ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart21g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome 42 1.5
2emb|AJ132755.1|ONO132755 Ophiostoma novo-ulmi mitovirus 5-Ld mRN... 42 1.5
3gb|U60065.1|GLU60065 Gibbon leukemia virus strain X, complete ge... 42 1.5
4dbj|AP001331.1| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 1.5
5dbj|AP003479.1| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 1.5
6ref|NM_130261.2| Arabidopsis thaliana carboxylic ester hydrolase... 40 6.1
7ref|XM_501951.1| Yarrowia lipolytica CLIB122, YALI0C17831g predi... 40 6.1
8gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 40 6.1
9gb|AY052671.1| Arabidopsis thaliana At2g46930/F14M4.24 mRNA, com... 40 6.1
10gb|AC015861.7|AC015861 Homo sapiens, clone RP11-45A1, complete s... 40 6.1
11emb|BX820116.1|CNS0A8JG Arabidopsis thaliana Full-length cDNA Co... 40 6.1
12emb|BX649220.6| Chicken DNA sequence from clone WAG-14F8, comple... 40 6.1
13emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 40 6.1

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 206     cagcaacggtcttgccatgctcatt 230
               |||||||||||||||||| ||||||
Sbjct: 1486717 cagcaacggtcttgccatcctcatt 1486693



to top

>emb|AJ132755.1|ONO132755 Ophiostoma novo-ulmi mitovirus 5-Ld mRNA for putative RNA-dependent
           RNA polymerase
          Length = 2474

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 14  cctgaaatcgataataatctt 34
           |||||||||||||||||||||
Sbjct: 430 cctgaaatcgataataatctt 410



to top

>gb|U60065.1|GLU60065 Gibbon leukemia virus strain X, complete genome
          Length = 8379

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 268 ggaacagaccgaaaccaaaat 288
           |||||||||||||||||||||
Sbjct: 625 ggaacagaccgaaaccaaaat 605



to top

>dbj|AP001331.1| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1153C10
          Length = 207620

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 52    aagagaaaacaatcactatcc 72
             |||||||||||||||||||||
Sbjct: 23412 aagagaaaacaatcactatcc 23392



to top

>dbj|AP003479.1| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1296F8
          Length = 146340

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 52     aagagaaaacaatcactatcc 72
              |||||||||||||||||||||
Sbjct: 120999 aagagaaaacaatcactatcc 120979



to top

>ref|NM_130261.2| Arabidopsis thaliana carboxylic ester hydrolase AT2G46930 mRNA,
            complete cds
          Length = 1614

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 205  tcagcaacggtcttgccatg 224
            ||||||||||||||||||||
Sbjct: 1260 tcagcaacggtcttgccatg 1241



to top

>ref|XM_501951.1| Yarrowia lipolytica CLIB122, YALI0C17831g predicted mRNA
          Length = 1476

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 205 tcagcaacggtcttgccatgctca 228
           |||||||||||||| |||||||||
Sbjct: 89  tcagcaacggtcttaccatgctca 112



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 71     ccgcacatcgacaaacaatccggt 94
              |||||||||| |||||||||||||
Sbjct: 793251 ccgcacatcggcaaacaatccggt 793274



to top

>gb|AY052671.1| Arabidopsis thaliana At2g46930/F14M4.24 mRNA, complete cds
          Length = 1509

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 205  tcagcaacggtcttgccatg 224
            ||||||||||||||||||||
Sbjct: 1260 tcagcaacggtcttgccatg 1241



to top

>gb|AC015861.7|AC015861 Homo sapiens, clone RP11-45A1, complete sequence
          Length = 151308

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 291    caaggacagttccttctgccaaca 314
              |||| |||||||||||||||||||
Sbjct: 115513 caagcacagttccttctgccaaca 115536



to top

>emb|BX820116.1|CNS0A8JG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS75ZE08 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1405

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 205  tcagcaacggtcttgccatg 224
            ||||||||||||||||||||
Sbjct: 1188 tcagcaacggtcttgccatg 1169



to top

>emb|BX649220.6| Chicken DNA sequence from clone WAG-14F8, complete sequence
          Length = 87646

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    caagagaaaacaatcactat 70
             ||||||||||||||||||||
Sbjct: 69035 caagagaaaacaatcactat 69054



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 205     tcagcaacggtcttgccatgctca 228
               |||||||||||||| |||||||||
Sbjct: 2472361 tcagcaacggtcttaccatgctca 2472338


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,029,718
Number of Sequences: 3902068
Number of extensions: 3029718
Number of successful extensions: 55687
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55632
Number of HSP's gapped (non-prelim): 55
length of query: 451
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 429
effective length of database: 17,147,199,772
effective search space: 7356148702188
effective search space used: 7356148702188
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top