ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart20e12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X93170.1|HV1433B H.vulgare mRNA for Hv14-3-3b 801 0.0
2emb|AJ276594.1|OSA276594 Oryza sativa mRNA for 14-3-3-like prote... 176 4e-41
3dbj|AK104907.1| Oryza sativa (japonica cultivar-group) cDNA clon... 176 4e-41
4dbj|AK068248.1| Oryza sativa (japonica cultivar-group) cDNA clon... 176 4e-41
5dbj|AK066506.1| Oryza sativa (japonica cultivar-group) cDNA clon... 168 1e-38
6ref|XM_472763.1| Oryza sativa (japonica cultivar-group), predic... 123 5e-25
7dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 123 5e-25
8dbj|AP006161.3| Oryza sativa (japonica cultivar-group) genomic D... 123 5e-25
9dbj|AP003999.3| Oryza sativa (japonica cultivar-group) genomic D... 123 5e-25
10dbj|AK101938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
11dbj|AK099243.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
12dbj|AK071822.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
13dbj|AK071311.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
14dbj|AK062065.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
15gb|U65956.1|OSU65956 Oryza sativa GF14-b protein mRNA, complete cds 123 5e-25
16emb|BX842605.1|OSJN00299 Oryza sativa genomic DNA, chromosome 4,... 107 3e-20
17emb|AL606460.3|OSJN00003 Oryza sativa genomic DNA, chromosome 4,... 107 3e-20
18dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
19gb|AY110486.1| Zea mays CL1980_1 mRNA sequence 107 3e-20
20emb|AL512547.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 107 3e-20
21gb|BT016497.1| Zea mays clone Contig330 mRNA sequence 101 2e-18
22gb|BT017754.1| Zea mays clone EL01N0450F06.c mRNA sequence 100 7e-18
23gb|M96856.1|MZEREGP Zea mays regulatory protein GF14-12 mRNA, co... 94 5e-16
24gb|AF548740.1| Triticum aestivum 14-3-3 protein mRNA, complete cds 88 3e-14
25emb|Y14200.1|HVY14200 Hordeum vulgare mRNA for 14-3-3 protein (H... 88 3e-14
26gb|S77133.1| GRF1=general regulatory factor [Zea mays, XL80, Gen... 84 4e-13
27gb|AC134053.4| Oryza sativa (japonica cultivar-group) chromosome... 78 3e-11
28gb|AY736127.1| Triticum aestivum 14-3-3 protein mRNA, complete cds 78 3e-11
29dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
30dbj|AK101580.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
31dbj|AK070548.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
32gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 78 3e-11
33gb|U65958.1|OSU65958 Oryza sativa GF14-d protein mRNA, complete cds 78 3e-11
34gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence 76 1e-10
35gb|AF342780.1|AF342780 Brassica napus GF14 omega mRNA, complete cds 74 4e-10
36dbj|AP004483.1| Lotus japonicus genomic DNA, chromosome 1, clone... 74 4e-10
37gb|AY103898.1| Zea mays PCO115124 mRNA sequence 72 2e-09
38ref|NM_116969.2| Arabidopsis thaliana GRF1; protein phosphorylat... 70 7e-09
39emb|AL161513.2|ATCHRIV25 Arabidopsis thaliana DNA chromosome 4, ... 70 7e-09
40gb|AY065064.1| Arabidopsis thaliana AT4g09000/F23J3_30 mRNA, com... 70 7e-09
41gb|AF272572.1|AF272572 Populus x canescens clone INRA717-1-B4 14... 70 7e-09
42gb|AF412067.1|AF412067 Arabidopsis thaliana AT4g09000/F23J3_30 m... 70 7e-09
43gb|BT024489.1| Arabidopsis thaliana At4g09000 mRNA, complete cds 70 7e-09
44emb|BX827760.1|CNS0A34H Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
45gb|AY086143.1| Arabidopsis thaliana clone 21771 mRNA, complete s... 70 7e-09
46gb|AC005359.1|AC005359 REVERSE-COMPLEMENT OF: F23J3.GCG.SEQ CHE... 70 7e-09
47gb|AF191746.1|AF191746 Lilium longiflorum 14-3-3-like protein mR... 68 3e-08
48gb|AF037460.1|AF037460 Fritillaria agrestis GF14 protein (GRF) m... 68 3e-08
49gb|AY604849.1| Tropaeolum majus 14-3-3 protein mRNA, complete cds 66 1e-07
50gb|AC144342.26| Medicago truncatula clone mth2-10n2, complete se... 66 1e-07
51gb|BT018670.1| Zea mays clone EL01N0510D09.d mRNA sequence 64 4e-07
52gb|AY070220.1| Solanum tuberosum 14-3-3 protein isoform 16R gene... 64 4e-07
53gb|AF499714.1| Thellungiella halophila 14-3-3-like protein mRNA,... 64 4e-07
54emb|Z48504.1|VFA1433A V.faba mRNA for 14-3-3 brain protein homol... 64 4e-07
55emb|Y11685.1|ST16R1433 Solanum tuberosum mRNA for 14-3-3 protein... 64 4e-07
56emb|X95904.2|LETFT6 L.esculentum mRNA for 14-3-3 protein, TFT6 64 4e-07
57emb|AJ309008.3|NTA309008 Nicotiana tabacum mRNA for 14-3-3 protein 64 4e-07
58gb|AF079104.1|AF079104 Lycopersicon esculentum 14-3-3 family pro... 64 4e-07
59gb|L09112.1|ATHGFCHI Arabidopsis thaliana GF14 chi chain mRNA, c... 64 4e-07
60dbj|AB117744.1| Nicotiana tabacum Nt14-3-3omega1 gene for 14-3-3... 64 4e-07
61gb|U31542.1|NCU31542 Neospora caninum 14-3-3 protein homologue m... 64 4e-07
62gb|U09377.1|ATU09377 Arabidopsis thaliana GF14chi isoform (GRF1)... 64 4e-07
63ref|NM_121610.2| Arabidopsis thaliana GRF5; protein phosphorylat... 62 2e-06
64ref|NM_031603.1| Rattus norvegicus tyrosine 3-monooxygenase/tryp... 62 2e-06
65gb|AY742293.1| Malus x domestica 14-3-3 family protein mRNA, com... 62 2e-06
66ref|NM_009536.2| Mus musculus tyrosine 3-monooxygenase/tryptopha... 62 2e-06
67gb|AY059115.1| Arabidopsis thaliana putative 14-3-3 protein GF14... 62 2e-06
68gb|AY035170.1| Arabidopsis thaliana putative 14-3-3 protein GF14... 62 2e-06
69emb|AL391145.1|ATF1N13 Arabidopsis thaliana DNA chromosome 5, BA... 62 2e-06
70emb|AL669897.15| Mouse DNA sequence from clone RP23-78H4 on chro... 62 2e-06
71gb|AF483479.1| Mus musculus strain ISS epsilon 14-3-3 mRNA, comp... 62 2e-06
72gb|AF483478.1| Mus musculus strain ILS epsilon 14-3-3 mRNA, comp... 62 2e-06
73dbj|AK135867.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 62 2e-06
74dbj|AK135831.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 62 2e-06
75dbj|AK169812.1| Mus musculus 2 days neonate thymus thymic cells ... 62 2e-06
76gb|L09109.1|ATHGFUPS Arabidopsis thaliana GF14 upsilon chain mRN... 62 2e-06
77dbj|AK075995.1| Mus musculus 10 days embryo whole body cDNA, RIK... 62 2e-06
78dbj|AK011612.1| Mus musculus 10 days embryo whole body cDNA, RIK... 62 2e-06
79emb|BX829808.1|CNS0A1K3 Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
80emb|BX832451.1|CNS0A14A Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
81emb|AJ586516.1| Fagus sylvatica partial 14.3.3-1 mRNA for 14-3-3... 62 2e-06
82gb|AF001415.1|AF001415 Arabidopsis thaliana 14-3-3-like protein ... 62 2e-06
83gb|U53882.1|RNU53882 Rattus norvegicus 14-3-3 protein epsilon is... 62 2e-06
84gb|M84416.1|RAT1433PEI Rat 14-3-3 protein epsilon isoform mRNA, ... 62 2e-06
85gb|BC063163.1| Rattus norvegicus tyrosine 3-monooxygenase/trypto... 62 2e-06
86gb|BC058686.1| Mus musculus tyrosine 3-monooxygenase/tryptophan ... 62 2e-06
87gb|U80070.1|MCU80070 Mesembryanthemum crystallinum 14-3-3-like p... 62 2e-06
88emb|Z19599.1|MME1433IS M.musculus epsilon 14-3-3 isoform mRNA 62 2e-06
89dbj|D30739.1|RAT1433PA Rat 14-3-3 protein mRNA for mitochondrial... 62 2e-06
90dbj|D87663.1| Mus musculus mRNA for 14-3-3 epsilon, complete cds 62 2e-06
91emb|X76086.1|CPA215 Cucurbita pepo 14-3-3 protein 60 6e-06
92emb|X62388.1|HV1433PH H.vulgare mRNA for 14-3-3 protein homolog... 60 6e-06
93ref|NM_102411.1| Arabidopsis thaliana GRF12; protein phosphoryla... 58 3e-05
94ref|XM_507235.1| PREDICTED Oryza sativa (japonica cultivar-group... 58 3e-05
95ref|XM_482517.1| Oryza sativa (japonica cultivar-group), mRNA 58 3e-05
96emb|X62838.1|OHPKCIH Oenothera elata subsp. hookeri mRNA for pro... 58 3e-05
97emb|AJ297911.1|HJE297911 Hypocrea jecorina ftt2 gene for 14-3-3-... 58 3e-05
98emb|AJ238681.2|PSA238681 Pisum sativum mRNA for 14-3-3-like prot... 58 3e-05
99gb|AF335544.1| Arabidopsis thaliana 14-3-3 protein GF14iota (grf... 58 3e-05
100gb|BT006230.1| Arabidopsis thaliana At1g26480 gene, complete cds 58 3e-05
101dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
102gb|M95066.1|MZEORFG Zea mays putative brain specific 14-3-3 prot... 58 3e-05
103gb|AY085338.1| Arabidopsis thaliana clone 146580 mRNA, complete ... 58 3e-05
104gb|AC013427.3|T1K7 Sequence of BAC T1K7 from Arabidopsis thalian... 58 3e-05
105dbj|AP003881.3| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
106dbj|AK117907.1| Arabidopsis thaliana At1g26480 mRNA for putative... 58 3e-05
107dbj|AK122149.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
108dbj|AK070230.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
109dbj|AK065266.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
110dbj|AK061786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
111gb|U65957.1|OSU65957 Oryza sativa GF14-c protein mRNA, complete cds 58 3e-05
112gb|U15036.1|PSU15036 Pisum sativum 14-3-3-like protein mRNA, com... 58 3e-05
113gb|AY965896.2| Dunaliella salina 14-3-3 protein mRNA, complete cds 58 3e-05
114dbj|AB042299.1| Vigna angularis mRNA for 14-3-3 protein, complet... 58 3e-05
115ref|XM_469508.1| Oryza sativa (japonica cultivar-group), mRNA 56 1e-04
116gb|DQ207874.1| Solanum tuberosum clone 089F11 14-3-3 protein-lik... 56 1e-04
117gb|AC162284.11| Mus musculus chromosome 8, clone RP23-256C11, co... 56 1e-04
118gb|AC087181.9| Oryza sativa (japonica cultivar-group) chromosome... 56 1e-04
119gb|BT014142.1| Lycopersicon esculentum clone 133261F, mRNA sequence 56 1e-04
120gb|AY573799.1| Solanum chacoense 14-3-3 protein mRNA, complete cds 56 1e-04
121gb|AC127416.7| Mus musculus BAC clone RP23-457J22 from chromosom... 56 1e-04
122gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 56 1e-04
123gb|AC160547.6| Mus musculus chromosome 8, clone RP23-240F23, com... 56 1e-04
124gb|AF424640.1| Phytophthora infestans clone MY-01-D-08 14-3-3-li... 56 1e-04
125emb|X95903.1|LETFT5 L.esculentum mRNA for 14-3-3 protein, TFT5 56 1e-04
