Clone Name | rbart21c01 |
---|---|
Clone Library Name | barley_pub |
>gb|AF460219.1| Hordeum vulgare subsp. vulgare nuclear transcription factor SLN1 gene, complete cds Length = 4098 Score = 155 bits (78), Expect = 9e-35 Identities = 153/173 (88%), Gaps = 4/173 (2%) Strand = Plus / Plus Query: 57 aaaatgctanacatacaaagagttacatgaggttatatgctaactaggattctttctttc 116 ||||||||| |||||||||||||||||| |||||| | ||| |||||||||||||||||| Sbjct: 991 aaaatgctagacatacaaagagttacataaggttacaggctgactaggattctttctttc 1050 Query: 117 taactaaccattcccccttgattttcaagggggtgggcccct-attccccttaatctcca 175 ||||||||| ||||||||||||||||| ||| |||| |||| ||| |||||||||| || Sbjct: 1051 taactaacc-gtcccccttgattttcaacgggctggggccctcatttcccttaatcttca 1109 Query: 176 ataaaaact-acctttttatcaaaacctatataaacttatgtatgtgtagcat 227 || |||| | | |||||| | ||||||||| |||||||||||||||||||||| Sbjct: 1110 atcaaaattcatcttttt-taaaaacctatgtaaacttatgtatgtgtagcat 1161
>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome Length = 1899877 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Minus Query: 188 tttttatcaaaacctatataa 208 ||||||||||||||||||||| Sbjct: 819690 tttttatcaaaacctatataa 819670
>emb|AL391995.7| Human DNA sequence from clone RP11-522N4 on chromosome 13, complete sequence Length = 178920 Score = 42.1 bits (21), Expect = 0.89 Identities = 24/25 (96%) Strand = Plus / Plus Query: 199 acctatataaacttatgtatgtgta 223 |||||||||||| |||||||||||| Sbjct: 104780 acctatataaacatatgtatgtgta 104804
>gb|AC162691.2| Mus musculus chromosome 1, clone RP23-263K13, complete sequence Length = 173327 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Plus Query: 189 ttttatcaaaacctatataaa 209 ||||||||||||||||||||| Sbjct: 70720 ttttatcaaaacctatataaa 70740
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 gtggattttgattggagatta 29 ||||||||||||||||||||| Sbjct: 21905688 gtggattttgattggagatta 21905668
>dbj|AP003334.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1114B07 Length = 148060 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 gtggattttgattggagatta 29 ||||||||||||||||||||| Sbjct: 134981 gtggattttgattggagatta 134961
>gb|AC131750.3| Mus musculus BAC clone RP23-34F5 from 1, complete sequence Length = 190325 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Minus Query: 189 ttttatcaaaacctatataaa 209 ||||||||||||||||||||| Sbjct: 27125 ttttatcaaaacctatataaa 27105
>gb|AC161519.11| Mus musculus chromosome 18, clone RP24-83L9, complete sequence Length = 233631 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 204 tataaacttatgtatgtgta 223 |||||||||||||||||||| Sbjct: 72859 tataaacttatgtatgtgta 72878
>gb|AC185999.2| Pan troglodytes BAC clone CH251-186C12 from chromosome 9, complete sequence Length = 169499 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 45067 ttgattttcaagggggtggg 45086
>gb|AC183772.2| Pan troglodytes BAC clone CH251-73E21 from chromosome 9, complete sequence Length = 162544 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 64046 ttgattttcaagggggtggg 64027
>gb|AC116180.4| Mus musculus BAC clone RP24-167M11 from chromosome 9, complete sequence Length = 149442 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 aataaaaactacctttttat 194 |||||||||||||||||||| Sbjct: 70342 aataaaaactacctttttat 70323
>emb|BX284677.8| Human DNA sequence from clone RP11-315E10 on chromosome 9, complete sequence Length = 166687 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 74013 ttgattttcaagggggtggg 73994
>gb|BC036146.1| Mus musculus tissue factor pathway inhibitor, mRNA (cDNA clone MGC:37332 IMAGE:4975683), complete cds Length = 3065 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 ttttgattggagattaaggg 33 |||||||||||||||||||| Sbjct: 2450 ttttgattggagattaaggg 2469
>emb|BX664615.10| Human DNA sequence from clone RP11-104G3 on chromosome 9 Contains a RAB28, member RAS oncogene family pseudogene (RAB28), a pseudogene similar to part of recombining binding protein suppressor of hairless (Drosophila) (RBPSUH), two novel pseudogenes, a pseudogene similar to part of fibroblast growth factor 7 (keratinocyte growth factor) (FGF7), the 3' end of a novel gene and two CpG islands, complete sequence Length = 163837 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 84962 ttgattttcaagggggtggg 84943
>emb|BX664718.7| Human DNA sequence from clone RP11-175I6 on chromosome 9 Conatins a pseudogene similar to part of fibroblast growth factor 7 (keratinocyte growth factor) (FGF7), two novel pseudogenes, a pseudogene similar to part of G protein-coupled receptor 116 (GPR116), a novel gene and a pseudogene similar to part of meprin A, alpha (PABA peptide hydrolase) (MEP1A), complete sequence Length = 167646 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 96120 ttgattttcaagggggtggg 96139
