ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart21b09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC136956.4| Oryza sativa (japonica cultivar-group) chromosome... 44 0.42
2gb|AC129182.4| Mus musculus BAC clone RP23-340P24 from chromosom... 44 0.42
3dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.42
4gb|AC079924.6| Homo sapiens BAC clone RP11-469L8 from 2, complet... 44 0.42
5gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.42
6gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's ... 42 1.7
7gb|AC122485.3| Mus musculus BAC clone RP24-377J10 from chromosom... 42 1.7
8gb|AC161513.5| Mus musculus chromosome 3, clone RP23-238A12, com... 42 1.7
9gb|AC165259.2| Mus musculus BAC clone RP23-146P7 from chromosome... 42 1.7
10gb|AC073856.17| Homo sapiens 3 BAC RP11-938G16 (Roswell Park Can... 42 1.7
11gb|AC158611.7| Mus musculus 10 BAC RP23-29D19 (Roswell Park Canc... 42 1.7
12emb|CR847939.13| Zebrafish DNA sequence from clone CH211-262I1 i... 42 1.7
13gb|AC164630.6| Mus musculus 10 BAC RP23-153M4 (Roswell Park Canc... 42 1.7
14ref|XM_628913.1| Dictyostelium discoideum hypothetical protein (... 40 6.5
15gb|AC107447.5| Rattus norvegicus 4 BAC CH230-46D21 (Children's H... 40 6.5
16gb|AC010212.10| Drosophila melanogaster clone BACR32D05, complet... 40 6.5
17ref|XM_600599.2| PREDICTED: Bos taurus similar to B0507.2 (LOC52... 40 6.5
18ref|XM_536151.2| PREDICTED: Canis familiaris similar to B0507.2 ... 40 6.5
19gb|AC113114.9| Mus musculus chromosome 17, clone RP23-338H10, co... 40 6.5
20gb|AC105071.7| Mus musculus, clone RP23-277C24, complete sequence 40 6.5
21gb|AC098697.4| Rattus norvegicus strain Brown Norway clone RP31-... 40 6.5
22emb|AL109654.22|HSG278N14 Human DNA sequence from clone GS1-278N... 40 6.5
23gb|AC154715.2| Mus musculus BAC clone RP24-361A22 from chromosom... 40 6.5
24emb|AL627279.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 6.5
25emb|CR860996.1| Pongo pygmaeus mRNA; cDNA DKFZp459J0518 (from cl... 40 6.5
26gb|AF401197.1| Acer tegmentosum chloroplast tRNA-Leu gene, parti... 40 6.5
27gb|BC112792.1| Bos taurus cDNA clone IMAGE:8167640, partial cds 40 6.5
28ref|NM_141401.1| Drosophila melanogaster CG2330-RA (CG2330), mRNA 40 6.5
29gb|AC090257.5| Homo sapiens chromosome 15, clone RP11-301A18, co... 40 6.5
30gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete ... 40 6.5
31gb|AC154360.3| Mus musculus BAC clone RP23-167I5 from chromosome... 40 6.5
32gb|AY043214.1| Capsicum annuum RSH-like protein mRNA, complete cds 40 6.5
33gb|AC018787.5|AC018787 Homo sapiens, clone RP11-22O12, complete ... 40 6.5
34gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chr... 40 6.5
35gb|AC114778.5| Homo sapiens BAC clone RP11-516O5 from 2, complet... 40 6.5
36emb|BX248331.8| Zebrafish DNA sequence from clone CH211-236D3 in... 40 6.5
37gb|AC026108.29| Homo sapiens 12 BAC RP11-438H24 (Roswell Park Ca... 40 6.5
38gb|AC079903.26| Homo sapiens 12 BAC RP11-449D7 (Roswell Park Can... 40 6.5
39gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 6.5
40dbj|BS000057.1| Pan troglodytes chromosome 22 clone:RP43-020J03,... 40 6.5
41dbj|BS000056.1| Pan troglodytes chromosome 22 clone:RP43-138K13,... 40 6.5
42gb|AC154848.2| Mus musculus BAC clone RP23-38J19 from 13, comple... 40 6.5
43ref|NM_208465.1| Eremothecium gossypii ABR164Wp (ABR164W), mRNA 40 6.5
44emb|BX321888.21| Zebrafish DNA sequence from clone DKEYP-47D4 in... 40 6.5
45emb|BX296516.3| Zebrafish DNA sequence from clone DKEY-219E20 in... 40 6.5
46gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 6.5
47gb|AE003675.4| Drosophila melanogaster chromosome 3R, section 9 ... 40 6.5
48gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 6.5
49dbj|AP000873.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 6.5
50gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 40 6.5
51emb|CT025639.13| Mouse DNA sequence from clone RP23-233I11 on ch... 40 6.5
52emb|AL732498.15| Mouse DNA sequence from clone RP23-323E6 on chr... 40 6.5
53gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 6.5
54emb|AJ342715.1|HSA342715 Homo sapiens genomic sequence surroundi... 40 6.5
55emb|AJ413101.1|AMO413101 Acer tschonoskii chloroplast tRNA-Leu g... 40 6.5
56emb|AJ413100.1|AMO413100 Acer tschonoskii chloroplast tRNA-Leu g... 40 6.5
57emb|AJ413099.1|AMO413099 Acer rufinerve chloroplast tRNA-Leu gen... 40 6.5
58emb|AJ413098.1|AMO413098 Acer rufinerve chloroplast tRNA-Leu gen... 40 6.5
59emb|AJ413097.1|AMO413097 Acer capillipes chloroplast tRNA-Leu ge... 40 6.5
60emb|AJ413096.1|AMO413096 Acer tegmentosum chloroplast tRNA-Leu g... 40 6.5
61emb|AJ413095.1|AMO413095 Acer tegmentosum chloroplast tRNA-Leu g... 40 6.5
62emb|AJ413094.1|AMO413094 Acer rufinerve chloroplast tRNA-Leu gen... 40 6.5
63emb|AJ413093.1|AMO413093 Acer crataegifolium chloroplast tRNA-Le... 40 6.5
64emb|AJ413092.1|AMO413092 Acer caudatifolium chloroplast tRNA-Leu... 40 6.5
65emb|AJ413091.1|AMO413091 Acer crataegifolium chloroplast tRNA-Le... 40 6.5
66emb|AJ413090.1|AMO413090 Acer capillipes chloroplast tRNA-Leu ge... 40 6.5

