| Sbjct: 897 aacatattgattattattattatta 873
>ref|XM_632820.1| Dictyostelium discoideum hypothetical protein (DDB0186788), partial mRNA Length = 2226 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 72 attactattattattattatc 52
>ref|XM_631995.1| Dictyostelium discoideum hypothetical protein (DDB0219278), partial mRNA Length = 534 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 18 attactattattattattatccaaa 42 |||| |||||||||||||||||||| Sbjct: 249 attattattattattattatccaaa 225
>ref|XM_631794.1| Dictyostelium discoideum hypothetical protein (DDB0187766), partial mRNA Length = 1896 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 gattactattattattattat 37 ||||||||||||||||||||| Sbjct: 592 gattactattattattattat 572
>ref|XM_642066.1| Dictyostelium discoideum serine-tRNA ligase (DDB0231306), partial mRNA Length = 1578 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1383 attactattattattattatc 1363
>ref|XM_641508.1| Dictyostelium discoideum hypothetical protein (DDB0190861), partial mRNA Length = 4080 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 2592 attactattattattattatc 2572 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 1371 attactattattattattat 1352
>ref|XM_641403.1| Dictyostelium discoideum hypothetical protein (DDB0190763), partial mRNA Length = 1254 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 903 attactattattattattatc 883
>ref|XM_641188.1| Dictyostelium discoideum hypothetical protein (DDB0216701), partial mRNA Length = 1503 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1323 attactattattattattatc 1303
>ref|XM_641181.1| Dictyostelium discoideum hypothetical protein (DDB0190549), partial mRNA Length = 3099 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 2145 attactattattattattatc 2125
>ref|XM_640480.1| Dictyostelium discoideum modulatory calcineurin-interacting protein (DDB0231030), partial mRNA Length = 1218 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 gattactattattattattat 37 ||||||||||||||||||||| Sbjct: 298 gattactattattattattat 278
>ref|XM_640824.1| Dictyostelium discoideum hypothetical protein (DDB0201701), partial mRNA Length = 1689 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 tattgattactattattattattat 37 |||| |||||||||||||||||||| Sbjct: 273 tatttattactattattattattat 297
>ref|XM_640724.1| Dictyostelium discoideum hypothetical protein (DDB0216779), partial mRNA Length = 1950 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 9 aacatattgattactattattattattat 37 |||||| | |||||||||||||||||||| Sbjct: 573 aacataatcattactattattattattat 545
>ref|XM_640329.1| Dictyostelium discoideum hypothetical protein (DDB0216943), partial mRNA Length = 4098 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 111 attactattattattattatc 91
>ref|XM_640264.1| Dictyostelium discoideum Ras guanine nucleotide exchange factor (DDB0185195), partial mRNA Length = 4671 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 90 attactattattattattatc 70
>ref|XM_639816.1| Dictyostelium discoideum hypothetical protein (DDB0168928), partial mRNA Length = 3447 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1347 attactattattattattatc 1327 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 1512 attactattattattattat 1493
>ref|XM_640175.1| Dictyostelium discoideum hypothetical protein (DDB0185211), partial mRNA Length = 2535 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 174 attactattattattattatc 154
>ref|XM_639664.1| Dictyostelium discoideum hypothetical protein (DDB0217124), partial mRNA Length = 5058 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 13 tattgattactattattattattat 37 ||||||||| ||||||||||||||| Sbjct: 353 tattgattattattattattattat 329 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 4956 attactattattattattat 4937 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 1224 attactattattattattat 1205
>ref|XM_639402.1| Dictyostelium discoideum hypothetical protein (DDB0217291), partial mRNA Length = 5058 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 13 tattgattactattattattattat 37 ||||||||| ||||||||||||||| Sbjct: 353 tattgattattattattattattat 329 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 4956 attactattattattattat 4937 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 1224 attactattattattattat 1205
>ref|XM_639197.1| Dictyostelium discoideum hypothetical protein (DDB0220680), partial mRNA Length = 2832 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 747 attactattattattattatc 727
>ref|XM_638849.1| Dictyostelium discoideum hypothetical protein (DDB0203296), partial mRNA Length = 1341 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 432 attactattattattattatc 412
