ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart20g02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full... 272 8e-70
2ref|XM_483167.1| Oryza sativa (japonica cultivar-group), mRNA 153 5e-34
3ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group... 153 5e-34
4ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group... 153 5e-34
5gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 153 5e-34
6dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for ... 153 5e-34
7dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 153 5e-34
8dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic D... 153 5e-34
9dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 5e-34
10dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 5e-34
11dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 5e-34
12gb|AY108449.1| Zea mays PCO131734 mRNA sequence 98 3e-17
13gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full ... 68 2e-08
14gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase m... 66 1e-07
15emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyl... 64 4e-07
16gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full ... 64 4e-07
17dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
18dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
19dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
20dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
21gb|AY104406.1| Zea mays PCO108855 mRNA sequence 64 4e-07
22gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methy... 64 4e-07
23gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-met... 64 4e-07
24gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-meth... 64 4e-07
25gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-m... 64 4e-07
26gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3... 64 4e-07
27gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3... 64 4e-07
28gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltr... 64 4e-07
29gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltra... 64 4e-07
30gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) ... 64 4e-07
31gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line)... 64 4e-07
32gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltran... 64 4e-07
33gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltra... 64 4e-07
34gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltran... 64 4e-07
35gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltran... 64 4e-07
36gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-met... 64 4e-07
37gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltrans... 64 4e-07
38gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-meth... 64 4e-07
39gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltrans... 64 4e-07
40gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltra... 64 4e-07
41gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltr... 64 4e-07
42gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltran... 64 4e-07
43gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltra... 64 4e-07
44gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methylt... 64 4e-07
45gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methylt... 64 4e-07
46gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltrans... 64 4e-07
47gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltrans... 64 4e-07
48gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltra... 64 4e-07
49gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltr... 64 4e-07
50gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltr... 64 4e-07
51gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltra... 64 4e-07
52gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltra... 64 4e-07
53gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltran... 64 4e-07
54gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltra... 64 4e-07
55gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltra... 64 4e-07
56gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 62 2e-06
57dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
58dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
59dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
60dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
61emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyl... 56 9e-05
62gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase ... 56 9e-05
63gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase ... 56 9e-05
64gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (... 56 9e-05
65gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferas... 56 9e-05
66gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (c... 56 9e-05
67gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransfera... 56 9e-05
68gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransf... 56 9e-05
69gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransfe... 56 9e-05
70gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase ... 56 9e-05
71gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase... 56 9e-05
72gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase... 56 9e-05
73gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (... 56 9e-05
74gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (... 56 9e-05
75gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (... 56 9e-05
76gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferas... 56 9e-05
77gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase ... 56 9e-05
78gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase ... 56 9e-05
79gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferas... 56 9e-05
80gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase... 56 9e-05
81gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase... 56 9e-05
82gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase ... 56 9e-05
83gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (c... 56 9e-05
84gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase ... 56 9e-05
85gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase ... 56 9e-05
86gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (... 56 9e-05
87gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransfer... 56 9e-05
88gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransf... 56 9e-05
89gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransfe... 56 9e-05
90gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltran... 56 9e-05
91gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyl... 56 9e-05
92gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransfe... 56 9e-05
93gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransfe... 56 9e-05
94gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 48 0.023
95dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.023
96dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 46 0.089
97gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.35
98gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.35
99gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 44 0.35
100dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
101dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O... 44 0.35
102dbj|AK062452.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.35
103ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
104ref|XM_483170.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.4
105ref|XM_483169.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.4
106gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543... 42 1.4
107gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 42 1.4
108emb|AL138917.11| Human DNA sequence from clone RP3-354M18 on chr... 42 1.4
109dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
110dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
111gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, c... 40 5.5
112gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 5.5
113gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosom... 40 5.5
114gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 5.5
115gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, co... 40 5.5
116gb|AY657045.1| Synthetic construct Peudomonas aeruginosa clone F... 40 5.5
117gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete... 40 5.5
118gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 40 5.5
119emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete ch... 40 5.5
120emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chr... 40 5.5
121emb|AL603964.2| Human DNA sequence from clone RP13-13L9 on chrom... 40 5.5
122emb|AL513342.7| Human DNA sequence from clone RP11-96F14 on chro... 40 5.5
123gb|CP000316.1| Polaromonas sp. JS666, complete genome 40 5.5
124emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on ch... 40 5.5
125gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 5.5
126emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin hea... 40 5.5
127emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete ... 40 5.5
128emb|AJ417789.1|PSP417789 Polytomella sp. 'Pringsheim 198.80' mRN... 40 5.5
129gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, comp... 40 5.5
130gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 5.5
131gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 5.5
132gb|AC092118.3| Homo sapiens chromosome 16 clone CTD-2600O9, comp... 40 5.5
133dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 5.5
134gb|AE004939.1| Pseudomonas aeruginosa PAO1, section 500 of 529 o... 40 5.5
135gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical... 40 5.5
136dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 5.5
137gb|AY104670.1| Zea mays PCO117754 mRNA sequence 40 5.5
138dbj|AB070936.1| Streptomyces avermitilis siderophore biosyntheti... 40 5.5 
>gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full insert mRNA
           sequence
          Length = 953