126gb|AF079451.1|AF079451 Lycopersicon esculentum clone SIG5 14-3-3... 56 1e-04
127dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
128dbj|AB119479.1| Nicotiana tabacum mRNA for 14-3-3 h-2 protein, c... 56 1e-04
129dbj|AB119478.1| Nicotiana tabacum mRNA for 14-3-3 h-1 protein, c... 56 1e-04
130dbj|AB119466.1| Nicotiana tabacum mRNA for 14-3-3 a-1 protein, c... 56 1e-04
131dbj|D16140.1|RICS94A Oryza sativa S94 mRNA for brain specific pr... 56 1e-04
132dbj|AK103065.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
133dbj|AK062077.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
134gb|DQ294278.1| Solanum tuberosum clone 178B04 14-3-3 protein-lik... 56 1e-04
135emb|AL590963.11| Mouse DNA sequence from clone RP23-395E10 on ch... 56 1e-04
136dbj|AB012775.1| Toxoplasma gondii mRNA for 14-3-3 protein homolo... 56 1e-04
137dbj|AB042193.1| Triticum aestivum TaWIN1 mRNA, complete cds 56 1e-04
138gb|AF529418.1| Echinococcus granulosus putative growth regulator... 54 4e-04
139gb|AY280670.1| Branchiostoma belcheri tsingtaunese 14-3-3 protei... 54 4e-04
140emb|CR932957.2| Medicago truncatula chromosome 5 clone mth2-58c3... 54 4e-04
141gb|DQ444463.1| Camellia sinensis 14-3-3 protein mRNA, complete cds 54 4e-04
142emb|AJ004898.1|GMJ004898 Glycine max mRNA for 14-3-3 protein, pa... 54 4e-04
143gb|BC059441.1| Danio rerio tyrosine 3-monooxygenase/tryptophan 5... 54 4e-04
144gb|BC065346.1| Danio rerio tyrosine 3-monooxygenase/tryptophan 5... 54 4e-04
145ref|XM_691943.1| PREDICTED: Danio rerio similar to tyrosine 3-mo... 54 4e-04
146gb|AF207904.1|AF207904 Echinococcus granulosus 14-3-3 protein (1... 54 4e-04
147ref|NM_199562.1| Danio rerio tyrosine 3-monooxygenase/tryptophan... 54 4e-04
148gb|AF066076.1|AF066076 Helianthus annuus 14-3-3-like protein mRN... 54 4e-04
149gb|U70533.1|GMU70533 Glycine max 14-3-3 related protein SGF14A m... 54 4e-04
150gb|DQ415922.1| Cleome spinosa clone BAC Cs1, complete sequence 52 0.002
151emb|AM040266.1| Capsicum chinense 14-3-3 gene, 5'UTR region 52 0.002
152gb|DQ115331.1| Caenorhabditis remanei 14-3-3 protein (ftt-2) mRN... 52 0.002
153emb|Y11687.1|ST34G1433 Solanum tuberosum mRNA for 14-3-3 protein... 52 0.002
154emb|Y11686.1|ST27G1433 Solanum tuberosum mRNA for 14-3-3 protein... 52 0.002
155emb|X95901.2|LETFT2 L.esculentum mRNA for 14-3-3 protein, TFT2 52 0.002
156emb|X95902.1|LETFT3 L.esculentum mRNA for 14-3-3 protein, TFT3 52 0.002
157emb|AJ270959.1|LES270959 Lycopersicon esculentum partial mRNA fo... 52 0.002
158gb|AF121194.2|AF121194 Populus x canescens 14-3-3 protein (14-3-... 52 0.002
159gb|DQ063576.1| Caenorhabditis remanei strain EM464 14-3-3 (ftt-2... 52 0.002
160dbj|AB119470.1| Nicotiana tabacum mRNA for 14-3-3 c-2 protein, c... 52 0.002
161dbj|AB119469.1| Nicotiana tabacum mRNA for 14-3-3 c-1 protein, c... 52 0.002
162dbj|AB117745.1| Nicotiana tabacum Nt14-3-3omega2 gene for 14-3-3... 52 0.002
163emb|Y11211.1|NT1433LB N.tabacum mRNA for 14-3-3-like protein (B) 52 0.002
164gb|U91724.1|NTU91724 Nicotiana tabacum 14-3-3 isoform c T14-3c m... 52 0.002
165gb|L29151.1|TOMPBLT3A Solanum lycopersicum (clone pBLT3) 14-3-3 ... 52 0.002
166dbj|AB042194.1| Triticum aestivum TaWIN2 mRNA, complete cds 52 0.002
167ref|NM_103213.2| Arabidopsis thaliana GRF4; protein phosphorylat... 50 0.006
168gb|AF272573.1|AF272573 Populus x canescens clone INRA717-1-B4 14... 50 0.006
169gb|AY060534.1| Arabidopsis thaliana At1g35160/T32G9_30 mRNA, com... 50 0.006
170gb|AY039845.1| Arabidopsis thaliana At1g35160/T32G9_30 mRNA, com... 50 0.006
171emb|BX814586.1|CNS0AC9T Arabidopsis thaliana Full-length cDNA Co... 50 0.006
172emb|BX813581.1|CNS0AC0Y Arabidopsis thaliana Full-length cDNA Co... 50 0.006
173gb|AC079605.13|AC079605 Arabidopsis thaliana chromosome 1 BAC T3... 50 0.006
174dbj|AB120322.1| Nicotiana tabacum mRNA for 14-3-3 f-2 protein, p... 50 0.006
175dbj|AB119476.1| Nicotiana tabacum mRNA for 14-3-3 f-1 protein, c... 50 0.006
176gb|AY084342.1| Arabidopsis thaliana clone 104934 mRNA, complete ... 50 0.006
177dbj|AB117746.1| Nicotiana tabacum Nt14-3-3omega3 gene for 14-3-3... 50 0.006
178gb|AF222805.1|AF222805 Euphorbia esula 14-3-3-like protein mRNA,... 50 0.006
179gb|AY111491.1| Zea mays CL2549_2 mRNA sequence 50 0.006
180gb|AY105971.1| Zea mays PCO076386 mRNA sequence 50 0.006
181gb|U91727.1|NTU91727 Nicotiana tabacum 14-3-3 isoform f T14-3f m... 50 0.006
182gb|AF001414.1|AF001414 Arabidopsis thaliana 14-3-3-like protein ... 50 0.006
183gb|L09111.1|ATHGFPHI Arabidopsis thaliana GF14 protein phi chain... 50 0.006
184ref|NM_213145.1| Danio rerio tyrosine 3-monooxygenase/tryptophan... 48 0.024
185ref|XM_482989.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.024
186ref|NM_018754.1| Mus musculus stratifin (Sfn), mRNA 48 0.024
187gb|AY224524.1| Oryza sativa (japonica cultivar-group) isolate 20... 48 0.024
188gb|AC084162.3| Mus musculus strain C57BL6/J chromosome 5 clone R... 48 0.024
189emb|CT010208.1| Mus musculus full open reading frame cDNA clone ... 48 0.024
190ref|XM_546936.2| PREDICTED: Canis familiaris similar to 14-3-3 p... 48 0.024
191gb|AC092728.2| Canis familiaris clone RP81-237O17, complete sequ... 48 0.024
192ref|NM_019376.1| Rattus norvegicus tyrosine 3-monooxygenase/tryp... 48 0.024
193gb|BC099129.1| Rattus norvegicus cDNA clone IMAGE:7461680, **** ... 48 0.024
194gb|AC091514.2| Rattus norvegicus strain Brown Norway clone RP31-... 48 0.024
195emb|BX058218.1|CNS09H32 Single read from an extremity of a full-... 48 0.024
196emb|BX031038.1|CNS08W42 Single read from an extremity of a full-... 48 0.024
197emb|BX031037.1|CNS08W41 Single read from an extremity of a full-... 48 0.024
198emb|BX049248.1|CNS09A5W Single read from an extremity of a full-... 48 0.024
199emb|BX029843.1|CNS08V6V Single read from an extremity of a full-... 48 0.024
200emb|BX026330.1|CNS08SHA Single read from an extremity of a full-... 48 0.024
201emb|BX026329.1|CNS08SH9 Single read from an extremity of a full-... 48 0.024
202emb|X87370.1|ST1433PRO Solanum tuberosum mRNA for 14-3-3 protein... 48 0.024
203gb|DQ445254.1| Sus scrofa stratifin (Sfn) mRNA, complete cds 48 0.024
204gb|BC053247.1| Danio rerio tyrosine 3-monooxygenase/tryptophan 5... 48 0.024
205emb|AJ504807.1|LES504807 Lycopersicon esculentum mRNA for 14-3-3... 48 0.024
206gb|AF532628.1| Glycine max 14-.3.3 protein mRNA, complete cds 48 0.024
207gb|BC008129.1| Mus musculus 3-monooxygenase/tryptophan 5-monooxy... 48 0.024
208dbj|AK148618.1| Mus musculus 2 days neonate sympathetic ganglion... 48 0.024
209dbj|AK146490.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 48 0.024
210dbj|AK153307.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
211dbj|AK164356.1| Mus musculus 12 days embryo spinal ganglion cDNA... 48 0.024
212dbj|AK169358.1| Mus musculus 17 days embryo stomach cDNA, RIKEN ... 48 0.024
213gb|S55305.1| Rattus sp. 14-3-3 protein gamma subtype mRNA, compl... 48 0.024
214ref|NM_018871.2| Mus musculus 3-monooxygenase/tryptophan 5-monoo... 48 0.024
215dbj|AK088847.1| Mus musculus 2 days neonate thymus thymic cells ... 48 0.024
216gb|AY224434.1| Oryza sativa (japonica cultivar-group) isolate 20... 48 0.024
217ref|NM_174793.1| Bos taurus tyrosine 3-monooxygenase/tryptophan ... 48 0.024
218gb|AY973204.1| Haematococcus pluvialis Flotow NIES-144 14-3-3 pr... 48 0.024
219ref|XM_232745.3| PREDICTED: Rattus norvegicus stratifin (predict... 48 0.024
220gb|AF152893.1|AF152893 Mus musculus 14-3-3 protein sigma (Mme1) ... 48 0.024
221dbj|AP005391.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
222dbj|AP004643.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.024
223dbj|AK210653.1| Mus musculus cDNA, clone:Y2G0119C12, strand:plus... 48 0.024
224dbj|AK186099.1| Mus musculus cDNA, clone:Y0G0136E11, strand:minu... 48 0.024
225gb|BC089860.1| Rattus norvegicus similar to 14-3-3 protein sigma... 48 0.024
226gb|BC079389.1| Rattus norvegicus similar to 14-3-3 protein sigma... 48 0.024
227ref|XM_564583.1| Anopheles gambiae str. PEST ENSANGP00000009311 ... 48 0.024
228ref|XM_564585.1| Anopheles gambiae str. PEST ENSANGP00000027944 ... 48 0.024
229ref|XM_564587.1| Anopheles gambiae str. PEST ENSANGP00000029364 ... 48 0.024
230ref|XM_564586.1| Anopheles gambiae str. PEST ENSANGP00000028977 ... 48 0.024
231ref|XM_564584.1| Anopheles gambiae str. PEST ENSANGP00000026603 ... 48 0.024
232dbj|AK101599.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.024
233gb|AF058799.1|AF058799 Mus musculus 14-3-3 protein gamma mRNA, c... 48 0.024
234gb|AF058798.1|AF058798 Mus musculus 14-3-3 protein sigma mRNA, c... 48 0.024
235gb|AF043737.1|AF043737 Bos taurus 14-3-3 protein gamma mRNA, com... 48 0.024
236emb|CT009705.9| Zebrafish DNA sequence from clone DKEYP-81C5 in ... 48 0.024
237emb|AL627228.31| Mouse DNA sequence from clone RP23-137L22 on ch... 48 0.024
238gb|L29150.1|TOMPBLT4A Solanum lycopersicum (clone pBLT4) 14-3-3 ... 48 0.024
239ref|NM_001013941.1| Rattus norvegicus similar to 14-3-3 protein ... 48 0.024
240dbj|D17447.1| Rattus norvegicus mRNA for 14-3-3 protein gamma-su... 48 0.024
241gb|AY518222.1| Solanum tuberosum cultivar Desiree 14-3-3 protein... 48 0.024
242gb|DQ443318.1| Bombyx mori tyrosine 3-monooxygenase/tryptophan 5... 46 0.096
243gb|DQ113651.1| Mus musculus Ywhae-like mRNA, partial sequence 46 0.096
244emb|Z48505.1|VFA1433B V.faba mRNA for 14-3-3 brain protein homol... 46 0.096
245emb|X97724.1|ST1433 S.tuberosum mRNA for 14-3-3 protein 46 0.096
246gb|DQ122865.1| Chlamydomonas incerta 14-3-3-like protein-related... 46 0.096
247gb|AF426249.1|AF426249 Fritillaria cirrhosa 14-3-3 protein (GF14... 46 0.096
248dbj|AB119480.1| Nicotiana tabacum mRNA for 14-3-3 i-1 protein, c... 46 0.096
249dbj|AP006081.1| Lotus japonicus genomic DNA, chromosome 2, clone... 46 0.096
