ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart21f07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 454 e-125
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 68 2e-08
3gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 68 2e-08
4dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 68 2e-08
5dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 68 2e-08
6dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 2e-08
7dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 2e-08
8dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 2e-08
9dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 2e-08
10dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 2e-08
11gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 68 2e-08
12dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsi... 66 7e-08
13dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 7e-08
14gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic p... 62 1e-06
15ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 60 4e-06
16emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative... 56 6e-05
17gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 52 0.001
18gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 52 0.001
19gb|AY104464.1| Zea mays PCO114899 mRNA sequence 52 0.001
20gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 52 0.001
21gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP)... 46 0.061
22gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, com... 46 0.061
23gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete... 46 0.061
24gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete ... 46 0.061
25ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.24
26ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin,... 44 0.24
27ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.24
28ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.24
29ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.24
30ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.24
31ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.24
32gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome... 42 0.96
33emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chr... 42 0.96
34gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, compl... 42 0.96
35gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complet... 42 0.96
36gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complet... 42 0.96
37gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a su... 42 0.96
38gb|AY258323.1| Rubella virus strain BRD-II, complete genome 42 0.96
39ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a ... 42 0.96
40emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BA... 42 0.96
41emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 i... 42 0.96
42dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 42 0.96
43gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome... 42 0.96
44ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate r... 42 0.96
45gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 0.96
46gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 0.96
47gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylg... 42 0.96
48gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 0.96
49gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylg... 42 0.96
50gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 0.96
51gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylg... 42 0.96
52gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 0.96
53gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylg... 42 0.96
54emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in... 42 0.96
55emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in ... 42 0.96
56gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 1... 42 0.96
57gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 0.96
58emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chr... 42 0.96
59emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in... 42 0.96
60gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphospha... 42 0.96
61gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, compl... 42 0.96
62gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosom... 40 3.8
63gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, com... 40 3.8
64gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome... 40 3.8
65gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, comple... 40 3.8
66emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in... 40 3.8
67gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, comple... 40 3.8
68gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region... 40 3.8
69emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chr... 40 3.8
70gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, pr... 40 3.8
71gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, pr... 40 3.8
72gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, ... 40 3.8
73emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 i... 40 3.8
74gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, co... 40 3.8
75tpg|BK001890.1| TPA: TPA_inf: Drosophila melanogaster HDC08154 (... 40 3.8
76dbj|AB118808.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 3.8
77dbj|AB089162.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 3.8
78dbj|AB088761.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 3.8
79gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, co... 40 3.8
80gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswel... 40 3.8
81emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in... 40 3.8
82emb|BX119977.10| Zebrafish DNA sequence from clone CH211-198A3 i... 40 3.8
83gb|AF022186.2|AF022186 Cyanidium caldarium strain RK1 chloroplas... 40 3.8
84gb|AC136687.6| Homo sapiens chromosome 15, clone RP11-439M15, co... 40 3.8
85gb|AC134393.6| Homo sapiens chromosome 15, clone CTC-803A3, comp... 40 3.8
86gb|AC131280.9| Homo sapiens chromosome 15, clone RP11-467L19, co... 40 3.8
87dbj|AB154356.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 3.8
88dbj|AB118809.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 3.8
89emb|X07932.1|HVWAXYR Barley mRNA pcwx27 for waxy locus 40 3.8
90emb|X07931.1|HVWAXYG Barley DNA for waxy locus encoding starch s... 40 3.8
91emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 i... 40 3.8
92gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10... 40 3.8
93gb|AC116680.21| Mus musculus chromosome 12, clone RP23-476M16, c... 40 3.8
94gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic se... 40 3.8
95emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in... 40 3.8
96gb|AF317103.1| Dumontia alaskana specimen-voucher GWS000917 (UNB... 40 3.8
97gb|AF317102.1| Dumontia alaskana specimen-voucher GWS000916 (UNB... 40 3.8
98gb|AF317101.1| Dumontia alaskana specimen-voucher G0221 (UNB) sm... 40 3.8
99dbj|AB054056.1| Hordeum vulgare waxy gene, partial sequence, cul... 40 3.8
100dbj|AB054055.2| Hordeum vulgare waxy gene, partial sequence, cul... 40 3.8
101emb|AL772162.4| Mouse DNA sequence from clone RP23-175J8 on chro... 40 3.8 
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score =  454 bits (229), Expect = e-125
 Identities = 244/249 (97%)
 Strand = Plus / Minus