 Score =  272 bits (137), Expect = 8e-70
 Identities = 161/169 (95%)
 Strand = Plus / Minus

                                                                       
Query: 243 cgcccgtctagacaacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaa 302
           |||||| |||||| | |||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 816 cgcccgcctagacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcaga 757

                                                                       
Query: 303 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggaaaagc 362
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 756 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcggagaagc 697

                                                            
Query: 363 gggtgtcgaggtcggacaagggcgtgcccgccggcagcgccaccgtgcc 411
           |||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 696 gggtgtcgaggtcggacatgggggtgcccgccggcagcgccaccgtgcc 648



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 150 aataatacaattgattaagggaagcggctggtaaggaa 187
           |||||||||||||||||||  |||||||||||||||||
Sbjct: 927 aataatacaattgattaagataagcggctggtaaggaa 890
to top
>ref|XM_483167.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 996

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Minus

                                                                       
Query: 259 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
           ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 820 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 761

                                                                       
Query: 319 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
           |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 760 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 701

                                            
Query: 379 caagggcgtgcccgccggcagcgccaccgtgcc 411
           ||  |||||| ||| ||||||||||||||||||
Sbjct: 700 cagcggcgtgtccggcggcagcgccaccgtgcc 668
to top
>ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA
          Length = 1096

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Minus

                                                                       
Query: 259 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
           ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 827 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 768

                                                                       
Query: 319 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
           |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 767 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 708

                                            
Query: 379 caagggcgtgcccgccggcagcgccaccgtgcc 411
           ||  |||||| ||| ||||||||||||||||||
Sbjct: 707 cagcggcgtgtccggcggcagcgccaccgtgcc 675
to top
>ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA
          Length = 1098

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Minus

                                                                       
Query: 259 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
           ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 829 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 770

                                                                       
Query: 319 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
           |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 769 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 710

                                            
Query: 379 caagggcgtgcccgccggcagcgccaccgtgcc 411
           ||  |||||| ||| ||||||||||||||||||
Sbjct: 709 cagcggcgtgtccggcggcagcgccaccgtgcc 677
to top
>gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA20) gene, complete cds
          Length = 1158

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Minus

                                                                        
Query: 259  gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
            ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 1049 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 990

                                                                        
Query: 319  ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
            |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 989  ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 930

                                             
Query: 379  caagggcgtgcccgccggcagcgccaccgtgcc 411
            ||  |||||| ||| ||||||||||||||||||
Sbjct: 929  cagcggcgtgtccggcggcagcgccaccgtgcc 897
to top
>dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for caffeoyl-CoA
           3-O-methyltransferase, complete cds, clone: 12FPR057
          Length = 976