>gb|AC136956.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0038B22, complete sequence
          Length = 177557

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 156   taatcataaactcatagcataa 177
             ||||||||||||||||||||||
Sbjct: 94385 taatcataaactcatagcataa 94406



to top

>gb|AC129182.4| Mus musculus BAC clone RP23-340P24 from chromosome 19, complete sequence
          Length = 187601

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 133    aaatcagggaagagagtaaaacataatcat 162
              ||||||| ||||||| ||||||||||||||
Sbjct: 101272 aaatcagagaagagattaaaacataatcat 101243



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 156      taatcataaactcatagcataa 177
                ||||||||||||||||||||||
Sbjct: 19917318 taatcataaactcatagcataa 19917339



to top

>gb|AC079924.6| Homo sapiens BAC clone RP11-469L8 from 2, complete sequence
          Length = 55282

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   aaaatcaaattcagatcttcaa 249
             ||||||||||||||||||||||
Sbjct: 21665 aaaatcaaattcagatcttcaa 21644



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 156      taatcataaactcatagcataa 177
                ||||||||||||||||||||||
Sbjct: 20202297 taatcataaactcatagcataa 20202318



to top

>gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 227955

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    gtttgttttgctatgtagtcc 307
              |||||||||||||||||||||
Sbjct: 210761 gtttgttttgctatgtagtcc 210741



to top

>gb|AC122485.3| Mus musculus BAC clone RP24-377J10 from chromosome 3, complete sequence
          Length = 157739