                                                                        
Query: 39   gaattcacaggttttacacaagcaaattgacagggtcgatcgtcaaaggtttcacagcac 98
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1020 gaattcacaggttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcac 961

                                                                        
Query: 99   cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 158
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 960  cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 901

                                                                        
Query: 159  ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 218
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 900  ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 841

                                                                        
Query: 219  ggcggggggcaggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcg 278
            |||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||
Sbjct: 840  ggcggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcg 781

                     
Query: 279  ggaaatgaa 287
            ||| |||||
Sbjct: 780  ggagatgaa 772
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                         
Query: 230     ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
               ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||
Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaa 2544773



 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 204     acggacggacgggcgggcggg 224
               |||||||||||||||||||||
Sbjct: 8319519 acggacggacgggcgggcggg 8319499
to top
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                        
Query: 230    ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
              ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||
Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaa 125321
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                         
Query: 230     ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
               ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||
Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaa 2544883



 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 204     acggacggacgggcgggcggg 224
               |||||||||||||||||||||
Sbjct: 8317354 acggacggacgggcgggcggg 8317334
to top
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 230 ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||
Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaa 787
to top
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 230 ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||
Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaa 796
to top
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 230 ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||
Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaa 798
to top
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 230 ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||
Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaa 632
to top
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 230 ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||
Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaa 322
to top
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 230 ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||
Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaa 794
to top
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 250 tcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           |||||||||||||||||||||||||||||||| |||||
Sbjct: 840 tcggtggtggggagctgctcgtgggtgcgggagatgaa 803



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 66/76 (86%), Gaps = 6/76 (7%)
 Strand = Plus / Minus

                                                                        
Query: 6    aactcaactgaacttgaaattactcgggcgga-----cgaattcacaggttttacacaag 60
            ||||||||| |||||||||||||||||||||      ||||||||||| ||||||| |||
Sbjct: 1101 aactcaactcaacttgaaattactcgggcgggacgggcgaattcacag-ttttacagaag 1043

                            
Query: 61   caaattgacagggtcg 76
            ||||||||||| ||||
Sbjct: 1042 caaattgacagtgtcg 1027



 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 151 aagcaaacttaaacgactcatg 172
           ||||||||||||||||||||||
Sbjct: 977 aagcaaacttaaacgactcatg 956
to top
>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1,
           complete cds
          Length = 1067

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 247 taatcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           |||||||||||||||||||||||||||||| |||| |||||
Sbjct: 822 taatcggtggtggggagctgctcgtgggtgtgggagatgaa 782
to top
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 230 ggcggcggtgaacttaataatcggtggtggggagctgctcgtgggtgcgggaaatga 286
           ||||||| ||| |||| || ||||||||||||||||||||||||||| |||| ||||
Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223
to top
>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA,
           partial cds
          Length = 529