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Minus

                                                                       
Query: 259 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
           ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 797 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 738

                                                                       
Query: 319 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
           |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 737 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 678

                                            
Query: 379 caagggcgtgcccgccggcagcgccaccgtgcc 411
           ||  |||||| ||| ||||||||||||||||||
Sbjct: 677 cagcggcgtgtccggcggcagcgccaccgtgcc 645
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Plus

                                                                            
Query: 259      gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
                ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 24579640 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 24579699

                                                                            
Query: 319      ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
                |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 24579700 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 24579759

                                                 
Query: 379      caagggcgtgcccgccggcagcgccaccgtgcc 411
                ||  |||||| ||| ||||||||||||||||||
Sbjct: 24579760 cagcggcgtgtccggcggcagcgccaccgtgcc 24579792



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                            
Query: 259      gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
                ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 24590673 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 24590732

                                    
Query: 319      ggcggcgagcttggcgttga 338
                |||||||| | |||||||||
Sbjct: 24590733 ggcggcgaccatggcgttga 24590752



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 310      gcgcgggtcggcggcgagcttggcgttga 338
                |||||||||| |||||| |||||||||||
Sbjct: 24586325 gcgcgggtcgccggcgatcttggcgttga 24586353
to top
>dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0026F07
          Length = 137354

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Plus

                                                                         
Query: 259   gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
             ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 87900 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 87959

                                                                         
Query: 319   ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
             |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 87960 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 88019

                                              
Query: 379   caagggcgtgcccgccggcagcgccaccgtgcc 411
             ||  |||||| ||| ||||||||||||||||||
Sbjct: 88020 cagcggcgtgtccggcggcagcgccaccgtgcc 88052



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                         
Query: 259   gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
             ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 98933 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 98992

                                 
Query: 319   ggcggcgagcttggcgttga 338
             |||||||| | |||||||||
Sbjct: 98993 ggcggcgaccatggcgttga 99012



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 310   gcgcgggtcggcggcgagcttggcgttga 338
             |||||||||| |||||| |||||||||||
Sbjct: 94585 gcgcgggtcgccggcgatcttggcgttga 94613
to top
>dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C03, full
           insert sequence
          Length = 1096

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Minus

                                                                       
Query: 259 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
           ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 827 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 768

                                                                       
Query: 319 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
           |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 767 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 708

                                            
Query: 379 caagggcgtgcccgccggcagcgccaccgtgcc 411
           ||  |||||| ||| ||||||||||||||||||
Sbjct: 707 cagcggcgtgtccggcggcagcgccaccgtgcc 675
to top
>dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-F10, full
           insert sequence
          Length = 996

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Minus

                                                                       
Query: 259 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
           ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 820 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 761

                                                                       
Query: 319 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
           |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 760 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 701

                                            
Query: 379 caagggcgtgcccgccggcagcgccaccgtgcc 411
           ||  |||||| ||| ||||||||||||||||||
Sbjct: 700 cagcggcgtgtccggcggcagcgccaccgtgcc 668
to top
>dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093N24, full
           insert sequence
          Length = 1098

 Score =  153 bits (77), Expect = 5e-34
 Identities = 134/153 (87%)
 Strand = Plus / Minus

                                                                       
Query: 259 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
           ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||
Sbjct: 829 gcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgcgggtc 770

                                                                       
Query: 319 ggcggcgagcttggcgttgaggtccctgagggcggcggaaaagcgggtgtcgaggtcgga 378
           |||||||||| ||| |||||||||||||| |||| |||| || |    ||| ||||| ||
Sbjct: 769 ggcggcgagcctggagttgaggtccctgatggcgacggagaacctccggtccaggtccga 710

                                            
Query: 379 caagggcgtgcccgccggcagcgccaccgtgcc 411
           ||  |||||| ||| ||||||||||||||||||
Sbjct: 709 cagcggcgtgtccggcggcagcgccaccgtgcc 677
to top
>gb|AY108449.1| Zea mays PCO131734 mRNA sequence
          Length = 1072