250dbj|AB050953.1| Vicia faba mRNA for vf14-3-3d protein, complete cds 46 0.096
251ref|NM_106479.2| Arabidopsis thaliana GRF2; protein phosphorylat... 44 0.38
252ref|NM_001031477.1| Gallus gallus scavenger receptor cysteine ri... 44 0.38
253gb|BC070566.1| Xenopus laevis hypothetical protein MGC80017, mRN... 44 0.38
254ref|XM_658256.1| Aspergillus nidulans FGSC A4 hypothetical prote... 44 0.38
255ref|XM_455629.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F12100g ... 44 0.38
256ref|XM_449048.1| Candida glabrata CBS138, CAGL0L06270g partial mRNA 44 0.38
257gb|AC093131.2| Papio anubis clone RP41-51G4, complete sequence 44 0.38
258gb|BC059340.1| Xenopus laevis hypothetical protein MGC69099, mRN... 44 0.38
259gb|AC139746.15| Medicago truncatula clone mth2-17b20, complete s... 44 0.38
260gb|AC148177.13| Medicago truncatula clone mth2-4c9, complete seq... 44 0.38
261emb|Z47746.1|SC8557 S.cerevisiae chromosome IV cosmid 8557 44 0.38
262emb|X84817.1|SCDNABMH2 S.cerevisiae BMH2 gene 44 0.38
263emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 44 0.38
264emb|CR380958.1| Candida glabrata strain CBS138 chromosome L comp... 44 0.38
265emb|AJ851534.1| Gallus gallus mRNA for hypothetical protein, clo... 44 0.38
266gb|AY077667.1| Arabidopsis thaliana At1g78300/F3F9_16 mRNA, comp... 44 0.38
267gb|AF462807.1|AF462807 Arabidopsis thaliana At1g78300/F3F9_16 mR... 44 0.38
268gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 44 0.38
269ref|NM_077537.2| Caenorhabditis elegans Fourteen-Three-Three fam... 44 0.38
270ref|NM_077538.3| Caenorhabditis elegans Fourteen-Three-Three fam... 44 0.38
271emb|BX814726.1|CNS0ACAO Arabidopsis thaliana Full-length cDNA Co... 44 0.38
272emb|BX815228.1|CNS0ABJ2 Arabidopsis thaliana Full-length cDNA Co... 44 0.38
273emb|BX814839.1|CNS0ABET Arabidopsis thaliana Full-length cDNA Co... 44 0.38
274dbj|AB119468.1| Nicotiana tabacum mRNA for 14-3-3 b-2 protein, c... 44 0.38
275dbj|AB119467.1| Nicotiana tabacum mRNA for 14-3-3 b-1 protein, c... 44 0.38
276gb|AY086467.1| Arabidopsis thaliana clone 25284 mRNA, complete s... 44 0.38
277gb|AC013430.5|AC013430 Genomic sequence for Arabidopsis thaliana... 44 0.38
278ref|NM_211835.1| Eremothecium gossypii AGR107Cp (AGR107C), mRNA 44 0.38
279emb|Z66564.1|CEF52D10 Caenorhabditis elegans Cosmid F52D10, comp... 44 0.38
280gb|DQ333113.1| Synthetic construct Saccharomyces cerevisiae clon... 44 0.38
281gb|U91723.1|NTU91723 Nicotiana tabacum 14-3-3 isoform b T14-3b m... 44 0.38
282gb|AF039709.1|AF039709 Maackia amurensis 14-3-3 protein homolog ... 44 0.38
283gb|U09376.1|ATU09376 Arabidopsis thaliana GF14omega isoform (GRF... 44 0.38
284gb|M96855.1|ATHGF14A Arabidopsis thaliana GF14 mRNA, complete cds 44 0.38
285gb|U01883.1|U01883 Saccharomyces cerevisiae 14-3-3-like protein ... 44 0.38
286dbj|AB071967.1| Nicotiana tabacum D31 mRNA for 14-3-3 protein, c... 44 0.38
287gb|AC107635.16| Mus musculus chromosome 9, clone RP23-24C14, com... 42 1.5
288gb|AC152352.12| Medicago truncatula clone mth2-77a17, complete s... 42 1.5
289gb|AY370879.1| Oncorhynchus mykiss 14-3-3B1 protein mRNA, comple... 42 1.5
290gb|AC008616.6| Homo sapiens chromosome 19 clone CTB-144D21, comp... 42 1.5
291dbj|AB119481.1| Nicotiana tabacum mRNA for 14-3-3 i-2 protein, c... 42 1.5
292gb|AC102338.10| Mus musculus chromosome 3, clone RP24-559D1, com... 42 1.5
293emb|BX005256.11| Zebrafish DNA sequence from clone DKEY-79D12, c... 42 1.5
294gb|AF053561.1|AF053561 Mesembryanthemum crystallinum 14-3-3 like... 42 1.5
295dbj|AP006074.1| Lotus japonicus genomic DNA, chromosome 3, clone... 42 1.5
296ref|NM_103196.2| Arabidopsis thaliana GRF11; amino acid binding ... 40 5.9
297gb|M93010.1|HUMMAMEPI Human epithelial cell marker protein 1 (HM... 40 5.9
298gb|BC072895.1| Xenopus laevis MGC80334 protein, mRNA (cDNA clone... 40 5.9
299gb|AC132405.3| Mus musculus BAC clone RP23-332I1 from chromosome... 40 5.9
300gb|BC000995.2| Homo sapiens stratifin, mRNA (cDNA clone MGC:5018... 40 5.9
301gb|BC000329.2| Homo sapiens stratifin, mRNA (cDNA clone MGC:8516... 40 5.9
302gb|BC023552.2| Homo sapiens stratifin, mRNA (cDNA clone MGC:1971... 40 5.9
303ref|XM_878909.1| PREDICTED: Bos taurus similar to 14-3-3 protein... 40 5.9
304ref|XM_606876.2| PREDICTED: Bos taurus similar to 14-3-3 protein... 40 5.9
305ref|NM_006142.3| Homo sapiens stratifin (SFN), mRNA 40 5.9
306gb|AC131099.4| Mus musculus BAC clone RP23-15N12 from chromosome... 40 5.9
307ref|XM_657013.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 5.9
308ref|XM_652867.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 5.9
309gb|BT014108.1| Lycopersicon esculentum clone 133212F, mRNA sequence 40 5.9
310gb|AC123549.5| Mus musculus BAC clone RP24-91K17 from chromosome... 40 5.9
311ref|XR_003201.1| PREDICTED: Mus musculus similar to 14-3-3 prote... 40 5.9
312ref|XM_744371.1| Aspergillus fumigatus Af293 hypothetical protei... 40 5.9
313ref|XM_745475.1| Aspergillus fumigatus Af293 hypothetical protei... 40 5.9
314ref|XM_382352.1| Gibberella zeae PH-1 chromosome 1 predicted pro... 40 5.9
315gb|AC104872.8| Mus musculus chromosome 12, clone RP23-360C2, com... 40 5.9
316ref|XM_544477.2| PREDICTED: Canis familiaris similar to 14-3-3 p... 40 5.9
317gb|AC105951.9| Mus musculus chromosome 5, clone RP23-475D21, com... 40 5.9
318gb|BC001550.1| Homo sapiens stratifin, mRNA (cDNA clone MGC:5019... 40 5.9
319gb|AC159466.3| Mus musculus 10 BAC RP23-388A21 (Roswell Park Can... 40 5.9
320gb|AY370882.1| Oncorhynchus mykiss 14-3-3C2 protein mRNA, comple... 40 5.9
321ref|XM_501483.1| Yarrowia lipolytica CLIB122, YALI0C05665g predi... 40 5.9
322emb|AL359874.9| Human DNA sequence from clone RP11-3K22 on chrom... 40 5.9
323emb|AL034380.26|HS50O24 Human DNA sequence from clone RP1-50O24 ... 40 5.9
324emb|Y11212.1|NT1433LA N.tabacum mRNA for 14-3-3-like protein (A) 40 5.9
325emb|X95905.1|LETFT7 Lycopersicon esculentum mRNA for 14-3-3 prot... 40 5.9
326emb|X57348.1|HS9112 H.sapiens mRNA (clone 9112) 40 5.9
327emb|CR548612.1| Paramecium tetraurelia macronuclear largest chro... 40 5.9
328emb|AJ719304.1| Gallus gallus mRNA for hypothetical protein, clo... 40 5.9
329gb|BC090759.1| Danio rerio zgc:113329, mRNA (cDNA clone MGC:1133... 40 5.9
330ref|NM_001006219.1| Gallus gallus tyrosine 3-monooxygenase/trypt... 40 5.9
331ref|NM_001013341.1| Danio rerio zgc:113329 (zgc:113329), mRNA 40 5.9
332gb|AC121493.1| Homo sapiens chromosome 3 clone RP11-88H12, compl... 40 5.9
333dbj|AB226237.1| Aspergillus oryzae cDNA, contig sequence: AoEST3096 40 5.9
334gb|AC103921.2| Homo sapiens chromosome 3 clone RP11-131O21, comp... 40 5.9
335gb|AF323920.1| Arabidopsis thaliana 14-3-3 protein GF14omicron m... 40 5.9
336gb|AC103587.2| Homo sapiens chromosome 3 clone RP11-164G20, comp... 40 5.9
337gb|AC004873.3| Homo sapiens PAC clone RP4-742P4 from 1, complete... 40 5.9
338gb|AF079450.1|AF079450 Lycopersicon esculentum clone SIG74 14-3-... 40 5.9
339emb|CR541926.1| Homo sapiens full open reading frame cDNA clone ... 40 5.9
340emb|CR541905.1| Homo sapiens full open reading frame cDNA clone ... 40 5.9
341gb|AC153150.5| Mus musculus BAC clone RP23-181B14 from chromosom... 40 5.9
342gb|AC006551.6|AC006551 Arabidopsis thaliana chromosome I BAC F12... 40 5.9
343gb|AC179924.2| Mus musculus BAC clone RP23-270O20 from chromosom... 40 5.9
344emb|BX816095.1|CNS0ADDS Arabidopsis thaliana Full-length cDNA Co... 40 5.9
345emb|BX816370.1|CNS0ABVG Arabidopsis thaliana Full-length cDNA Co... 40 5.9
346emb|BX813898.1|CNS0AC4T Arabidopsis thaliana Full-length cDNA Co... 40 5.9
347gb|AF071008.1|AF071008 Ovis aries stratifin mRNA, complete cds 40 5.9
348gb|AC087083.2|AC087083 Homo sapiens chromosome 3 clone 138a17 ma... 40 5.9
349gb|AC153568.5| Mus musculus 10 BAC RP23-66K22 (Roswell Park Canc... 40 5.9
350ref|NM_001009208.1| Ovis aries stratifin (SFN), mRNA 40 5.9
351dbj|AB119475.1| Nicotiana tabacum mRNA for 14-3-3 e-2 protein, c... 40 5.9
352gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome 40 5.9
353ref|XM_233867.3| PREDICTED: Rattus norvegicus anaplastic lymphom... 40 5.9
354gb|AC018460.2|AC018460 Arabidopsis thaliana chromosome I BAC F11... 40 5.9
355gb|AC024057.5| Homo sapiens chromosome 3 clone RP11-299N3 map 3p... 40 5.9
356gb|AE014133.1| Streptococcus mutans UA159, complete genome 40 5.9
357gb|AC171014.3| Gallus gallus BAC clone CH261-89A18 from chromoso... 40 5.9
358dbj|AK179881.1| Mus musculus cDNA, clone:Y0G0112A05, strand:minu... 40 5.9
359gb|AY894114.1| Synthetic construct Homo sapiens clone FLH130877.... 40 5.9
360gb|AY893275.1| Synthetic construct Homo sapiens clone FLH130843.... 40 5.9
361gb|BC002995.1| Homo sapiens stratifin, mRNA (cDNA clone MGC:3828... 40 5.9
362emb|CR855299.12| Zebrafish DNA sequence from clone CH211-199C22 ... 40 5.9
363gb|AC007894.2|F21H2 Arabidopsis thaliana chromosome 1 BAC F21H2 ... 40 5.9
364gb|AY090662.1| Yarrowia lipolytica 14-3-3 protein Bmh2 gene, com... 40 5.9
365gb|AF029082.1|AF029082 Homo sapiens 14-3-3 sigma protein mRNA, c... 40 5.9
366gb|AF029081.1|AF029081 Homo sapiens 14-3-3 sigma protein promote... 40 5.9
367gb|AC004104.1|AC004104 Homo sapiens 12q24 PAC RPCI5-942N13 (Rosw... 40 5.9
368emb|CT030697.6| Mouse DNA sequence from clone RP23-274A4 on chro... 40 5.9
369gb|AC122464.3| Mus musculus BAC clone RP24-301O17 from 6, comple... 40 5.9
370emb|AL928981.7| Mouse DNA sequence from clone RP23-54O14 on chro... 40 5.9
371emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 40 5.9
372gb|U24158.1|THU24158 Trichoderma harzianum 14.3.3. protein mRNA,... 40 5.9
373gb|AC161507.2| Mus musculus chromosome 5, clone RP23-76L18, comp... 40 5.9
374dbj|AB071968.1| Nicotiana tabacum D75 mRNA for 14-3-3 protein, c... 40 5.9