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 242 cttaataatcggtggtggggagctgctcgtgggtg 276
           |||||||||||||||| ||||||||||||||||||
Sbjct: 416 cttaataatcggtggttgggagctgctcgtgggtg 382
to top
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 250 tcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||||||||||||||||||||||| |||| |||||
Sbjct: 746 tcggtggtggggagctgctcgtgggtgtgggagatgaa 709
to top
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 250 tcggtggtggggagctgctcgtgggtgcggga 281
           ||||||||||||||||||||||||||| ||||
Sbjct: 828 tcggtggtggggagctgctcgtgggtgtggga 797
to top
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 250 tcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||||||||||||||||||| |||| |||||
Sbjct: 843 tcggtggaggggagctgctcgtgggtgtgggagatgaa 806
to top
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 250 tcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||||||||||||||||||| |||| |||||
Sbjct: 747 tcggtggaggggagctgctcgtgggtgtgggagatgaa 710
to top
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 250 tcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||||||||||||||||||| |||| |||||
Sbjct: 842 tcggtggaggggagctgctcgtgggtgtgggagatgaa 805
to top
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 250 tcggtggtggggagctgctcgtgggtgcgggaaatgaa 287
           ||||||| ||||||||||||||||||| |||| |||||
Sbjct: 839 tcggtggaggggagctgctcgtgggtgtgggagatgaa 802
to top
>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete
           cds
          Length = 1099

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 255 ggtggggagctgctcgtgggtgc 277
           |||||||||||||||||||||||
Sbjct: 845 ggtggggagctgctcgtgggtgc 823
to top
>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence
          Length = 134793

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 213   cgggcgggcggggggcaggcggc 235
             |||||||||||||||||||||||
Sbjct: 78789 cgggcgggcggggggcaggcggc 78811
to top
>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds
          Length = 9803

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 213  cgggcgggcggggggcaggcggc 235
            |||||||||||||||||||||||
Sbjct: 1449 cgggcgggcggggggcaggcggc 1427
to top
>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA
          Length = 6870

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 213 cgggcgggcggggggcaggcggc 235
           |||||||||||||||||||||||
Sbjct: 688 cgggcgggcggggggcaggcggc 666
to top
>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 11 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
to top
>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 1 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
to top
>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 10 (LOC479191), mRNA
          Length = 4663

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
to top
>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 9 (LOC479191), mRNA
          Length = 4438

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
to top
>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 7 (LOC479191), mRNA
          Length = 4777

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
to top
>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 6 (LOC479191), mRNA
          Length = 4696

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
to top
>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 3 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 204 acggacggacgggcgggcggggggcaggcggcgg 237
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
to top
>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence
          Length = 136354

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 94084 acggacggacgggcgggcggg 94104
to top
>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete
              sequence
          Length = 160805

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 204    acggacggacgggcgggcggg 224
              |||||||||||||||||||||
Sbjct: 155955 acggacggacgggcgggcggg 155935
to top
>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence
          Length = 166421

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 204  acggacggacgggcgggcggg 224
            |||||||||||||||||||||
Sbjct: 7846 acggacggacgggcgggcggg 7826
to top
>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence
          Length = 240151

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 37973 acggacggacgggcgggcggg 37953
to top
>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence
          Length = 148259

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 37509 acggacggacgggcgggcggg 37489



 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 201   cacacggacggacgggcgggcggg 224
             ||||||||||||||| ||||||||
Sbjct: 37516 cacacggacggacggacgggcggg 37493
to top
>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA
           clone MGC:19255 IMAGE:3967218), complete cds
          Length = 2176

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 23  acggacggacgggcgggcggg 43
to top
>gb|AY258323.1| Rubella virus strain BRD-II, complete genome
          Length = 9778

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 213  cgggcgggcggggggcaggcggcgg 237
            ||||||||| |||||||||||||||
Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303
to top
>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta),
           mRNA
          Length = 2547

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1
          Length = 68478

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 42894 acggacggacgggcgggcggg 42914



 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 201   cacacggacggacgggcgggcggg 224
             ||||||||||||||| ||||||||
Sbjct: 42887 cacacggacggacggacgggcggg 42910
to top
>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3,
             complete sequence
          Length = 198900

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 27616 acggacggacgggcgggcggg 27596
to top
>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920074L06 product:Rab geranylgeranyl
           transferase, a subunit, full insert sequence
          Length = 2422

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 41  acggacggacgggcgggcggg 61
to top
>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11,
             complete sequence
          Length = 126040

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 56775 acggacggacgggcgggcggg 56755
to top
>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1),
           mRNA
          Length = 1544