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 55/57 (96%)
 Strand = Plus / Minus

                                                                    
Query: 252 agacaacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcga 308
           |||| |||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 822 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 766
to top
>gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full insert mRNA
           sequence
          Length = 1078

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggt 317
           |||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| |||| |||
Sbjct: 874 cgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcgctggt 815

                     
Query: 318 cggcggcgag 327
           ||||||||||
Sbjct: 814 cggcggcgag 805
to top
>gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase mRNA, partial cds
          Length = 607

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 260 cggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtcg 319
           |||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| ||||||
Sbjct: 361 cggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcgggggtcg 302

                    
Query: 320 gcggcgagc 328
            ||||||||
Sbjct: 301 acggcgagc 293
to top
>emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene),
           1136 BP
          Length = 1136

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 257 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
           ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 858 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 799

                       
Query: 317 tcggcggcgagc 328
           ||||||||||||
Sbjct: 798 tcggcggcgagc 787
to top
>gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full insert mRNA
           sequence
          Length = 1118

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 257 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
           ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 859 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 800

                       
Query: 317 tcggcggcgagc 328
           ||||||||||||
Sbjct: 799 tcggcggcgagc 788
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 257      acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 300
                |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 18420524 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 18420567
to top
>dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0463G11
          Length = 154188

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                          
Query: 257    acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 300
              |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 135260 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 135303
to top
>dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0463D04
          Length = 145828

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 257   acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 300
             |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 82398 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 82441
to top
>dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-F02, full
           insert sequence
          Length = 959

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 257 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 300
           |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 817 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 774
to top
>gb|AY104406.1| Zea mays PCO108855 mRNA sequence
          Length = 1146

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 257 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
           ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 864 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 805

                       
Query: 317 tcggcggcgagc 328
           ||||||||||||
Sbjct: 804 tcggcggcgagc 793
to top
>gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1320

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1293 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1234

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1233 tcggcggcgagc 1222
to top
>gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1219 tcggcggcgagc 1208
to top
>gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1308

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1281 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1222

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1221 tcggcggcgagc 1210
to top
>gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1314

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1287 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1228

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1227 tcggcggcgagc 1216
to top
>gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3-O-methyltransferase
            1 (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1224 tcggcggcgagc 1213
to top
>gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3-O-methyltransferase
            1 (ccoaomt1) gene, complete cds
          Length = 1309

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1282 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1223

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1222 tcggcggcgagc 1211
to top
>gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1224 tcggcggcgagc 1213
to top
>gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) caffeoyl-CoA
            3-O-methyltransferase 1 (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line) caffeoyl-CoA
            3-O-methyltransferase 1 (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1219 tcggcggcgagc 1208
to top
>gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1224 tcggcggcgagc 1213
to top
>gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1309

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1282 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1223

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1222 tcggcggcgagc 1211
to top
>gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1314

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1287 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1228

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1227 tcggcggcgagc 1216
to top
>gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1224 tcggcggcgagc 1213
to top
>gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1537

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1549

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1284 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1225

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1224 tcggcggcgagc 1213
to top
>gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1536

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1544

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1219 tcggcggcgagc 1208
to top
>gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1546

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1281 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1222

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1221 tcggcggcgagc 1210
to top
>gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1537

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1272 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1213

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1212 tcggcggcgagc 1201
to top
>gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1271 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1212

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1211 tcggcggcgagc 1200
to top
>gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1306

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1219 tcggcggcgagc 1208
to top
>gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1309

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1282 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1223

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1222 tcggcggcgagc 1211
to top
>gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1279 acgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1220

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1219 tcggcggcgagc 1208
to top
>gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA1) gene, complete cds
          Length = 1272

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| |||  ||
Sbjct: 1165 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 1106

                       
Query: 317  tcggcggcgag 327
            |||||||||||
Sbjct: 1105 tcggcggcgag 1095
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                           
Query: 257     acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
               ||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| |||  ||
Sbjct: 3314238 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 3314179