>emb|X93170.1|HV1433B H.vulgare mRNA for Hv14-3-3b
          Length = 1136

 Score =  801 bits (404), Expect = 0.0
 Identities = 410/412 (99%)
 Strand = Plus / Minus

                                                                        
Query: 28   ggaaagggttcagaagacgcccttcctaaagaagaaaagcagatgaatagacaaggggcc 87
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1135 ggaaagggttcagaagacgcccttcctaaagaagaaaagcagatgaatagacaaggggcc 1076

                                                                        
Query: 88   acacagacaagagcagcagaaatttctagaaccaccaaagtaacaggaaggttcaacaag 147
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1075 acacagacaagagcagcagaaatttctagaaccaccaaagtaacaggaaggttcaacaag 1016

                                                                        
Query: 148  aggcaataaccagtgcagcccgataacaaagcaaggcaggcagctacaagcttccctatc 207
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1015 aggcaataaccagtgcagcccgataaccaagcaaggcaggcagctacaagcttccctatc 956

                                                                        
Query: 208  acaacacaaattggagcctccaattaccaacaaccacactgacgacattacaatctacac 267
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 955  acaacacaaattggagcctccaattaccaacaaccacactgacgacattacaatctacac 896

                                                                        
Query: 268  tgaacaagcaagaaagacaagtttctggacacatagacaatgtttactgtccatctccag 327
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 895  tgaacaagcaagaaagacaagtttctggacacatagacaatgtttactgtccatctccag 836

                                                                        
Query: 328  attcacccttgggagcatccttcatttcttcagcggcgtcctccgagatgtcggaagtcc 387
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 835  attcacccttgggagcatccttcatttcttcagcagcgtcctccgagatgtcggaagtcc 776

                                                                
Query: 388  acagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
            ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 775  acagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 724



to top

>emb|AJ276594.1|OSA276594 Oryza sativa mRNA for 14-3-3-like protein (gf14-e gene)
          Length = 987

 Score =  176 bits (89), Expect = 4e-41
 Identities = 122/133 (91%)
 Strand = Plus / Minus

