>gb|AC134862.4| Mus musculus BAC clone RP24-91P2 from 5, complete sequence
          Length = 205726

 Score = 42.1 bits (21), Expect = 0.74
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 195    cccatgagcagcatccttgtg 215
              |||||||||||||||||||||
Sbjct: 114272 cccatgagcagcatccttgtg 114252

>gb|AY742516.1| Archoplites interruptus isolate AintA 16S ribosomal RNA gene, partial
            sequence; mitochondrial
          Length = 1689

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 108  gtacgcctccccccacctaa 127
            ||||||||||||||||||||
Sbjct: 1614 gtacgcctccccccacctaa 1633

>gb|AC138642.10| Mus musculus chromosome 3, clone RP23-21O7, complete sequence
          Length = 252108

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      tgaggaaataacagatcaaa 22
              ||||||||||||||||||||
Sbjct: 156530 tgaggaaataacagatcaaa 156549

>emb|AL109828.22|HSJ586J11 Human DNA sequence from clone RP4-586J11 on chromosome 20 Contains
             ESTs, complete sequence
          Length = 91350

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   aaattgttaaaatgatttga 145
             ||||||||||||||||||||
Sbjct: 24004 aaattgttaaaatgatttga 24023

>gb|AC107426.13| Homo sapiens 3 BAC RP11-573F3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 114540

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 133   taaaatgatttgacgatttg 152
             ||||||||||||||||||||
Sbjct: 30039 taaaatgatttgacgatttg 30058

>dbj|AB025605.1| Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F5H8
          Length = 70098

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     aggaaataacagatcaaact 24
             ||||||||||||||||||||
Sbjct: 60377 aggaaataacagatcaaact 60358


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,697,400
Number of Sequences: 3902068
Number of extensions: 1697400
Number of successful extensions: 29212
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29203
Number of HSP's gapped (non-prelim): 9
length of query: 228
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 206
effective length of database: 17,147,199,772
effective search space: 3532323153032
effective search space used: 3532323153032
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)