                          
Query: 317     tcggcggcgag 327
               |||||||||||
Sbjct: 3314178 tcggcggcgag 3314168
to top
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0015I14
          Length = 150650

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                          
Query: 257    acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
              ||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| |||  ||
Sbjct: 101601 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 101542

                         
Query: 317    tcggcggcgag 327
              |||||||||||
Sbjct: 101541 tcggcggcgag 101531
to top
>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone P0680A03
          Length = 156054

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            ||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| |||  ||
Sbjct: 5792 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 5733

                       
Query: 317  tcggcggcgag 327
            |||||||||||
Sbjct: 5732 tcggcggcgag 5722
to top
>dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039L12, full
           insert sequence
          Length = 1052

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 257 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
           ||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| |||  ||
Sbjct: 846 acgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtgg 787

                      
Query: 317 tcggcggcgag 327
           |||||||||||
Sbjct: 786 tcggcggcgag 776
to top
>emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene),
           1167 BP
          Length = 1167

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                       
Query: 257 acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
           |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 858 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 799

                       
Query: 317 tcggcggcgagc 328
           ||||||||||||
Sbjct: 798 tcggcggcgagc 787
to top
>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1083 tcggcggcgagc 1072
to top
>gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1136

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1069 tcggcggcgagc 1058
to top
>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1083 tcggcggcgagc 1072
to top
>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1152

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1145 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1086

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1085 tcggcggcgagc 1074
to top
>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1145

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1138 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1079

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1078 tcggcggcgagc 1067
to top
>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1083 tcggcggcgagc 1072
to top
>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1222

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1155 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1096

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1095 tcggcggcgagc 1084
to top
>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1209

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1155 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1096

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1095 tcggcggcgagc 1084
to top
>gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1172

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1105 tcggcggcgagc 1094
to top
>gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1181

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1069 tcggcggcgagc 1058
to top
>gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1172

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1105 tcggcggcgagc 1094
to top
>gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1181

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1069 tcggcggcgagc 1058
to top
>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1152

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1145 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1086

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1085 tcggcggcgagc 1074
to top
>gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1445

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1105 tcggcggcgagc 1094
to top
>gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1438

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1161 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1102

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1101 tcggcggcgagc 1090
to top
>gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1451

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1168 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1109

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1108 tcggcggcgagc 1097
to top
>gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1442

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1105 tcggcggcgagc 1094
to top
>gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1445

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1105 tcggcggcgagc 1094
to top
>gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1444

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1105 tcggcggcgagc 1094
to top
>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1463

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1181 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1122

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1121 tcggcggcgagc 1110
to top
>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1464

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1181 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1122

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1121 tcggcggcgagc 1110
to top
>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1434

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1151 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1092

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1091 tcggcggcgagc 1080
to top
>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1083 tcggcggcgagc 1072
to top
>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1143 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1084

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1083 tcggcggcgagc 1072
to top
>gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1136

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1069 tcggcggcgagc 1058
to top
>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1153

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1146 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1087

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1086 tcggcggcgagc 1075
to top
>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1182

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1175 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1116

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1115 tcggcggcgagc 1104
to top
>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1206

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1155 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1096

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1095 tcggcggcgagc 1084
to top
>gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1172

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1105 tcggcggcgagc 1094
to top
>gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyltransferase
            (ccoaomt2) gene, complete cds
          Length = 1172

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1165 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1106

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1105 tcggcggcgagc 1094
to top
>gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1181

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1129 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1070

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1069 tcggcggcgagc 1058
to top
>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1451

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 257  acgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcggg 316
            |||||||||||||  |||||||||||| ||| || ||||||||| | ||||| |||   |
Sbjct: 1172 acgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtcg 1113

                        
Query: 317  tcggcggcgagc 328
            ||||||||||||
Sbjct: 1112 tcggcggcgagc 1101
to top
>gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA26) gene, complete cds
          Length = 1116

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 259  gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
            ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 1007 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 948