>ref|XM_638654.1| Dictyostelium discoideum homeodomain (HOX) containing protein (DDB0185105), partial mRNA Length = 2829 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 237 attactattattattattatc 217 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 14 attgattactattattattattat 37 |||||||| ||||||||||||||| Sbjct: 733 attgattattattattattattat 710
>ref|XM_637196.1| Dictyostelium discoideum hypothetical protein (DDB0218087), partial mRNA Length = 2559 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1800 attactattattattattatc 1780
>ref|XM_637131.1| Dictyostelium discoideum hypothetical protein (DDB0204524), partial mRNA Length = 2673 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 gattactattattattattat 37 ||||||||||||||||||||| Sbjct: 424 gattactattattattattat 404 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 1809 attactattattattattat 1790
>ref|XM_636743.1| Dictyostelium discoideum hypothetical protein (DDB0204710), partial mRNA Length = 1281 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 537 attactattattattattatc 517
>ref|XM_635447.1| Dictyostelium discoideum SART-1 family protein (DDB0216406), partial mRNA Length = 2067 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1497 attactattattattattatc 1477
>ref|XM_635243.1| Dictyostelium discoideum hypothetical protein (DDB0205161), partial mRNA Length = 1668 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 132 attactattattattattatc 112
>ref|XM_634240.1| Dictyostelium discoideum hypothetical protein (DDB0191478), partial mRNA Length = 1083 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1005 attactattattattattatc 985
>ref|XM_631109.1| Dictyostelium discoideum hypothetical protein (DDB0219444), partial mRNA Length = 1689 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1638 attactattattattattatc 1618
>ref|XM_630959.1| Dictyostelium discoideum Ras guanine nucleotide exchange factor (DDB0191356), partial mRNA Length = 3897 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 726 attactattattattattatc 706 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 672 attactattattattattat 653
>ref|XM_630398.1| Dictyostelium discoideum hypothetical protein (DDB0189163), partial mRNA Length = 9402 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 5142 attactattattattattatc 5122
>ref|XM_630093.1| Dictyostelium discoideum hypothetical protein (DDB0183867), partial mRNA Length = 2538 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1506 attactattattattattatc 1486
>ref|XM_629787.1| Dictyostelium discoideum hypothetical protein (DDB0184184), partial mRNA Length = 774 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 735 attactattattattattatc 715 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 693 attactattattattattat 674
>ref|XM_629759.1| Dictyostelium discoideum hypothetical protein (DDB0184155), partial mRNA Length = 5211 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 885 attactattattattattatc 865
>ref|XM_629130.1| Dictyostelium discoideum hypothetical protein (DDB0229809), partial mRNA Length = 1431 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1053 attactattattattattatc 1033
>ref|XM_628986.1| Dictyostelium discoideum hypothetical protein (DDB0191988), partial mRNA Length = 6333 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 483 attactattattattattatc 463 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 1764 attactattattattattat 1745
>ref|XM_628976.1| Dictyostelium discoideum hypothetical protein (DDB0192113), partial mRNA Length = 3258 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 3024 attactattattattattatc 3004 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 3123 attactattattattattat 3104
>gb|AC122888.5| Mus musculus BAC clone RP23-93F11 from chromosome 3, complete sequence Length = 206760 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 160127 attactattattattattatc 160107
>gb|AC164111.4| Mus musculus BAC clone RP23-267E11 from chromosome 6, complete sequence Length = 179265 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 tattgattactattattattattat 37 |||| |||||||||||||||||||| Sbjct: 159908 tattaattactattattattattat 159932
>gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8 of 8 of the complete sequence Length = 271546 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 143907 attactattattattattatc 143927 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 143865 attactattattattattatc 143885 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 108869 attactattattattattat 108850 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 95959 attactattattattattat 95978 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 84888 attactattattattattat 84907 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 84870 attactattattattattat 84889 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 84852 attactattattattattat 84871