>emb|BX088651.9| Human DNA sequence from clone RP11-475I24 on chromosome 9 Contains a pseudogene similar to part of fibroblast growth factor 7 (keratinocyte growth factor) (FGF7), three novel pseudogenes, two novel genes, a recombining binding protein suppressor of hairless (Drosophila) (RBPSUH) pseudogene, a RAB28, member RAS oncogene family (RAB28) pseudogene and two CpG islands, complete sequence Length = 202891 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 129344 ttgattttcaagggggtggg 129363
>emb|BX005266.6| Human DNA sequence from clone RP11-211N8 on chromosome 9 Contains two novel pseudogenes, two novel genes, a recombining binding protein suppressor of hairless (Drosophila) (RBPSUH) pseudogene, a RAB28, member RAS oncogene family (RAB28) pseudogene and a G protein-coupled receptor, family C, group 5,member B (GPRC5B) pseudogene, complete sequence Length = 157298 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 86575 ttgattttcaagggggtggg 86594
>emb|AL512625.10| Human DNA sequence from clone RP11-262H14 on chromosome 9 Contains three novel genes, a novel pseudogene, two novel pseudogenes (LOC339742), a tumor suppressor deleted in oral cancer-related 1 (DOC-1R) pseudogene, a pseudogene similar to part of prostaglandin E receptor 4 (subtype EP4) (PTGER4), a pseudogene similar to part of myosin VA (heavy polypeptide 12, myoxin) (MYO5A), a pseudogene similar to part of G protein-coupled receptor 116 (GPR116), a pseudogene similar to part of fibroblast growth factor 7 (keratinocyte growth factor) (FGF7) and five CpG islands, complete sequence Length = 159539 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 131814 ttgattttcaagggggtggg 131833
>emb|AL031054.1|HS48G12 Human DNA sequence from clone RP1-48G12 on chromosome Xq27.1-27.3 Contains a CpG island, complete sequence Length = 199016 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 188 tttttatcaaaacctatataaact 211 |||||||||||||| ||||||||| Sbjct: 35122 tttttatcaaaaccaatataaact 35145
>emb|BX649563.5| Human DNA sequence from clone RP11-213O5 on chromosome 9 Contains a pseudogene similar to part of a novel protein (DKFZp434A171), a pseudogene similar to part of meprin A, alpha (PABA peptide hydrolase) (MEP1A), a pseudogene similar to part of a novel transmembrane receptor protein and two novel pseudogenes, complete sequence Length = 189495 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 100040 ttgattttcaagggggtggg 100021
>emb|CR788307.3| Human DNA sequence from clone RP11-384N15 on chromosome 9, complete sequence Length = 166827 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 130557 ttgattttcaagggggtggg 130576
>emb|CR606783.1| full-length cDNA clone CS0DE007YB16 of Placenta of Homo sapiens (human) Length = 1675 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 1325 ttgattttcaagggggtggg 1344
>gb|AY951944.1| Triticum monococcum TmBAC 21C6 FR-Am2 locus, genomic sequence Length = 190469 Score = 40.1 bits (20), Expect = 3.5 Identities = 35/39 (89%), Gaps = 2/39 (5%) Strand = Plus / Minus Query: 105 attctttctttctaactaaccattcccccttgattttca 143 |||||||||||||| |||||||| ||| |||||||||| Sbjct: 181174 attctttctttctagctaaccat--ccctttgattttca 181138 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 205 ataaacttatgtatgtgtagcatt 228 |||||| ||||||||||||||||| Sbjct: 181075 ataaacctatgtatgtgtagcatt 181052
>emb|CT485615.6| Mouse DNA sequence from clone RP23-32L22 on chromosome 16, complete sequence Length = 197249 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 174 caataaaaactacctttttatcaa 197 ||||||||||||| |||||||||| Sbjct: 101333 caataaaaactacatttttatcaa 101356
>emb|BX088717.12| Human DNA sequence from clone RP11-624E13 on chromosome 9, complete sequence Length = 186615 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 ttgattttcaagggggtggg 153 |||||||||||||||||||| Sbjct: 9702 ttgattttcaagggggtggg 9683
>emb|AL356332.1|ATT31P16 Arabidopsis thaliana DNA chromosome 5, BAC clone T31P16 (ESSA project) Length = 80088 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 195 caaaacctatataaacttat 214 |||||||||||||||||||| Sbjct: 56151 caaaacctatataaacttat 56170 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,691,772 Number of Sequences: 3902068 Number of extensions: 3691772 Number of successful extensions: 46028 Number of sequences better than 10.0: 26 Number of HSP's better than 10.0 without gapping: 26 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 45959 Number of HSP's gapped (non-prelim): 67 length of query: 270 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 248 effective length of database: 17,147,199,772 effective search space: 4252505543456 effective search space used: 4252505543456 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)