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 205 cggacggacgggcgggcggggggca 229
           |||||||||||||||||||| ||||
Sbjct: 56  cggacggacgggcgggcgggcggca 80
to top
>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2466

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2435

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2492

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2338

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2395

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) gene, complete cds,
           alternatively spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) gene, complete cds, alternatively
           spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38
to top
>emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in linkage group 20,
             complete sequence
          Length = 80017

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 44968 acggacggacgggcgggcggg 44988
to top
>emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in linkage group 23,
             complete sequence
          Length = 142417

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 45131 acggacggacgggcgggcggg 45151
to top
>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence
          Length = 207280

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 13760 acggacggacgggcgggcggg 13780
to top
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 215     ggcgggcggggggcaggcggcggtg 239
               ||||||||||||||| |||||||||
Sbjct: 2074504 ggcgggcggggggcatgcggcggtg 2074480
to top
>emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chromosome 12, complete
              sequence
          Length = 251037

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 204    acggacggacgggcgggcggg 224
              |||||||||||||||||||||
Sbjct: 108741 acggacggacgggcgggcggg 108721
to top
>emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in linkage group 13,
             complete sequence
          Length = 121689

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 204   acggacggacgggcgggcggg 224
             |||||||||||||||||||||
Sbjct: 73151 acggacggacgggcgggcggg 73131
to top
>gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor mRNA,
           complete cds
          Length = 1544

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 205 cggacggacgggcgggcggggggca 229
           |||||||||||||||||||| ||||
Sbjct: 56  cggacggacgggcgggcgggcggca 80
to top
>gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, complete cds
          Length = 4536

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 204 acggacggacgggcgggcggg 224
           |||||||||||||||||||||
Sbjct: 745 acggacggacgggcgggcggg 765
to top
>gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosome 13, complete
             sequence
          Length = 181893

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 204   acggacggacgggcgggcgg 223
             ||||||||||||||||||||
Sbjct: 94623 acggacggacgggcgggcgg 94642
to top
>gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, complete sequence
          Length = 197907

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 213    cgggcgggcggggggcaggc 232
              ||||||||||||||||||||
Sbjct: 122681 cgggcgggcggggggcaggc 122700
to top
>gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome alpha 1 subunit
           variant 1-like mRNA, complete sequence
          Length = 1190

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 213 cgggcgggcggggggcaggcggcg 236
           ||||||||||| ||||||||||||
Sbjct: 38  cgggcgggcggcgggcaggcggcg 15
to top
>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence
          Length = 124050

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 204   acggacggacgggcgggcgg 223
             ||||||||||||||||||||
Sbjct: 72221 acggacggacgggcgggcgg 72202
to top
>emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in linkage group 9, complete
              sequence
          Length = 153947

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 138    attcattcattcaaagcaaa 157
              ||||||||||||||||||||
Sbjct: 143356 attcattcattcaaagcaaa 143337
to top
>gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, complete sequence
          Length = 154859

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 133   gatggattcattcattcaaa 152
             ||||||||||||||||||||
Sbjct: 68036 gatggattcattcattcaaa 68017
to top
>gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region and partial 5'UTR
          Length = 3811

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 213  cgggcgggcggggggcaggc 232
            ||||||||||||||||||||
Sbjct: 3619 cgggcgggcggggggcaggc 3600
to top
>emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chromosome 1p32.1-33
             Contains 3' end of the DAB1 gene for disabled homolog 1
             (Drosophila), a novel gene and the 5' end of a novel gene,
             complete sequence
          Length = 60856

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 133   gatggattcattcattcaaa 152
             ||||||||||||||||||||
Sbjct: 53885 gatggattcattcattcaaa 53904
to top
>gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, promoter and 5'
           untranslated region
          Length = 1201

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 883 acggacggacgggcgggcgg 864
to top
>gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, promoter and 5'
           untranslated region
          Length = 1197