>gb|AE014826.1| Plasmodium falciparum 3D7 chromosome 14 section 11 of 13 of the complete sequence Length = 250663 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 16 tgattactattattattattatcca 40 |||| |||||||||||||||||||| Sbjct: 162558 tgataactattattattattatcca 162534 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 202170 attactattattattattat 202189 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 94027 attactattattattattat 94008 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 89262 attactattattattattat 89243 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 13790 attactattattattattat 13809
>gb|AC108763.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBb0004A05, complete sequence Length = 157913 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 14 attgattactattattattattatc 38 ||||||||||| ||||||||||||| Sbjct: 131752 attgattactagtattattattatc 131776
>gb|AE014850.1| Plasmodium falciparum 3D7 chromosome 12, section 7 of 9 of the complete sequence Length = 250713 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 166728 attactattattattattatc 166708 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 170538 attactattattattattat 170557 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 158517 attactattattattattat 158498 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 attgattactattattattattat 37 |||||||| ||||||||||||||| Sbjct: 106951 attgattattattattattattat 106974 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 102639 attactattattattattat 102620
>gb|AF185113.1|AF185113S1 Lasiorhinus krefftii microsatellite Lkr107f sequence Length = 187 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 129 attactattattattattatc 149
>gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence Length = 1590432 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1314469 attactattattattattatc 1314449 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 459415 attactattattattattat 459396
>gb|AC087327.7| Trypanosoma brucei chromosome 4 clone RPCI93-3I12, complete sequence Length = 158030 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 9546 attactattattattattatc 9566
>gb|AY740679.1| Dictyostelium discoideum modulatory calcineurin-interacting protein RcnA (rcnA) gene, complete cds Length = 1395 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 gattactattattattattat 37 ||||||||||||||||||||| Sbjct: 298 gattactattattattattat 278 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 852 attactattattattattat 833
>gb|AC167169.2| Mus musculus BAC clone RP24-257G14 from chromosome 16, complete sequence Length = 150549 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 99703 attactattattattattatc 99683
>gb|BC077207.1| Xenopus laevis MGC78972 protein, mRNA (cDNA clone MGC:78972 IMAGE:4405029), complete cds Length = 1751 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 13 tattgattactattattattattat 37 ||||||||| ||||||||||||||| Sbjct: 1486 tattgattattattattattattat 1462
>gb|AC010211.10| Drosophila melanogaster clone BACR26C09, complete sequence Length = 177855 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 74520 attactattattattattatc 74500 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 74385 attactattattattattatc 74365
>gb|AC008324.3| Drosophila melanogaster clone BACR25K01, complete sequence Length = 172939 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 tattgattactattattattattat 37 |||||| |||||||||||||||||| Sbjct: 153810 tattgagtactattattattattat 153834
>gb|AC008325.5| Drosophila melanogaster clone BACR05M06, complete sequence Length = 166423 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 tattgattactattattattattat 37 |||||| |||||||||||||||||| Sbjct: 83975 tattgagtactattattattattat 83999
>gb|AC145586.4| Mus musculus BAC clone RP24-167J1 from chromosome Y, complete sequence Length = 158469 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 92795 attactattattattattatc 92815
>ref|XM_457138.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0B03982g) partial mRNA Length = 2664 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 ttgattactattattattatt 35 ||||||||||||||||||||| Sbjct: 129 ttgattactattattattatt 109
>gb|AC132331.3| Mus musculus BAC clone RP24-217D10 from chromosome 12, complete sequence Length = 176940 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 13660 attactattattattattatc 13640