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 154    cataatcataaactcatagca 174
              |||||||||||||||||||||
Sbjct: 153215 cataatcataaactcatagca 153235



to top

>gb|AC161513.5| Mus musculus chromosome 3, clone RP23-238A12, complete sequence
          Length = 160438

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   cataatcataaactcatagca 174
             |||||||||||||||||||||
Sbjct: 36277 cataatcataaactcatagca 36297



to top

>gb|AC165259.2| Mus musculus BAC clone RP23-146P7 from chromosome 17, complete sequence
          Length = 252045

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   gtttgttttgctatgtagtcc 307
             |||||||||||||||||||||
Sbjct: 75918 gtttgttttgctatgtagtcc 75898



to top

>gb|AC073856.17| Homo sapiens 3 BAC RP11-938G16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 177363

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 221   tcacttgaaaatcaaattcag 241
             |||||||||||||||||||||
Sbjct: 55673 tcacttgaaaatcaaattcag 55653



to top

>gb|AC158611.7| Mus musculus 10 BAC RP23-29D19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 214923

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 285   aggtttgttttgctatgtagt 305
             |||||||||||||||||||||
Sbjct: 50901 aggtttgttttgctatgtagt 50881



to top

>emb|CR847939.13| Zebrafish DNA sequence from clone CH211-262I1 in linkage group 11,
              complete sequence
          Length = 181988

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 256    aatggtttgtttgcctgttgcaaaa 280
              |||| ||||||||||||||||||||
Sbjct: 112038 aatgctttgtttgcctgttgcaaaa 112062



to top

>gb|AC164630.6| Mus musculus 10 BAC RP23-153M4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 187031

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 285   aggtttgttttgctatgtagt 305
             |||||||||||||||||||||
Sbjct: 37625 aggtttgttttgctatgtagt 37645



to top

>ref|XM_628913.1| Dictyostelium discoideum hypothetical protein (DDB0192166), partial
           mRNA
          Length = 1527

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 213 aaatatcttcacttgaaaat 232
           ||||||||||||||||||||
Sbjct: 349 aaatatcttcacttgaaaat 330



to top

>gb|AC107447.5| Rattus norvegicus 4 BAC CH230-46D21 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 133054

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 3    acaacatggatacattttat 22
            ||||||||||||||||||||
Sbjct: 4286 acaacatggatacattttat 4267



to top

>gb|AC010212.10| Drosophila melanogaster clone BACR32D05, complete sequence
          Length = 161579

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 100   ggcaaacacaaacttcttat 119
             ||||||||||||||||||||
Sbjct: 97029 ggcaaacacaaacttcttat 97010



to top

>ref|XM_600599.2| PREDICTED: Bos taurus similar to B0507.2 (LOC522319), partial mRNA
          Length = 1122

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 213 aaatatcttcacttgaaaat 232
           ||||||||||||||||||||
Sbjct: 413 aaatatcttcacttgaaaat 432



to top

>ref|XM_536151.2| PREDICTED: Canis familiaris similar to B0507.2 (LOC478996), mRNA
          Length = 1386

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 213 aaatatcttcacttgaaaat 232
           ||||||||||||||||||||
Sbjct: 868 aaatatcttcacttgaaaat 887



to top

>gb|AC113114.9| Mus musculus chromosome 17, clone RP23-338H10, complete sequence
          Length = 183828

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 446    tgcataaggcttttgaagaa 465
              ||||||||||||||||||||
Sbjct: 111870 tgcataaggcttttgaagaa 111889



to top

>gb|AC105071.7| Mus musculus, clone RP23-277C24, complete sequence
          Length = 199946

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 226    tgaaaatcaaattcagatct 245
              ||||||||||||||||||||
Sbjct: 165693 tgaaaatcaaattcagatct 165674



to top

>gb|AC098697.4| Rattus norvegicus strain Brown Norway clone RP31-387A21, complete
             sequence
          Length = 123000