                                                                       
Query: 307 atgtttactgtccatctccagattcacccttgggagcatccttcatttcttcagcggcgt 366
           ||||| ||||||||||||| ||||| |||||||| || ||||| ||||| ||||| || |
Sbjct: 862 atgttcactgtccatctcctgattcgcccttgggggcctccttgatttcctcagcagcat 803

                                                                       
Query: 367 cctccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaag 426
           |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 802 cctccgagatatcggaagtccacagcgtcaggttatcacgcagaagctgcatgatcaaag 743

                        
Query: 427 tgctgtccttgta 439
           |||||||||||||
Sbjct: 742 tgctgtccttgta 730



to top

>dbj|AK104907.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G11, full
           insert sequence
          Length = 1269

 Score =  176 bits (89), Expect = 4e-41
 Identities = 122/133 (91%)
 Strand = Plus / Minus

                                                                       
Query: 307 atgtttactgtccatctccagattcacccttgggagcatccttcatttcttcagcggcgt 366
           ||||| ||||||||||||| ||||| |||||||| || ||||| ||||| ||||| || |
Sbjct: 799 atgttcactgtccatctcctgattcgcccttgggggcctccttgatttcctcagcagcat 740

                                                                       
Query: 367 cctccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaag 426
           |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 739 cctccgagatatcggaagtccacagcgtcaggttatcacgcagaagctgcatgatcaaag 680

                        
Query: 427 tgctgtccttgta 439
           |||||||||||||
Sbjct: 679 tgctgtccttgta 667



to top

>dbj|AK068248.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013146A14, full
            insert sequence
          Length = 2361

 Score =  176 bits (89), Expect = 4e-41
 Identities = 122/133 (91%)
 Strand = Plus / Minus

                                                                        
Query: 307  atgtttactgtccatctccagattcacccttgggagcatccttcatttcttcagcggcgt 366
            ||||| ||||||||||||| ||||| |||||||| || ||||| ||||| ||||| || |
Sbjct: 2083 atgttcactgtccatctcctgattcgcccttgggggcctccttgatttcctcagcagcat 2024

                                                                        
Query: 367  cctccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaag 426
            |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 2023 cctccgagatatcggaagtccacagcgtcaggttatcacgcagaagctgcatgatcaaag 1964

                         
Query: 427  tgctgtccttgta 439
            |||||||||||||
Sbjct: 1963 tgctgtccttgta 1951



to top

>dbj|AK066506.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013071A03, full
           insert sequence
          Length = 1407

 Score =  168 bits (85), Expect = 1e-38
 Identities = 121/133 (90%)
 Strand = Plus / Minus

                                                                       
Query: 307 atgtttactgtccatctccagattcacccttgggagcatccttcatttcttcagcggcgt 366
           ||||| ||||||||||||| ||||| |||||||| || ||||| | ||| ||||| || |
Sbjct: 868 atgttcactgtccatctcctgattcgcccttgggggcctccttgaattcctcagcagcat 809

                                                                       
Query: 367 cctccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaag 426
           |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 808 cctccgagatatcggaagtccacagcgtcaggttatcacgcagaagctgcatgatcaaag 749

                        
Query: 427 tgctgtccttgta 439
           |||||||||||||
Sbjct: 748 tgctgtccttgta 736



to top

>ref|XM_472763.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Minus

                                                                       
Query: 354 tcttcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagc 413
           ||||| |||| ||||||||||||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 746 tcttccgcggtgtcctccgagatgtctgaagtccacagggtcaggttatcacggaggagt 687

                                     
Query: 414 tgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||||||||||||
Sbjct: 686 tgcatgatcaaagtgctgtccttgta 661



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  123 bits (62), Expect = 5e-25
 Identities = 68/70 (97%)
 Strand = Plus / Minus

                                                                            
Query: 370      ccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgc 429
                ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 22356373 ccgagatatcggaagtccacagcgtcaggttatcacgcagaagctgcatgatcaaagtgc 22356314

                          
Query: 430      tgtccttgta 439
                ||||||||||
Sbjct: 22356313 tgtccttgta 22356304



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                            
Query: 307      atgtttactgtccatctccagattcacccttgggagcatccttcatttcttcagcggcgt 366
                ||||| ||||||||||||| ||||| |||||||| || ||||| ||||| ||||| || |
Sbjct: 22356530 atgttcactgtccatctcctgattcgcccttgggggcctccttgatttcctcagcagcat 22356471

                     
Query: 367      cctcc 371
                |||||
Sbjct: 22356470 cctcc 22356466



to top

>dbj|AP006161.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:B1267B06
          Length = 156989

 Score =  123 bits (62), Expect = 5e-25
 Identities = 68/70 (97%)
 Strand = Plus / Minus

                                                                          
Query: 370    ccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgc 429
              ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 115017 ccgagatatcggaagtccacagcgtcaggttatcacgcagaagctgcatgatcaaagtgc 114958

                        
Query: 430    tgtccttgta 439
              ||||||||||
Sbjct: 114957 tgtccttgta 114948



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                          
Query: 307    atgtttactgtccatctccagattcacccttgggagcatccttcatttcttcagcggcgt 366
              ||||| ||||||||||||| ||||| |||||||| || ||||| ||||| ||||| || |
Sbjct: 115174 atgttcactgtccatctcctgattcgcccttgggggcctccttgatttcctcagcagcat 115115

                   
Query: 367    cctcc 371
              |||||
Sbjct: 115114 cctcc 115110



to top

>dbj|AP003999.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1115_A05
          Length = 113326

 Score =  123 bits (62), Expect = 5e-25
 Identities = 68/70 (97%)
 Strand = Plus / Minus

                                                                         
Query: 370   ccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgc 429
             ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 12592 ccgagatatcggaagtccacagcgtcaggttatcacgcagaagctgcatgatcaaagtgc 12533

                       
Query: 430   tgtccttgta 439
             ||||||||||
Sbjct: 12532 tgtccttgta 12523



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 307   atgtttactgtccatctccagattcacccttgggagcatccttcatttcttcagcggcgt 366
             ||||| ||||||||||||| ||||| |||||||| || ||||| ||||| ||||| || |
Sbjct: 12749 atgttcactgtccatctcctgattcgcccttgggggcctccttgatttcctcagcagcat 12690

                  
Query: 367   cctcc 371
             |||||
Sbjct: 12689 cctcc 12685



to top

>dbj|AK101938.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033074G16, full
            insert sequence
          Length = 1496

 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Minus

                                                                        
Query: 354  tcttcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagc 413
            ||||| |||| ||||||||||||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 1154 tcttccgcggtgtcctccgagatgtctgaagtccacagggtcaggttatcacggaggagt 1095

                                      
Query: 414  tgcatgatcaaagtgctgtccttgta 439
            ||||||||||||||||||||||||||
Sbjct: 1094 tgcatgatcaaagtgctgtccttgta 1069



to top

>dbj|AK099243.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116M06, full
            insert sequence
          Length = 1830

 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Minus

                                                                        
Query: 354  tcttcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagc 413
            ||||| |||| ||||||||||||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 1513 tcttccgcggtgtcctccgagatgtctgaagtccacagggtcaggttatcacggaggagt 1454

                                      
Query: 414  tgcatgatcaaagtgctgtccttgta 439
            ||||||||||||||||||||||||||
Sbjct: 1453 tgcatgatcaaagtgctgtccttgta 1428



to top

>dbj|AK071822.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023117D08, full
            insert sequence
          Length = 1876

 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Minus

                                                                        
Query: 354  tcttcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagc 413
            ||||| |||| ||||||||||||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 1559 tcttccgcggtgtcctccgagatgtctgaagtccacagggtcaggttatcacggaggagt 1500

                                      
Query: 414  tgcatgatcaaagtgctgtccttgta 439
            ||||||||||||||||||||||||||
Sbjct: 1499 tgcatgatcaaagtgctgtccttgta 1474



to top

>dbj|AK071311.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023085B16, full
           insert sequence
          Length = 1156

 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Minus

                                                                       
Query: 354 tcttcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagc 413
           ||||| |||| ||||||||||||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 839 tcttccgcggtgtcctccgagatgtctgaagtccacagggtcaggttatcacggaggagt 780

                                     
Query: 414 tgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||||||||||||
Sbjct: 779 tgcatgatcaaagtgctgtccttgta 754



to top

>dbj|AK062065.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-D04, full
           insert sequence
          Length = 1116

 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Minus

                                                                       
Query: 354 tcttcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagc 413
           ||||| |||| ||||||||||||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 787 tcttccgcggtgtcctccgagatgtctgaagtccacagggtcaggttatcacggaggagt 728

                                     
Query: 414 tgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||||||||||||
Sbjct: 727 tgcatgatcaaagtgctgtccttgta 702



to top

>gb|U65956.1|OSU65956 Oryza sativa GF14-b protein mRNA, complete cds
          Length = 1170

 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Minus

                                                                       
Query: 354 tcttcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagc 413
           ||||| |||| ||||||||||||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 818 tcttccgcggtgtcctccgagatgtctgaagtccacagggtcaggttatcacggaggagt 759

                                     
Query: 414 tgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||||||||||||
Sbjct: 758 tgcatgatcaaagtgctgtccttgta 733



to top

>emb|BX842605.1|OSJN00299 Oryza sativa genomic DNA, chromosome 4, BAC clone: B1358B12, complete
             sequence
          Length = 131246

 Score =  107 bits (54), Expect = 3e-20
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                         
Query: 370   ccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgc 429
             |||||||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||
Sbjct: 78102 ccgagatgtctgaagtccacagggtcaggttatcacggaggagttgcatgatcaaagtgc 78043

                       
Query: 430   tgtccttgta 439
             ||||||||||
Sbjct: 78042 tgtccttgta 78033



to top

>emb|AL606460.3|OSJN00003 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072F16,
              complete sequence
          Length = 176383

 Score =  107 bits (54), Expect = 3e-20
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                          
Query: 370    ccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgc 429
              |||||||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||
Sbjct: 176189 ccgagatgtctgaagtccacagggtcaggttatcacggaggagttgcatgatcaaagtgc 176130

                        
Query: 430    tgtccttgta 439
              ||||||||||
Sbjct: 176129 tgtccttgta 176120