>gb|AC186150.1| Ornithorhynchus anatinus chromosome UNK clone OABb-264K6, complete sequence Length = 149168 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 20 tactattattattattatcca 40 ||||||||||||||||||||| Sbjct: 119531 tactattattattattatcca 119551
>gb|AY815068.1| Schistosoma japonicum SJCHGC02019 protein mRNA, complete cds Length = 2023 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 1545 attactattattattattatc 1565
>gb|AC108909.15| Mus musculus chromosome 3, clone RP24-245I16, complete sequence Length = 194252 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 35320 attactattattattattatc 35300
>gb|AC164441.4| Mus musculus BAC clone CH25-660D15 from chromosome 13, complete sequence Length = 110316 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 38953 attactattattattattatc 38973
>gb|AC145805.2| Xenopus tropicalis clone CH216-85O8, complete sequence Length = 166207 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 101573 attactattattattattatc 101553
>gb|AC116963.2| Dictyostelium discoideum chromosome 2 map 4657875-4914984 strain AX4, complete sequence Length = 257109 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 119575 attactattattattattatc 119595 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 195749 attactattattattattat 195730 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 174180 attactattattattattat 174161 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 170297 attactattattattattat 170316 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 158302 attactattattattattat 158283 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 155422 attactattattattattat 155403 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 154486 attactattattattattat 154467 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 151302 attactattattattattat 151283 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 140252 attactattattattattat 140271 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 132978 attactattattattattat 132997 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 73902 attactattattattattat 73883 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 70371 attactattattattattat 70352 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 55831 attactattattattattat 55850
>gb|AC140188.3| Mus musculus BAC clone RP24-365F13 from chromosome Y, complete sequence Length = 191466 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 13 tattgattactattattattattat 37 ||||| ||||||||||||||||||| Sbjct: 77331 tattgtttactattattattattat 77307
>gb|AC140357.4| Mus musculus BAC clone RP24-72I2 from chromosome Y, complete sequence Length = 203978 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 tattgattactattattattattat 37 ||||| ||||||||||||||||||| Sbjct: 60134 tattgtttactattattattattat 60158
>gb|AC144853.3| Mus musculus BAC clone RP24-305D3 from chromosome Y, complete sequence Length = 160134 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 13 tattgattactattattattattat 37 ||||| ||||||||||||||||||| Sbjct: 59693 tattgtttactattattattattat 59669
>gb|AC134556.5| Mus musculus BAC clone RP24-320K6 from chromosome Y, complete sequence Length = 180237 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 tattgattactattattattattat 37 ||||| ||||||||||||||||||| Sbjct: 106501 tattgtttactattattattattat 106525
>gb|AC122896.4| Mus musculus BAC clone RP23-69N8 from chromosome 10, complete sequence Length = 232473 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 9 aacatattgattactattattattattat 37 |||||||| |||| ||||||||||||||| Sbjct: 116244 aacatatttattattattattattattat 116272
>gb|AC140463.2| Mus musculus BAC clone RP24-348D8 from chromosome 14, complete sequence Length = 159158 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 106444 attactattattattattatc 106464
>gb|AY484462.1| Dictyostelium discoideum kinesin family member 8 gene, complete cds Length = 6744 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 tattgattactattattattattat 37 |||| |||||||||||||||||||| Sbjct: 6559 tatttattactattattattattat 6583 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 5189 attactattattattattat 5170 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 2312 attactattattattattat 2293
>emb|CR759880.7| Zebrafish DNA sequence from clone DKEY-32O22 in linkage group 9, complete sequence Length = 183450 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 13 tattgattactattattattattat 37 ||||||||| ||||||||||||||| Sbjct: 131665 tattgattattattattattattat 131641 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 13 tattgattactattattattattat 37 ||||||||| ||||||||||||||| Sbjct: 131640 tattgattattattattattattat 131616 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 81280 attactattattattattat 81299