                                
Query: 319  ggcggcgagcttggcgttga 338
            |||||||| | |||||||||
Sbjct: 947  ggcggcgaccatggcgttga 928
to top
>dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-A04, full
            insert sequence
          Length = 1895

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 259  gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 318
            ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 1671 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 1612

                                
Query: 319  ggcggcgagcttggcgttga 338
            |||||||| | |||||||||
Sbjct: 1611 ggcggcgaccatggcgttga 1592
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 46.1 bits (23), Expect = 0.089
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 302     acctcgatgcgcgggtcggcggc 324
               |||||||||||||||||||||||
Sbjct: 4035539 acctcgatgcgcgggtcggcggc 4035517
to top
>gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0099O15,
              complete sequence
          Length = 137357

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 57     ccctctcctctcatcaaatttc 78
              ||||||||||||||||||||||
Sbjct: 118827 ccctctcctctcatcaaatttc 118848
to top
>gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1004_E02,
            complete sequence
          Length = 127642

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 57   ccctctcctctcatcaaatttc 78
            ||||||||||||||||||||||
Sbjct: 9747 ccctctcctctcatcaaatttc 9768
to top
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 317     tcggcggcgagcttggcgttga 338
               ||||||||||||||||||||||
Sbjct: 4580941 tcggcggcgagcttggcgttga 4580920



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 391     cgccggcagcgccaccgtgc 410
               ||||||||||||||||||||
Sbjct: 2819105 cgccggcagcgccaccgtgc 2819124
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 57       ccctctcctctcatcaaatttc 78
                ||||||||||||||||||||||
Sbjct: 23728874 ccctctcctctcatcaaatttc 23728895
to top
>dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O-methyltransferase,
           partial cds
          Length = 622

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 258 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggt 317
           ||||||||||||  |||| ||||||| ||| || ||||||||| | ||||| |||   ||
Sbjct: 387 cgcggcggcagagtgtgatgccgtcgccgacggggagctggcagatctcgacgcggtcgt 328

                     
Query: 318 cggcggcgag 327
           ||||||||||
Sbjct: 327 cggcggcgag 318
to top
>dbj|AK062452.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-103-C05, full
           insert sequence
          Length = 551

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 57  ccctctcctctcatcaaatttc 78
           ||||||||||||||||||||||
Sbjct: 216 ccctctcctctcatcaaatttc 195
to top
>ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.26-2
           mRNA
          Length = 1149

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 310 gcgcgggtcggcggcgagcttggcgttga 338
           |||||||||| |||||| |||||||||||
Sbjct: 887 gcgcgggtcgccggcgatcttggcgttga 859
to top
>ref|XM_483170.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 612

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 310 gcgcgggtcggcggcgagcttggcgttga 338
           |||||||||| |||||| |||||||||||
Sbjct: 552 gcgcgggtcgccggcgatcttggcgttga 524
to top
>ref|XM_483169.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 879

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 310 gcgcgggtcggcggcgagcttggcgttga 338
           |||||||||| |||||| |||||||||||
Sbjct: 819 gcgcgggtcgccggcgatcttggcgttga 791
to top
>gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543 cytochrome b
           gene, partial cds; mitochondrial
          Length = 800

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 142 cagggaaaaataatacaattg 162
           |||||||||||||||||||||
Sbjct: 742 cagggaaaaataatacaattg 722
to top
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 320    gcggcgagcttggcgttgagg 340
              |||||||||||||||||||||
Sbjct: 363316 gcggcgagcttggcgttgagg 363296
to top
>emb|AL138917.11| Human DNA sequence from clone RP3-354M18 on chromosome 6 Contains the
             5' end of the APG5L gene for APG5 autophagy 5-like (S.
             cerevisiae) and a CpG island, complete sequence
          Length = 34768

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 85    aaaaaagtattattgaaaact 105
             |||||||||||||||||||||
Sbjct: 11155 aaaaaagtattattgaaaact 11175
to top
>dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013030H15, full
            insert sequence
          Length = 1466