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  107 bits (54), Expect = 3e-20
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                            
Query: 370      ccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgc 429
                |||||||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||
Sbjct: 23081772 ccgagatgtctgaagtccacagggtcaggttatcacggaggagttgcatgatcaaagtgc 23081713

                          
Query: 430      tgtccttgta 439
                ||||||||||
Sbjct: 23081712 tgtccttgta 23081703



to top

>gb|AY110486.1| Zea mays CL1980_1 mRNA sequence
          Length = 1900

 Score =  107 bits (54), Expect = 3e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                        
Query: 354  tcttcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagc 413
            |||||||| | ||||||||||||||| |||||||| || |||| ||||||||| || |||
Sbjct: 1435 tcttcagcagggtcctccgagatgtcagaagtccatagggtcaagttatcacgaaggagc 1376

                                      
Query: 414  tgcatgatcaaagtgctgtccttgta 439
            ||||||||||||||||||||||||||
Sbjct: 1375 tgcatgatcaaagtgctgtccttgta 1350



to top

>emb|AL512547.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: B0812A04, complete
            sequence
          Length = 43144

 Score =  107 bits (54), Expect = 3e-20
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                        
Query: 370  ccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgc 429
            |||||||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||
Sbjct: 2706 ccgagatgtctgaagtccacagggtcaggttatcacggaggagttgcatgatcaaagtgc 2647

                      
Query: 430  tgtccttgta 439
            ||||||||||
Sbjct: 2646 tgtccttgta 2637



to top

>gb|BT016497.1| Zea mays clone Contig330 mRNA sequence
          Length = 1194

 Score =  101 bits (51), Expect = 2e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 365 gtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaa 424
           ||||||||||||||| |||||||| || |||| ||||||||| || ||||||||||||||
Sbjct: 802 gtcctccgagatgtcagaagtccatagggtcaagttatcacgaaggagctgcatgatcaa 743

                          
Query: 425 agtgctgtccttgta 439
           |||||||||||||||
Sbjct: 742 agtgctgtccttgta 728



to top

>gb|BT017754.1| Zea mays clone EL01N0450F06.c mRNA sequence
          Length = 1189

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                       
Query: 354 tcttcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagc 413
           |||||||| | ||||||||||||||| || ||||| || |||| ||||||||| || |||
Sbjct: 355 tcttcagcagggtcctccgagatgtcagaggtccatagggtcaagttatcacgaaggagc 414

                                     
Query: 414 tgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||||||||||||
Sbjct: 415 tgcatgatcaaagtgctgtccttgta 440



to top

>gb|M96856.1|MZEREGP Zea mays regulatory protein GF14-12 mRNA, complete cds
          Length = 1082

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 68/75 (90%)
 Strand = Plus / Minus

                                                                       
Query: 365 gtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaa 424
           ||||||||||||||| |||||||| || |||| ||||||| | || ||||||||||||||
Sbjct: 706 gtcctccgagatgtcagaagtccatagggtcaagttatcatgaaggagctgcatgatcaa 647

                          
Query: 425 agtgctgtccttgta 439
           |||||||||||||||
Sbjct: 646 agtgctgtccttgta 632



to top

>gb|AF548740.1| Triticum aestivum 14-3-3 protein mRNA, complete cds
          Length = 750

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 360 gcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatg 419
           |||| |||||||| ||||||||||||||| || |||| ||||||||| || || ||||||
Sbjct: 698 gcggtgtcctccgtgatgtcggaagtccagagggtcaagttatcacgaaggagttgcatg 639

                               
Query: 420 atcaaagtgctgtccttgta 439
           ||||| ||||||||||||||
Sbjct: 638 atcaaggtgctgtccttgta 619



to top

>emb|Y14200.1|HVY14200 Hordeum vulgare mRNA for 14-3-3 protein (Hv1433c)
          Length = 1155

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 360 gcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatg 419
           |||| |||||||| ||||||||||||||| || |||| ||||||||| || || ||||||
Sbjct: 814 gcggtgtcctccgtgatgtcggaagtccagagggtcaagttatcacgaaggagttgcatg 755

                               
Query: 420 atcaaagtgctgtccttgta 439
           ||||| ||||||||||||||
Sbjct: 754 atcaaggtgctgtccttgta 735



to top

>gb|S77133.1| GRF1=general regulatory factor [Zea mays, XL80, Genomic, 5348 nt]
          Length = 5348

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                        
Query: 370  ccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgc 429
            |||||||||| || ||||| || |||| ||||||||| || |||||||||||||||||||
Sbjct: 4504 ccgagatgtcagaggtccatagggtcaagttatcacgaaggagctgcatgatcaaagtgc 4445

                      
Query: 430  tgtccttgta 439
            ||||||||||
Sbjct: 4444 tgtccttgta 4435



to top

>gb|AC134053.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0005H02, complete sequence
          Length = 144882

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                        
Query: 381   gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
             ||||||||||| |||| ||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 51353 gaagtccacagagtcaagttgtcacgcaggagctgcatgatcaaagtgctgtccttgta 51295



to top

>gb|AY736127.1| Triticum aestivum 14-3-3 protein mRNA, complete cds
          Length = 804

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 357 tcagcggcgtcctccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgc 416
           ||||||| |||||||| |||||| | |||||| || |||| ||||||||| || || |||
Sbjct: 746 tcagcggtgtcctccgtgatgtcaggagtccagagggtcaagttatcacgaaggagttgc 687

                                  
Query: 417 atgatcaaagtgctgtccttgta 439
           |||||||| ||||||||||||||
Sbjct: 686 atgatcaaggtgctgtccttgta 664



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                           
Query: 381      gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
                ||||||||||| |||| ||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 19477076 gaagtccacagagtcaagttgtcacgcaggagctgcatgatcaaagtgctgtccttgta 19477018



to top

>dbj|AK101580.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033050N17, full
           insert sequence
          Length = 1298

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||| ||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 835 gaagtccacagagtcaagttgtcacgcaggagctgcatgatcaaagtgctgtccttgta 777



to top

>dbj|AK070548.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055G11, full
           insert sequence
          Length = 1345

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||| ||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 831 gaagtccacagagtcaagttgtcacgcaggagctgcatgatcaaagtgctgtccttgta 773



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                           
Query: 381      gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
                ||||||||||| |||| ||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 19636250 gaagtccacagagtcaagttgtcacgcaggagctgcatgatcaaagtgctgtccttgta 19636192



to top

>gb|U65958.1|OSU65958 Oryza sativa GF14-d protein mRNA, complete cds
          Length = 1002

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||| ||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 745 gaagtccacagagtcaagttgtcacgcaggagctgcatgatcaaagtgctgtccttgta 687



to top

>gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence
          Length = 132380

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                          
Query: 374    gatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtc 433
              ||||||||||||||| || |||||||| |||||||| || ||||||||||| || |||||
Sbjct: 105785 gatgtcggaagtccagagggtcaggttgtcacggaggagttgcatgatcaatgtactgtc 105844

                    
Query: 434    cttgta 439
              ||||||
Sbjct: 105845 cttgta 105850



to top

>gb|AF342780.1|AF342780 Brassica napus GF14 omega mRNA, complete cds
          Length = 1129

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           |||||||| ||||| || || ||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 790 atgtcggatgtccagagagtgaggttgtcacggagaagctgcatgatcaaggtgctgtct 731

                
Query: 435 ttgta 439
           |||||
Sbjct: 730 ttgta 726



to top

>dbj|AP004483.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT13O04, TM0016,
            complete sequence
          Length = 122116

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                        
Query: 375  atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
            ||||| || ||||| || || ||||||||||||||||| ||||||||||||||||| |||
Sbjct: 3216 atgtcagaggtccaaagggtgaggttatcacggagaagttgcatgatcaaagtgctatcc 3157

                 
Query: 435  ttgta 439
            |||||
Sbjct: 3156 ttgta 3152



to top

>gb|AY103898.1| Zea mays PCO115124 mRNA sequence
          Length = 1622

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                        
Query: 376  tgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcct 435
            ||||||||||||| || |||| ||| ||||| || ||||||||||||| |||||||||||
Sbjct: 1065 tgtcggaagtccatagggtcaagttgtcacgcaggagctgcatgatcagagtgctgtcct 1006

                
Query: 436  tgta 439
            ||||
Sbjct: 1005 tgta 1002



to top

>ref|NM_116969.2| Arabidopsis thaliana GRF1; protein phosphorylated amino acid
           binding AT4G09000 (GRF1) mRNA, complete cds
          Length = 1249

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 843 gaagtccagagagtgaggttatcacgaagaagctgcataatcaaagtactgtccttgta 785



to top

>emb|AL161513.2|ATCHRIV25 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 25
          Length = 179771

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                         
Query: 381    gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
              |||||||| || || ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 163415 gaagtccagagagtgaggttatcacgaagaagctgcataatcaaagtactgtccttgta 163357



to top

>gb|AY065064.1| Arabidopsis thaliana AT4g09000/F23J3_30 mRNA, complete cds
          Length = 1226

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 843 gaagtccagagagtgaggttatcacgaagaagctgcataatcaaagtactgtccttgta 785



to top

>gb|AF272572.1|AF272572 Populus x canescens clone INRA717-1-B4 14-3-3 protein (14-3-3P20-1)
           mRNA, complete cds
          Length = 1014

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || ||||| || ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 793 gaagtccagagtgtcagattgtcacggagaagttgcatgatcaatgtgctgtccttgta 735



to top

>gb|AF412067.1|AF412067 Arabidopsis thaliana AT4g09000/F23J3_30 mRNA, complete cds
          Length = 1194

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 810 gaagtccagagagtgaggttatcacgaagaagctgcataatcaaagtactgtccttgta 752



to top

>gb|BT024489.1| Arabidopsis thaliana At4g09000 mRNA, complete cds
          Length = 804

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 722 gaagtccagagagtgaggttatcacgaagaagctgcataatcaaagtactgtccttgta 664



to top

>emb|BX827760.1|CNS0A34H Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH19ZE07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1135

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 815 gaagtccagagagtgaggttatcacgaagaagctgcataatcaaagtactgtccttgta 757



to top

>gb|AY086143.1| Arabidopsis thaliana clone 21771 mRNA, complete sequence
          Length = 1163