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 884 acggacggacgggcgggcgg 865
to top
>gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, promoter and 5'
           untranslated region
          Length = 1195

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 882 acggacggacgggcgggcgg 863
to top
>emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 in linkage group 17,
             complete sequence
          Length = 141987

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   gggatggattcattcattca 150
             ||||||||||||||||||||
Sbjct: 10001 gggatggattcattcattca 10020
to top
>gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, complete sequence
          Length = 177355

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 128   aatgggatggattcattcattcaa 151
             |||||||| |||||||||||||||
Sbjct: 47407 aatgggattgattcattcattcaa 47384
to top
>tpg|BK001890.1| TPA: TPA_inf: Drosophila melanogaster HDC08154 (HDC08154) gene,
            complete cds
          Length = 1399

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 204  acggacggacgggcgggcgg 223
            ||||||||||||||||||||
Sbjct: 1381 acggacggacgggcgggcgg 1362
to top
>dbj|AB118808.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound
           starch synthase I, complete cds, strain:OUH643
          Length = 5119

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 797 acggacggacgggcgggcgg 778
to top
>dbj|AB089162.1| Hordeum vulgare subsp. vulgare GBSSI gene for granule bound starch
           synthase I
          Length = 5190

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 822 acggacggacgggcgggcgg 803
to top
>dbj|AB088761.1| Hordeum vulgare subsp. vulgare GBSSI gene for granule bound starch
           synthase I, complete cds
          Length = 5190

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 822 acggacggacgggcgggcgg 803
to top
>gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, complete sequence
          Length = 171987

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 128   aatgggatggattcattcattcaa 151
             |||||||| |||||||||||||||
Sbjct: 31404 aatgggattgattcattcattcaa 31381
to top
>gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 170900

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 204   acggacggacgggcgggcgg 223
             ||||||||||||||||||||
Sbjct: 32025 acggacggacgggcgggcgg 32006
to top
>emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in linkage group 21,
             complete sequence
          Length = 153142

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 204   acggacggacgggcgggcgg 223
             ||||||||||||||||||||
Sbjct: 66723 acggacggacgggcgggcgg 66704
to top
>emb|BX119977.10| Zebrafish DNA sequence from clone CH211-198A3 in linkage group 7,
             complete sequence
          Length = 182186

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 204   acggacggacgggcgggcgg 223
             ||||||||||||||||||||
Sbjct: 16609 acggacggacgggcgggcgg 16590
to top
>gb|AF022186.2|AF022186 Cyanidium caldarium strain RK1 chloroplast, complete genome
          Length = 164921

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    aactgaacttgaaattactc 30
             ||||||||||||||||||||
Sbjct: 98129 aactgaacttgaaattactc 98148
to top
>gb|AC136687.6| Homo sapiens chromosome 15, clone RP11-439M15, complete sequence
          Length = 180708

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 128    aatgggatggattcattcattcaa 151
              |||||||| |||||||||||||||
Sbjct: 146597 aatgggattgattcattcattcaa 146620
to top
>gb|AC134393.6| Homo sapiens chromosome 15, clone CTC-803A3, complete sequence
          Length = 132353

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 128   aatgggatggattcattcattcaa 151
             |||||||| |||||||||||||||
Sbjct: 74998 aatgggattgattcattcattcaa 74975
to top
>gb|AC131280.9| Homo sapiens chromosome 15, clone RP11-467L19, complete sequence
          Length = 194754

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 128    aatgggatggattcattcattcaa 151
              |||||||| |||||||||||||||
Sbjct: 116188 aatgggattgattcattcattcaa 116211
to top
>dbj|AB154356.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound
           starch synthase I, complete cds
          Length = 4535

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 400 acggacggacgggcgggcgg 381
to top
>dbj|AB118809.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound
           starch synthase I, complete cds, strain:OUH602
          Length = 5190

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 822 acggacggacgggcgggcgg 803
to top
>emb|X07932.1|HVWAXYR Barley mRNA pcwx27 for waxy locus
          Length = 2311