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    ggatacattttattatttaa 29
             ||||||||||||||||||||
Sbjct: 76876 ggatacattttattatttaa 76857



to top

>emb|AL109654.22|HSG278N14 Human DNA sequence from clone GS1-278N14 on chromosome Xq27.3-28,
             complete sequence
          Length = 182150

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 134   aatcagggaagagagtaaaa 153
             ||||||||||||||||||||
Sbjct: 25750 aatcagggaagagagtaaaa 25769



to top

>gb|AC154715.2| Mus musculus BAC clone RP24-361A22 from chromosome 16, complete
             sequence
          Length = 172362

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 139   gggaagagagtaaaacataa 158
             ||||||||||||||||||||
Sbjct: 84349 gggaagagagtaaaacataa 84368



to top

>emb|AL627279.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
             complete chromosome; segment 15/20
          Length = 264050

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 323   atgtatcgtggtggccgcttatca 346
             |||||||||||||||| |||||||
Sbjct: 16935 atgtatcgtggtggcctcttatca 16912



to top

>emb|CR860996.1| Pongo pygmaeus mRNA; cDNA DKFZp459J0518 (from clone DKFZp459J0518)
          Length = 2032

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 374 tccatctccatgtccaatga 393
           ||||||||||||||||||||
Sbjct: 520 tccatctccatgtccaatga 501



to top

>gb|AF401197.1| Acer tegmentosum chloroplast tRNA-Leu gene, partial sequence; and
           trnL-trnF intergenic spacer region, complete sequence
          Length = 937

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 411 cttttgaagaaccgattgctcaga 434



to top

>gb|BC112792.1| Bos taurus cDNA clone IMAGE:8167640, partial cds
          Length = 1265

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 213  aaatatcttcacttgaaaat 232
            ||||||||||||||||||||
Sbjct: 1085 aaatatcttcacttgaaaat 1104



to top

>ref|NM_141401.1| Drosophila melanogaster CG2330-RA (CG2330), mRNA
          Length = 2606

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 100  ggcaaacacaaacttcttat 119
            ||||||||||||||||||||
Sbjct: 1407 ggcaaacacaaacttcttat 1388



to top

>gb|AC090257.5| Homo sapiens chromosome 15, clone RP11-301A18, complete sequence
          Length = 159299

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 217   atcttcacttgaaaatcaaa 236
             ||||||||||||||||||||
Sbjct: 77158 atcttcacttgaaaatcaaa 77177



to top

>gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete genome
          Length = 859006

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 297    ctatgtagtccttgttcttt 316
              ||||||||||||||||||||
Sbjct: 197757 ctatgtagtccttgttcttt 197776



to top

>gb|AC154360.3| Mus musculus BAC clone RP23-167I5 from chromosome 14, complete sequence
          Length = 198179

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 226    tgaaaatcaaattcagatct 245
              ||||||||||||||||||||
Sbjct: 134544 tgaaaatcaaattcagatct 134563



to top

>gb|AY043214.1| Capsicum annuum RSH-like protein mRNA, complete cds
          Length = 2710

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 291  gttttgctatgtagtccttg 310
            ||||||||||||||||||||
Sbjct: 1893 gttttgctatgtagtccttg 1874



to top

>gb|AC018787.5|AC018787 Homo sapiens, clone RP11-22O12, complete sequence
          Length = 90722

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 217   atcttcacttgaaaatcaaa 236
             ||||||||||||||||||||
Sbjct: 83177 atcttcacttgaaaatcaaa 83196



to top

>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete
             sequence
          Length = 4332241

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 223   acttgaaaatcaaattcaga 242
             ||||||||||||||||||||
Sbjct: 77165 acttgaaaatcaaattcaga 77146



to top

>gb|AC114778.5| Homo sapiens BAC clone RP11-516O5 from 2, complete sequence
          Length = 187842

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 77     cacacacataaattggggaa 96
              ||||||||||||||||||||
Sbjct: 123324 cacacacataaattggggaa 123343



to top

>emb|BX248331.8| Zebrafish DNA sequence from clone CH211-236D3 in linkage group 11,
             complete sequence
          Length = 174071