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 780 gaagtccagagagtgaggttatcacgaagaagctgcataatcaaagtactgtccttgta 722



to top

>gb|AC005359.1|AC005359 REVERSE-COMPLEMENT OF: F23J3.GCG.SEQ  CHECK: 2754  FROM: 1  TO: 93489,
             complete sequence
          Length = 93489

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 381   gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
             |||||||| || || ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 28618 gaagtccagagagtgaggttatcacgaagaagctgcataatcaaagtactgtccttgta 28560



to top

>gb|AF191746.1|AF191746 Lilium longiflorum 14-3-3-like protein mRNA, complete cds
          Length = 1153

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttg 437
           ||||| |||||||| ||||| || || |||||||||||||||||||  ||||||||||||
Sbjct: 815 tcggaggtccacagagtcagattgtctcggagaagctgcatgatcagtgtgctgtccttg 756

             
Query: 438 ta 439
           ||
Sbjct: 755 ta 754



to top

>gb|AF037460.1|AF037460 Fritillaria agrestis GF14 protein (GRF) mRNA, complete cds
          Length = 1083

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttg 437
           ||||| |||||||| ||||| || || |||||||||||||||||||  ||||||||||||
Sbjct: 769 tcggaggtccacagagtcagattgtctcggagaagctgcatgatcagtgtgctgtccttg 710

             
Query: 438 ta 439
           ||
Sbjct: 709 ta 708



to top

>gb|AY604849.1| Tropaeolum majus 14-3-3 protein mRNA, complete cds
          Length = 1054

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| || |||||||| || || || ||||| ||||||||||||||||| |||||||||
Sbjct: 802 atgtctgaggtccacagagtgagattgtcacgcagaagctgcatgatcaaggtgctgtcc 743

                
Query: 435 ttgta 439
           |||||
Sbjct: 742 ttgta 738



to top

>gb|AC144342.26| Medicago truncatula clone mth2-10n2, complete sequence
          Length = 145497

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                         
Query: 375   atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
             ||||| || ||||| || || ||||||||||| ||||| ||||||||||||||||| |||
Sbjct: 44675 atgtcagatgtccatagggtgaggttatcacgaagaagttgcatgatcaaagtgctatcc 44616

                  
Query: 435   ttgta 439
             |||||
Sbjct: 44615 ttgta 44611



to top

>gb|BT018670.1| Zea mays clone EL01N0510D09.d mRNA sequence
          Length = 1291

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                       
Query: 376 tgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcct 435
           ||||||||||||| |  |||| ||| ||||| || ||||||||||||| |||||||||||
Sbjct: 819 tgtcggaagtccataaggtcaagttgtcacgcaggagctgcatgatcagagtgctgtcct 760

               
Query: 436 tgta 439
           ||||
Sbjct: 759 tgta 756



to top

>gb|AY070220.1| Solanum tuberosum 14-3-3 protein isoform 16R gene, complete cds
          Length = 4829

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 396  aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
            ||||||||||| |||||||||||||||| |||||| ||||||||
Sbjct: 2072 aggttatcacgaagaagctgcatgatcagagtgctatccttgta 2029



to top

>gb|AF499714.1| Thellungiella halophila 14-3-3-like protein mRNA, complete cds
          Length = 1154

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 728 aggttgtcacgaagaagctgcatgatcaaagtactgtccttgta 685



to top

>emb|Z48504.1|VFA1433A V.faba mRNA for 14-3-3 brain protein homolog (clone Vfa-1433a)
          Length = 946

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 713 aggttatcacggagaagttgcataatcaaagtgctatccttgta 670



to top

>emb|Y11685.1|ST16R1433 Solanum tuberosum mRNA for 14-3-3 protein, isolate 16R
          Length = 1219

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||||||||||||||| |||||| ||||||||
Sbjct: 784 aggttatcacgaagaagctgcatgatcagagtgctatccttgta 741



to top

>emb|X95904.2|LETFT6 L.esculentum mRNA for 14-3-3 protein, TFT6
          Length = 1152

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||||||||||||||| |||||| ||||||||
Sbjct: 780 aggttatcacgaagaagctgcatgatcagagtgctatccttgta 737



to top

>emb|AJ309008.3|NTA309008 Nicotiana tabacum mRNA for 14-3-3 protein
          Length = 1090

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||||||||||||||| |||||| ||||||||
Sbjct: 759 aggttatcacgaagaagctgcatgatcagagtgctatccttgta 716



to top

>gb|AF079104.1|AF079104 Lycopersicon esculentum 14-3-3 family protein mRNA, complete cds
          Length = 1026

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||||||||||||||| |||||| ||||||||
Sbjct: 756 aggttatcacgaagaagctgcatgatcagagtgctatccttgta 713



to top

>gb|L09112.1|ATHGFCHI Arabidopsis thaliana GF14 chi chain mRNA, complete cds
          Length = 1126

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 707 aggttatcacgaagaagctgcataatcaaagtactgtccttgta 664



to top

>dbj|AB117744.1| Nicotiana tabacum Nt14-3-3omega1 gene for 14-3-3 protein, complete
           cds
          Length = 1117

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||||||||||||||| |||||| ||||||||
Sbjct: 784 aggttatcacgaagaagctgcatgatcagagtgctatccttgta 741



to top

>gb|U31542.1|NCU31542 Neospora caninum 14-3-3 protein homologue mRNA, complete cds
          Length = 1757

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| || |||| ||||||||| |||||||||||||| | |||||||||||||||
Sbjct: 778 gtccagagagtcaagttatcacgcagaagctgcatgataagagtgctgtccttgta 723



to top

>gb|U09377.1|ATU09377 Arabidopsis thaliana GF14chi isoform (GRF1) gene, complete cds
          Length = 3250

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 396  aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
            ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 1860 aggttatcacgaagaagctgcataatcaaagtactgtccttgta 1817



to top

>ref|NM_121610.2| Arabidopsis thaliana GRF5; protein phosphorylated amino acid
           binding AT5G16050 (GRF5) mRNA, complete cds
          Length = 1153

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 796 gaagtccagagggtgagattgtcacggagaagctgcatgatcaatgtactgtccttgta 738



to top

>ref|NM_031603.1| Rattus norvegicus tyrosine 3-monooxygenase/tryptophan
           5-monooxygenase activation protein, epsilon polypeptide
           (Ywhae), mRNA
          Length = 1771

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 794 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 748



to top

>gb|AY742293.1| Malus x domestica 14-3-3 family protein mRNA, complete cds
          Length = 1090

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || ||||| || || ||||| |||||||||||||||||||| ||||||||
Sbjct: 791 gaagtccagagtgtcagattgtctcggaggagctgcatgatcaaagtgctatccttgta 733



to top

>ref|NM_009536.2| Mus musculus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
           activation protein, epsilon polypeptide (Ywhae), mRNA
          Length = 2025

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 794 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 748



to top

>gb|AY059115.1| Arabidopsis thaliana putative 14-3-3 protein GF14upsilon
           (At5g16050) mRNA, complete cds
          Length = 838

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 713 gaagtccagagggtgagattgtcacggagaagctgcatgatcaatgtactgtccttgta 655



to top

>gb|AY035170.1| Arabidopsis thaliana putative 14-3-3 protein GF14upsilon (grf5)
           (At5g16050) mRNA, complete cds
          Length = 1073

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 793 gaagtccagagggtgagattgtcacggagaagctgcatgatcaatgtactgtccttgta 735



to top

>emb|AL391145.1|ATF1N13 Arabidopsis thaliana DNA chromosome 5, BAC clone F1N13 (ESSA project)
          Length = 74687

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                        
Query: 381   gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
             |||||||| || || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 62926 gaagtccagagggtgagattgtcacggagaagctgcatgatcaatgtactgtccttgta 62984



to top

>emb|AL669897.15| Mouse DNA sequence from clone RP23-78H4 on chromosome 11 Contains the
             Ywhae gene for tyrosine 3-monooxygenase/tryptophan
             5-monooxygenase activation protein epsilon polypeptide,
             the Doc2b gene for double C2 beta, a novl gene, the 3' end
             of the gene for a novel protein similar to rat
             rabphilin-3a related protein and two CpG islands, complete
             sequence
          Length = 178980

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                            
Query: 375   atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
             ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 45320 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 45274



to top

>gb|AF483479.1| Mus musculus strain ISS epsilon 14-3-3 mRNA, complete cds
          Length = 768

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 704 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 658



to top

>gb|AF483478.1| Mus musculus strain ILS epsilon 14-3-3 mRNA, complete cds
          Length = 768

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 704 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 658



to top

>dbj|AK135867.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420429N06 product:tyrosine
           3-monooxygenase/tryptophan 5-monooxygenase activation
           protein, epsilon polypeptide, full insert sequence
          Length = 1730

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 773 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 727



to top

>dbj|AK135831.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420423C21 product:tyrosine
           3-monooxygenase/tryptophan 5-monooxygenase activation
           protein, epsilon polypeptide, full insert sequence
          Length = 2012

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 773 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 727



to top

>dbj|AK169812.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430026M14
           product:tyrosine 3-monooxygenase/tryptophan
           5-monooxygenase activation protein, epsilon polypeptide,
           full insert sequence
          Length = 1764

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 800 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 754



to top

>gb|L09109.1|ATHGFUPS Arabidopsis thaliana GF14 upsilon chain mRNA, complete cds
          Length = 990

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 719 gaagtccagagggtgagattgtcacggagaagctgcatgatcaatgtactgtccttgta 661



to top

>dbj|AK075995.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610018M01 product:tyrosine
           3-monooxygenase/tryptophan 5-monooxygenase activation
           protein, epsilon polypeptide, full insert sequence
          Length = 2025

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 794 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 748



to top

>dbj|AK011612.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610029I19 product:tyrosine
           3-monooxygenase/tryptophan 5-monooxygenase activation
           protein, epsilon polypeptide, full insert sequence
          Length = 1183

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 214 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 168



to top

>emb|BX829808.1|CNS0A1K3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB38ZG02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1042

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 780 gaagtccagagggtgagattgtcacggagaagctgcatgatcaatgtactgtccttgta 722



to top

>emb|BX832451.1|CNS0A14A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZC04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 997

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 764 gaagtccagagggtgagattgtcacggagaagctgcatgatcaatgtactgtccttgta 706



to top

>emb|AJ586516.1| Fagus sylvatica partial 14.3.3-1 mRNA for 14-3-3 protein
          Length = 531