>emb|BX640472.24| Zebrafish DNA sequence from clone CH211-251J10 in linkage group 8, complete sequence Length = 104986 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 59068 attactattattattattatc 59048
>emb|BX890591.12| Zebrafish DNA sequence from clone DKEY-184J23 in linkage group 19, complete sequence Length = 171079 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 tattgattactattattattattat 37 ||||||||| ||||||||||||||| Sbjct: 33772 tattgattattattattattattat 33796
>emb|AL021531.1|FR151J19 Fugu rubripes cosmid 151J19 covering the WT1, reticulocalbin and PAX6 genes Length = 45565 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 21136 attactattattattattatc 21116 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 attactattattattattat 37 |||||||||||||||||||| Sbjct: 41237 attactattattattattat 41218
>ref|XM_821303.1| Trypanosoma brucei TREU927 clone RPCI93-3I12 hypothetical protein (Tb927.4.4800) partial mRNA Length = 393 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 194 attactattattattattatc 214
>emb|CR388060.19| Zebrafish DNA sequence from clone DKEY-208J8 in linkage group 16, complete sequence Length = 213586 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 143349 attactattattattattatc 143369
>emb|CR381553.13| Zebrafish DNA sequence from clone CH211-154P8 in linkage group 14, complete sequence Length = 145320 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 42499 attactattattattattatc 42519
>emb|BX548040.19| Zebrafish DNA sequence from clone CH211-190L11 in linkage group 12, complete sequence Length = 147855 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 gattactattattattattat 37 ||||||||||||||||||||| Sbjct: 52792 gattactattattattattat 52812
>emb|BX936437.15| Zebrafish DNA sequence from clone DKEYP-96G2 in linkage group 14, complete sequence Length = 103928 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 9995 attactattattattattatc 10015
>emb|CR352331.8| Zebrafish DNA sequence from clone DKEY-171H2 in linkage group 17, complete sequence Length = 93120 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 4235 attactattattattattatc 4215
>emb|CR391978.12| Zebrafish DNA sequence from clone DKEY-252L8 in linkage group 1, complete sequence Length = 137171 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 12 atattgattactattattattatta 36 ||||| ||||||||||||||||||| Sbjct: 30230 atatttattactattattattatta 30206
>emb|CR855305.12| Zebrafish DNA sequence from clone DKEY-98F17 in linkage group 5, complete sequence Length = 155542 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 18 attactattattattattatccaaagaaa 46 |||| |||||||||||||||| ||||||| Sbjct: 151313 attattattattattattatcaaaagaaa 151285
>gb|AC129193.4| Mus musculus BAC clone RP24-136L12 from chromosome 9, complete sequence Length = 181376 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 174923 attactattattattattatc 174903
>gb|AC125155.4| Mus musculus BAC clone RP24-380D9 from chromosome 6, complete sequence Length = 173003 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 32597 attactattattattattatc 32577
>gb|AC124563.4| Mus musculus BAC clone RP23-206B15 from chromosome 6, complete sequence Length = 210092 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 13 tattgattactattattattattat 37 |||| |||||||||||||||||||| Sbjct: 77862 tattaattactattattattattat 77886
>gb|AC146815.1| Mus musculus BAC clone RP23-239A11 from chromosome 8, complete sequence Length = 203073 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 200246 attactattattattattatc 200226
>gb|AC124556.4| Mus musculus BAC clone RP23-246K11 from chromosome 12, complete sequence Length = 202214 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attactattattattattatc 38 ||||||||||||||||||||| Sbjct: 162518 attactattattattattatc 162498 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,373,240 Number of Sequences: 3902068 Number of extensions: 5373240 Number of successful extensions: 1054326 Number of sequences better than 10.0: 4487 Number of HSP's better than 10.0 without gapping: 4497 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 811769 Number of HSP's gapped (non-prelim): 213661 length of query: 483 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 461 effective length of database: 17,147,199,772 effective search space: 7904859094892 effective search space used: 7904859094892 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)