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tggatacattttattattta 28
             ||||||||||||||||||||
Sbjct: 60932 tggatacattttattattta 60951



to top

>gb|AC026108.29| Homo sapiens 12 BAC RP11-438H24 (Roswell Park Cancer Institute
           Human BAC Library) complete sequence
          Length = 77790

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 5   aacatggatacattttattattta 28
           ||||||||||| ||||||||||||
Sbjct: 361 aacatggatactttttattattta 384



to top

>gb|AC079903.26| Homo sapiens 12 BAC RP11-449D7 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 11273

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 5    aacatggatacattttattattta 28
            ||||||||||| ||||||||||||
Sbjct: 9630 aacatggatactttttattattta 9653



to top

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 323     atgtatcgtggtggccgcttatca 346
               |||||||||||||||| |||||||
Sbjct: 3918251 atgtatcgtggtggcctcttatca 3918274



to top

>dbj|BS000057.1| Pan troglodytes chromosome 22 clone:RP43-020J03, map 22, complete
             sequences
          Length = 185342

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 184   atgcaataaacttcacaatt 203
             ||||||||||||||||||||
Sbjct: 31338 atgcaataaacttcacaatt 31319



to top

>dbj|BS000056.1| Pan troglodytes chromosome 22 clone:RP43-138K13, map 22, complete
             sequences
          Length = 150136

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 184   atgcaataaacttcacaatt 203
             ||||||||||||||||||||
Sbjct: 88386 atgcaataaacttcacaatt 88367



to top

>gb|AC154848.2| Mus musculus BAC clone RP23-38J19 from 13, complete sequence
          Length = 140465

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   ccaaatatcttcacttgaaa 230
             ||||||||||||||||||||
Sbjct: 84091 ccaaatatcttcacttgaaa 84110



to top

>ref|NM_208465.1| Eremothecium gossypii ABR164Wp (ABR164W), mRNA
          Length = 1506

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 262 ttgtttgcctgttgcaaaaa 281
           ||||||||||||||||||||
Sbjct: 893 ttgtttgcctgttgcaaaaa 874



to top

>emb|BX321888.21| Zebrafish DNA sequence from clone DKEYP-47D4 in linkage group 20,
             complete sequence
          Length = 176463

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    agctacataacactttacat 67
             ||||||||||||||||||||
Sbjct: 38961 agctacataacactttacat 38980



to top

>emb|BX296516.3| Zebrafish DNA sequence from clone DKEY-219E20 in linkage group 20,
             complete sequence
          Length = 160555

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    agctacataacactttacat 67
             ||||||||||||||||||||
Sbjct: 59143 agctacataacactttacat 59124



to top

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 323     atgtatcgtggtggccgcttatca 346
               |||||||||||||||| |||||||
Sbjct: 3466593 atgtatcgtggtggcctcttatca 3466570



to top

>gb|AE003675.4| Drosophila melanogaster chromosome 3R, section 9 of 118 of the complete
              sequence
          Length = 145958

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 100    ggcaaacacaaacttcttat 119
              ||||||||||||||||||||
Sbjct: 135498 ggcaaacacaaacttcttat 135479



to top

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 323     atgtatcgtggtggccgcttatca 346
               |||||||||||||||| |||||||
Sbjct: 4075833 atgtatcgtggtggcctcttatca 4075856



to top

>dbj|AP000873.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-727A23, complete
              sequence
          Length = 174905

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 69     aaggacttcacacacataaa 88
              ||||||||||||||||||||
Sbjct: 142547 aaggacttcacacacataaa 142528



to top

>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130,
             chromosome I, complete sequence
          Length = 4277185

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 223   acttgaaaatcaaattcaga 242
             ||||||||||||||||||||
Sbjct: 77368 acttgaaaatcaaattcaga 77349



to top

>emb|CT025639.13| Mouse DNA sequence from clone RP23-233I11 on chromosome 13, complete
              sequence
          Length = 219226