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 133 acggacggacgggcgggcgg 114
to top
>emb|X07931.1|HVWAXYG Barley DNA for waxy locus encoding starch synthase (EC 2.4.1.11)
          Length = 5153

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 938 acggacggacgggcgggcgg 919
to top
>emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 in linkage group 20,
             complete sequence
          Length = 163231

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 204   acggacggacgggcgggcgg 223
             ||||||||||||||||||||
Sbjct: 60247 acggacggacgggcgggcgg 60266
to top
>gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10 of 83 of the complete
             sequence
          Length = 304419

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 204   acggacggacgggcgggcgg 223
             ||||||||||||||||||||
Sbjct: 80644 acggacggacgggcgggcgg 80625
to top
>gb|AC116680.21| Mus musculus chromosome 12, clone RP23-476M16, complete sequence
          Length = 215303

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 6      aactcaactgaacttgaaat 25
              ||||||||||||||||||||
Sbjct: 198046 aactcaactgaacttgaaat 198065
to top
>gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic sequence
          Length = 230278

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 204    acggacggacgggcgggcgg 223
              ||||||||||||||||||||
Sbjct: 161987 acggacggacgggcgggcgg 162006
to top
>emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in linkage group 3, complete
              sequence
          Length = 170964

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 204    acggacggacgggcgggcgg 223
              ||||||||||||||||||||
Sbjct: 119772 acggacggacgggcgggcgg 119791
to top
>gb|AF317103.1| Dumontia alaskana specimen-voucher GWS000917 (UNB) small subunit
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, complete sequence; and
           large subunit ribosomal RNA gene, partial sequence
          Length = 892

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 257 tggggagctgctcgtgggtgcggg 280
           |||||||||||| |||||||||||
Sbjct: 375 tggggagctgctggtgggtgcggg 398
to top
>gb|AF317102.1| Dumontia alaskana specimen-voucher GWS000916 (UNB) small subunit
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, complete sequence; and
           large subunit ribosomal RNA gene, partial sequence
          Length = 892

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 257 tggggagctgctcgtgggtgcggg 280
           |||||||||||| |||||||||||
Sbjct: 375 tggggagctgctggtgggtgcggg 398
to top
>gb|AF317101.1| Dumontia alaskana specimen-voucher G0221 (UNB) small subunit
            ribosomal RNA gene, internal transcribed spacer 1, 5.8S
            ribosomal RNA gene and internal transcribed spacer 2,
            complete sequence; and large subunit ribosomal RNA gene,
            partial sequence
          Length = 2663

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 257  tggggagctgctcgtgggtgcggg 280
            |||||||||||| |||||||||||
Sbjct: 2143 tggggagctgctggtgggtgcggg 2166
to top
>dbj|AB054056.1| Hordeum vulgare waxy gene, partial sequence, cultivar:Shonupana
          Length = 802

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 384 acggacggacgggcgggcgg 365
to top
>dbj|AB054055.2| Hordeum vulgare waxy gene, partial sequence, cultivar:Senbon hadaka
          Length = 1011

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acggacggacgggcgggcgg 223
           ||||||||||||||||||||
Sbjct: 399 acggacggacgggcgggcgg 380
to top
>emb|AL772162.4| Mouse DNA sequence from clone RP23-175J8 on chromosome 2, complete
             sequence
          Length = 100090

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 138   attcattcattcaaagcaaa 157
             ||||||||||||||||||||
Sbjct: 53765 attcattcattcaaagcaaa 53784


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,723,032
Number of Sequences: 3902068
Number of extensions: 2723032
Number of successful extensions: 60225
Number of sequences better than 10.0: 101
Number of HSP's better than 10.0 without gapping: 103
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59980
Number of HSP's gapped (non-prelim): 245
length of query: 290
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 268
effective length of database: 17,147,199,772
effective search space: 4595449538896
effective search space used: 4595449538896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top