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 310  gcgcgggtcggcggcgagcttggcgttga 338
            |||||||||| |||||| |||||||||||
Sbjct: 1040 gcgcgggtcgccggcgatcttggcgttga 1012
to top
>dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-A06, full
           insert sequence
          Length = 1149

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 310 gcgcgggtcggcggcgagcttggcgttga 338
           |||||||||| |||||| |||||||||||
Sbjct: 887 gcgcgggtcgccggcgatcttggcgttga 859
to top
>gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, complete sequence
          Length = 178820

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    ccactcctccctctcctctc 68
             ||||||||||||||||||||
Sbjct: 73124 ccactcctccctctcctctc 73105
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 307    gatgcgcgggtcggcggcga 326
              ||||||||||||||||||||
Sbjct: 369896 gatgcgcgggtcggcggcga 369877
to top
>gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosome 17, complete sequence
          Length = 216585

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 49     ccactcctccctctcctctc 68
              ||||||||||||||||||||
Sbjct: 160872 ccactcctccctctcctctc 160891
to top
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 305     tcgatgcgcgggtcggcggcgagc 328
               ||||||||||| ||||||||||||
Sbjct: 1810413 tcgatgcgcggctcggcggcgagc 1810390
to top
>gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, complete sequence
          Length = 216191

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 145    ggaaaaataatacaattgattaag 168
              ||||||||||| ||||||||||||
Sbjct: 154435 ggaaaaataatgcaattgattaag 154412
to top
>gb|AY657045.1| Synthetic construct Peudomonas aeruginosa clone FLH031886.01F
           PA5269 gene, partial cds
          Length = 276

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 315 ggtcggcggcgagcttggcgttga 338
           |||||||||||||| |||||||||
Sbjct: 208 ggtcggcggcgagcatggcgttga 185
to top
>gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete sequence
          Length = 133237

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 143    agggaaaaataatacaattgatta 166
              ||||||||||||||||||| ||||
Sbjct: 111187 agggaaaaataatacaatttatta 111164
to top
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence
          Length = 2580084

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 391     cgccggcagcgccaccgtgc 410
               ||||||||||||||||||||
Sbjct: 1734234 cgccggcagcgccaccgtgc 1734215
to top
>emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete chromosome; segment 11/12
          Length = 333800

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 304    ctcgatgcgcgggtcggcggcgag 327
              ||||||||||| ||||||||||||
Sbjct: 116899 ctcgatgcgcgtgtcggcggcgag 116922
to top
>emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chromosome 1 Contains the 3'
              end of the KCNN3 gene for potassium intermediate/small
              conductance calcium-activated channel, subfamily N, member
              3, a novel gene and the 5' end of the ADAR gene for
              adenosine deaminase, RNA-specific, complete sequence
          Length = 173014

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 51     actcctccctctcctctcatcaaa 74
              |||||||||||||| |||||||||
Sbjct: 107848 actcctccctctcccctcatcaaa 107871
to top
>emb|AL603964.2| Human DNA sequence from clone RP13-13L9 on chromosome 6, complete
            sequence
          Length = 26986

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 49   ccactcctccctctcctctcatca 72
            |||||| |||||||||||||||||
Sbjct: 3590 ccactcttccctctcctctcatca 3613
to top
>emb|AL513342.7| Human DNA sequence from clone RP11-96F14 on chromosome 1 Contains part
             of the FMN2 gene for formin 2, complete sequence
          Length = 127208

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 51    actcctccctctcctctcat 70
             ||||||||||||||||||||
Sbjct: 48178 actcctccctctcctctcat 48159
to top
>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 351    cggcggaaaagcgggtgtcgaggt 374
              ||||||||||||||||||| ||||
Sbjct: 753080 cggcggaaaagcgggtgtccaggt 753103
to top
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the 5'
              end of the RORB gene for RAR-related orphan receptor B
              protein (RZRB, ROR-BETA), two novel genes and two CpG
              islands, complete sequence
          Length = 174874