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    ccaaatatcttcacttgaaa 230
              ||||||||||||||||||||
Sbjct: 206313 ccaaatatcttcacttgaaa 206294



to top

>emb|AL732498.15| Mouse DNA sequence from clone RP23-323E6 on chromosome 4, complete
             sequence
          Length = 145881

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 195   ttcacaattgtgtttaccaa 214
             ||||||||||||||||||||
Sbjct: 17472 ttcacaattgtgtttaccaa 17491



to top

>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II,
              complete sequence
          Length = 867699

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 262    ttgtttgcctgttgcaaaaa 281
              ||||||||||||||||||||
Sbjct: 710931 ttgtttgcctgttgcaaaaa 710912



to top

>emb|AJ342715.1|HSA342715 Homo sapiens genomic sequence surrounding NotI site, clone NL1-FA6R
          Length = 761

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 92  gggaaaagggcaaacacaaa 111
           ||||||||||||||||||||
Sbjct: 539 gggaaaagggcaaacacaaa 558



to top

>emb|AJ413101.1|AMO413101 Acer tschonoskii chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1
          Length = 933

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 369 cttttgaagaaccgattgctcaga 392



to top

>emb|AJ413100.1|AMO413100 Acer tschonoskii chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, subsp. koreanum
          Length = 935

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 371 cttttgaagaaccgattgctcaga 394



to top

>emb|AJ413099.1|AMO413099 Acer rufinerve chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 2
          Length = 983

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 420 cttttgaagaaccgattgctcaga 443



to top

>emb|AJ413098.1|AMO413098 Acer rufinerve chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 3
          Length = 939

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 393 cttttgaagaaccgattgctcaga 416



to top

>emb|AJ413097.1|AMO413097 Acer capillipes chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1
          Length = 983

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 438 cttttgaagaaccgattgctcaga 461



to top

>emb|AJ413096.1|AMO413096 Acer tegmentosum chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 2
          Length = 943

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 403 cttttgaagaaccgattgctcaga 426



to top

>emb|AJ413095.1|AMO413095 Acer tegmentosum chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1
          Length = 943

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 403 cttttgaagaaccgattgctcaga 426



to top

>emb|AJ413094.1|AMO413094 Acer rufinerve chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1
          Length = 996

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 444 cttttgaagaaccgattgctcaga 467



to top

>emb|AJ413093.1|AMO413093 Acer crataegifolium chloroplast tRNA-Leu gene (partial) for
           transfer RNA-Leu and trnL-trnF intergenic spacer,
           isolate acc. 1
          Length = 1005

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 460 cttttgaagaaccgattgctcaga 483



to top

>emb|AJ413092.1|AMO413092 Acer caudatifolium chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 1
          Length = 970

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 434 cttttgaagaaccgattgctcaga 457



to top

>emb|AJ413091.1|AMO413091 Acer crataegifolium chloroplast tRNA-Leu gene (partial) for
           transfer RNA-Leu and trnL-trnF intergenic spacer,
           isolate acc. 2
          Length = 952

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 417 cttttgaagaaccgattgctcaga 440



to top

>emb|AJ413090.1|AMO413090 Acer capillipes chloroplast tRNA-Leu gene (partial) for transfer
           RNA-Leu and trnL-trnF intergenic spacer, isolate acc. 2
          Length = 957

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 455 cttttgaagaacccattgctcaga 478
           ||||||||||||| ||||||||||
Sbjct: 420 cttttgaagaaccgattgctcaga 443


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,161,425
Number of Sequences: 3902068
Number of extensions: 6161425
Number of successful extensions: 125128
Number of sequences better than 10.0: 66
Number of HSP's better than 10.0 without gapping: 66
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 124826
Number of HSP's gapped (non-prelim): 302
length of query: 483
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 461
effective length of database: 17,147,199,772
effective search space: 7904859094892
effective search space used: 7904859094892
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top