ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart21b04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC157099.5| Mus musculus 6 BAC RP24-467O4 (Roswell Park Cance... 42 0.93
2gb|AC159712.7| Mus musculus BAC RP23-236J3 (Roswell Park Cancer... 42 0.93
3gb|AC183664.3| Pan troglodytes BAC clone CH251-645D10 from chrom... 40 3.7
4emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome 40 3.7
5gb|AC129304.6| Mus musculus BAC clone RP24-462H23 from chromosom... 40 3.7
6gb|AC122018.4| Mus musculus BAC clone RP24-361O20 from chromosom... 40 3.7
7gb|AC125234.4| Mus musculus BAC clone RP23-14K16 from 13, comple... 40 3.7
8gb|AF186190.4| Homo sapiens chromosome 8 clone CTC-369M3 map 8q2... 40 3.7
9gb|AF192304.6| Homo sapiens chromosome 8 clone CTC-458A3 map 8q2... 40 3.7
10gb|AC012385.28| Homo sapiens 12 BAC RP11-350A5 (Roswell Park Can... 40 3.7
11gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 3.7
12gb|AC137692.4| Mus musculus BAC clone RP24-323P9 from 13, comple... 40 3.7

>gb|AC157099.5| Mus musculus 6 BAC RP24-467O4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 173237

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   ccctgtcccagtcaaaccagc 198
             |||||||||||||||||||||
Sbjct: 71854 ccctgtcccagtcaaaccagc 71874



to top

>gb|AC159712.7| Mus musculus  BAC RP23-236J3 (Roswell Park Cancer Institute (C57BL/6J
            Female) Mouse BAC Library) complete sequence
          Length = 221910

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 178  ccctgtcccagtcaaaccagc 198
            |||||||||||||||||||||
Sbjct: 1543 ccctgtcccagtcaaaccagc 1523



to top

>gb|AC183664.3| Pan troglodytes BAC clone CH251-645D10 from chromosome 12, complete
             sequence
          Length = 176676

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 24    ctgtctctgctctgcatttt 43
             ||||||||||||||||||||
Sbjct: 16253 ctgtctctgctctgcatttt 16272



to top

>emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome
          Length = 1395502

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 175    cctccctgtcccagtcaaac 194
              ||||||||||||||||||||
Sbjct: 185942 cctccctgtcccagtcaaac 185961



to top

>gb|AC129304.6| Mus musculus BAC clone RP24-462H23 from chromosome 10, complete sequence
          Length = 153772

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    ctccctgtcccagtcaaacc 195
              ||||||||||||||||||||
Sbjct: 117909 ctccctgtcccagtcaaacc 117928



to top

>gb|AC122018.4| Mus musculus BAC clone RP24-361O20 from chromosome 10, complete
             sequence
          Length = 173543

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   ctccctgtcccagtcaaacc 195
             ||||||||||||||||||||
Sbjct: 51665 ctccctgtcccagtcaaacc 51684



to top

>gb|AC125234.4| Mus musculus BAC clone RP23-14K16 from 13, complete sequence
          Length = 209715

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 26     gtctctgctctgcattttat 45
              ||||||||||||||||||||
Sbjct: 183898 gtctctgctctgcattttat 183879



to top

>gb|AF186190.4| Homo sapiens chromosome 8 clone CTC-369M3 map 8q24.3 , complete
             sequence
          Length = 152405

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 261   ctggctgcacgtcaggagcc 280
             ||||||||||||||||||||
Sbjct: 46980 ctggctgcacgtcaggagcc 46961



to top

>gb|AF192304.6| Homo sapiens chromosome 8 clone CTC-458A3 map 8q24.3, complete sequence
          Length = 177028

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 261    ctggctgcacgtcaggagcc 280
              ||||||||||||||||||||
Sbjct: 136443 ctggctgcacgtcaggagcc 136424



to top

>gb|AC012385.28| Homo sapiens 12 BAC RP11-350A5 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 24001

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 24   ctgtctctgctctgcatttt 43
            ||||||||||||||||||||
Sbjct: 9230 ctgtctctgctctgcatttt 9211



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 223     gctgggcctgccggcgccgg 242
               ||||||||||||||||||||
Sbjct: 4422934 gctgggcctgccggcgccgg 4422915



to top

>gb|AC137692.4| Mus musculus BAC clone RP24-323P9 from 13, complete sequence
          Length = 180677

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 26     gtctctgctctgcattttat 45
              ||||||||||||||||||||
Sbjct: 102801 gtctctgctctgcattttat 102820


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,827,511
Number of Sequences: 3902068
Number of extensions: 1827511
Number of successful extensions: 31185
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31143
Number of HSP's gapped (non-prelim): 42
length of query: 281
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 259
effective length of database: 17,147,199,772
effective search space: 4441124740948
effective search space used: 4441124740948
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top