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     tttaagagtacagtacataa 42
              ||||||||||||||||||||
Sbjct: 106430 tttaagagtacagtacataa 106411
to top
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 259    gcggcggcagatggtgacgccgtc 282
              ||||||||||||||||| ||||||
Sbjct: 427746 gcggcggcagatggtgaggccgtc 427723
to top
>emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin heavy chain gene
          Length = 5894

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 324  cgagcttggcgttgaggtccctgagggcggcg 355
            ||||||||||||||  |||| |||||||||||
Sbjct: 3847 cgagcttggcgttggcgtccttgagggcggcg 3816
to top
>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29
          Length = 313800

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 305  tcgatgcgcgggtcggcggcgagc 328
            |||| |||||||||||||||||||
Sbjct: 2353 tcgaagcgcgggtcggcggcgagc 2330
to top
>emb|AJ417789.1|PSP417789 Polytomella sp. 'Pringsheim 198.80' mRNA for aldehyde dehydrogenase
           (aldh gene)
          Length = 2164

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 317 tcggcggcgagcttggcgttgagg 340
           |||||||||||||||||| |||||
Sbjct: 767 tcggcggcgagcttggcgatgagg 744
to top
>gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, complete sequence
          Length = 214780

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    cactcctccctctcctctca 69
             ||||||||||||||||||||
Sbjct: 84202 cactcctccctctcctctca 84221
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 391     cgccggcagcgccaccgtgc 410
               ||||||||||||||||||||
Sbjct: 3170008 cgccggcagcgccaccgtgc 3169989
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 355    ggaaaagcgggtgtcgaggt 374
              ||||||||||||||||||||
Sbjct: 700594 ggaaaagcgggtgtcgaggt 700613
to top
>gb|AC092118.3| Homo sapiens chromosome 16 clone CTD-2600O9, complete sequence
          Length = 148794

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 22     gtttaagagtacagtacata 41
              ||||||||||||||||||||
Sbjct: 114656 gtttaagagtacagtacata 114637
to top
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 305     tcgatgcgcgggtcggcggcgagc 328
               |||| |||||||||||||||||||
Sbjct: 6387054 tcgaagcgcgggtcggcggcgagc 6387077
to top
>gb|AE004939.1| Pseudomonas aeruginosa PAO1, section 500 of 529 of the complete
            genome
          Length = 10294

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 315  ggtcggcggcgagcttggcgttga 338
            |||||||||||||| |||||||||
Sbjct: 8946 ggtcggcggcgagcatggcgttga 8923
to top
>gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical protein,
           regulatory protein PyrR (pyrR), aspartate carbamoyl
           transferase PyrB (pyrB), and dihydro-orotase PyrC (pyrC)
           genes, complete cds; and unknown gene
          Length = 4080

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 gacgccgtcggcgatggcga 293
           ||||||||||||||||||||
Sbjct: 444 gacgccgtcggcgatggcga 425
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 315     ggtcggcggcgagcttggcg 334
               ||||||||||||||||||||
Sbjct: 1444782 ggtcggcggcgagcttggcg 1444763
to top
>gb|AY104670.1| Zea mays PCO117754 mRNA sequence
          Length = 976

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 257 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 300
           ||||||||||| |  ||||  |||||||||||||||| ||||||
Sbjct: 776 acgcggcggcacagcgtgagcccgtcggcgatggcgacctggca 733
to top
>dbj|AB070936.1| Streptomyces avermitilis siderophore biosynthetic gene cluster
          Length = 10056

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 305  tcgatgcgcgggtcggcggcgagc 328
            |||| |||||||||||||||||||
Sbjct: 5465 tcgaagcgcgggtcggcggcgagc 5488


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,501,163
Number of Sequences: 3902068
Number of extensions: 3501163
Number of successful extensions: 82186
Number of sequences better than 10.0: 138
Number of HSP's better than 10.0 without gapping: 138
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80770
Number of HSP's gapped (non-prelim): 1406
length of query: 411
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 389
effective length of database: 17,147,199,772
effective search space: 6670260711308
effective search space used: 6670260711308
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top