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 369 tccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtg 428
           |||| |||||| ||||||||||  ||||| || || |||||||| ||||||||||| || 
Sbjct: 516 tccgtgatgtcagaagtccacaaagtcagattgtctcggagaagttgcatgatcaaggta 457

                      
Query: 429 ctgtccttgta 439
           |||||||||||
Sbjct: 456 ctgtccttgta 446



to top

>gb|AF001415.1|AF001415 Arabidopsis thaliana 14-3-3-like protein GF14 upsilon (GRF5) gene,
            complete cds
          Length = 4362

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 381  gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
            |||||||| || || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 2464 gaagtccagagggtgagattgtcacggagaagctgcatgatcaatgtactgtccttgta 2406



to top

>gb|U53882.1|RNU53882 Rattus norvegicus 14-3-3 protein epsilon isoform mRNA, complete cds
          Length = 1771

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 794 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 748



to top

>gb|M84416.1|RAT1433PEI Rat 14-3-3 protein epsilon isoform mRNA, complete cds
          Length = 1725

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 774 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 728



to top

>gb|BC063163.1| Rattus norvegicus tyrosine 3-monooxygenase/tryptophan
           5-monooxygenase activation protein, epsilon polypeptide,
           mRNA (cDNA clone MGC:72769 IMAGE:6921685), complete cds
          Length = 1457

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 772 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 726



to top

>gb|BC058686.1| Mus musculus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
           activation protein, epsilon polypeptide, mRNA (cDNA
           clone MGC:63439 IMAGE:6411635), complete cds
          Length = 1439

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 804 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 758



to top

>gb|U80070.1|MCU80070 Mesembryanthemum crystallinum 14-3-3-like protein (GBF) mRNA,
           complete cds
          Length = 1242

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 405 cggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||| ||||||||||||||
Sbjct: 743 cggagaagctgcatgatcaatgtgctgtccttgta 709



to top

>emb|Z19599.1|MME1433IS M.musculus epsilon 14-3-3 isoform mRNA
          Length = 1736

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 787 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 741



to top

>dbj|D30739.1|RAT1433PA Rat 14-3-3 protein mRNA for mitochondrial import stimulation factor
           (MSF) L subunit, complete cds
          Length = 1728

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 778 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 732



to top

>dbj|D87663.1| Mus musculus mRNA for 14-3-3 epsilon, complete cds
          Length = 1924

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 732 atgtctgaggtccacagcgtcaggttatcacgtagcagctgcatgat 686



to top

>emb|X76086.1|CPA215 Cucurbita pepo 14-3-3 protein
          Length = 1166

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 374 gatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtc 433
           |||||| |||||||| || || ||||| ||||| ||||| ||||||||||||||||| ||
Sbjct: 824 gatgtccgaagtccatagggtgaggttgtcacgaagaagttgcatgatcaaagtgctatc 765

                 
Query: 434 cttgta 439
            |||||
Sbjct: 764 tttgta 759



to top

>emb|X62388.1|HV1433PH H.vulgare  mRNA for 14-3-3 protein homologue (14-3-3a)
          Length = 1361

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttg 437
           ||||| ||||| || |||| ||| ||||| ||||| ||||||||||| ||||||||||||
Sbjct: 829 tcggaggtccagagggtcaagttgtcacgaagaagttgcatgatcaaggtgctgtccttg 770

             
Query: 438 ta 439
           ||
Sbjct: 769 ta 768



to top

>ref|NM_102411.1| Arabidopsis thaliana GRF12; protein phosphorylated amino acid
           binding AT1G26480 (GRF12) mRNA, complete cds
          Length = 1153

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 791 agctgcatgatcaaagtgctgtccttgta 763



to top

>ref|XM_507235.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1124_B05.7 mRNA
          Length = 2090

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 411  agctgcatgatcaaagtgctgtccttgta 439
            |||||||||||||||||||||||||||||
Sbjct: 1684 agctgcatgatcaaagtgctgtccttgta 1656



to top

>ref|XM_482517.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1168

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 762 agctgcatgatcaaagtgctgtccttgta 734



to top

>emb|X62838.1|OHPKCIH Oenothera elata subsp. hookeri mRNA for protein kinase C inhibitor
           homologue
          Length = 1017

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           |||||||| ||||| || || || || ||||| ||||| |||||||||| ||||||||||
Sbjct: 760 atgtcggatgtccagagggtgagattgtcacgaagaagttgcatgatcagagtgctgtcc 701

                
Query: 435 ttgta 439
           |||||
Sbjct: 700 ttgta 696



to top

>emb|AJ297911.1|HJE297911 Hypocrea jecorina ftt2 gene for 14-3-3-like protein, exons 1-5
          Length = 2040

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 381  gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtc 433
            ||||||||||| |||||||| ||||| || ||||||||||| | |||||||||
Sbjct: 1432 gaagtccacagggtcaggttgtcacgcaggagctgcatgatgagagtgctgtc 1380



to top

>emb|AJ238681.2|PSA238681 Pisum sativum mRNA for 14-3-3-like protein, sequence 1
          Length = 869

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 399 ttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 765 ttatcacgaagaagttgcatgatcaaagtgctatccttgta 725



to top

>gb|AF335544.1| Arabidopsis thaliana 14-3-3 protein GF14iota (grf12) mRNA, complete
           cds
          Length = 807

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 686 agctgcatgatcaaagtgctgtccttgta 658



to top

>gb|BT006230.1| Arabidopsis thaliana At1g26480 gene, complete cds
          Length = 807

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 686 agctgcatgatcaaagtgctgtccttgta 658



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                             
Query: 411      agctgcatgatcaaagtgctgtccttgta 439
                |||||||||||||||||||||||||||||
Sbjct: 20805865 agctgcatgatcaaagtgctgtccttgta 20805893



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                                
Query: 408      agaagctgcatgatcaaagtgctgtccttgta 439
                ||||||||||||||||  ||||||||||||||
Sbjct: 23744813 agaagctgcatgatcagggtgctgtccttgta 23744782



to top

>gb|M95066.1|MZEORFG Zea mays putative brain specific 14-3-3 protein, tau protein
           homolog  mRNA, partial cds
          Length = 187

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 tgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcct 435
           ||||||||||||| || |||| ||| ||  | || ||||||||||||| |||||||||||
Sbjct: 156 tgtcggaagtccatagggtcaagttgtcgngcaggagctgcatgatcagagtgctgtcct 97

               
Query: 436 tgta 439
           ||||
Sbjct: 96  tgta 93



to top

>gb|AY085338.1| Arabidopsis thaliana clone 146580 mRNA, complete sequence
          Length = 1153

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 791 agctgcatgatcaaagtgctgtccttgta 763



to top

>gb|AC013427.3|T1K7 Sequence of BAC T1K7 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 89473

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                          
Query: 411   agctgcatgatcaaagtgctgtccttgta 439
             |||||||||||||||||||||||||||||
Sbjct: 43590 agctgcatgatcaaagtgctgtccttgta 43562



to top

>dbj|AP003881.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1124_B05
          Length = 109917

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                          
Query: 411   agctgcatgatcaaagtgctgtccttgta 439
             |||||||||||||||||||||||||||||
Sbjct: 36998 agctgcatgatcaaagtgctgtccttgta 37026



to top

>dbj|AK117907.1| Arabidopsis thaliana At1g26480 mRNA for putative 14-3-3 protein
           epsilon, complete cds, clone: RAFL19-09-C10
          Length = 1152

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 790 agctgcatgatcaaagtgctgtccttgta 762



to top

>dbj|AK122149.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033138L07, full
           insert sequence
          Length = 1190

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 763 agctgcatgatcaaagtgctgtccttgta 735



to top

>dbj|AK070230.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041F18, full
            insert sequence
          Length = 2091

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 411  agctgcatgatcaaagtgctgtccttgta 439
            |||||||||||||||||||||||||||||
Sbjct: 1686 agctgcatgatcaaagtgctgtccttgta 1658



to top

>dbj|AK065266.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002K15, full
           insert sequence
          Length = 1169

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 763 agctgcatgatcaaagtgctgtccttgta 735



to top

>dbj|AK061786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E09, full
           insert sequence
          Length = 1085

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 576 agctgcatgatcaaagtgctgtccttgta 548



to top

>gb|U65957.1|OSU65957 Oryza sativa GF14-c protein mRNA, complete cds
          Length = 1207

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||||||||||||||||||
Sbjct: 743 agctgcatgatcaaagtgctgtccttgta 715



to top

>gb|U15036.1|PSU15036 Pisum sativum 14-3-3-like protein mRNA, complete cds
          Length = 1113

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 399 ttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 783 ttatcacgaagaagttgcatgatcaaagtgctatccttgta 743



to top

>gb|AY965896.2| Dunaliella salina 14-3-3 protein mRNA, complete cds
          Length = 1485

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| || ||||||||||||||||| || || || ||||||||||| |  |||||||||
Sbjct: 798 atgtctgaggtccacagcgtcaggttgtcccgcagcagctgcatgataagggtgctgtcc 739

                
Query: 435 ttgta 439
           |||||
Sbjct: 738 ttgta 734



to top

>dbj|AB042299.1| Vigna angularis mRNA for 14-3-3 protein, complete cds, clone:VaM41
          Length = 1094

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| || ||||| || || ||||||||||| || || ||||||||||||||||| |||
Sbjct: 781 atgtccgaggtccaaagggtgaggttatcacgaagcagttgcatgatcaaagtgctatcc 722

                
Query: 435 ttgta 439
           |||||
Sbjct: 721 ttgta 717



to top

>ref|XM_469508.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1362

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||||||
Sbjct: 918 gtccagagagtcagattgtcacgaagaagttgcatgatcaaggtgctgtccttgta 863



to top

>gb|DQ207874.1| Solanum tuberosum clone 089F11 14-3-3 protein-like mRNA, complete
           cds
          Length = 1083

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 743 aggttatcacgcagaagttgcataatcaaagtgctatccttgta 700



to top

>gb|AC162284.11| Mus musculus chromosome 8, clone RP23-256C11, complete sequence
          Length = 162981

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                     
Query: 384   gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
             ||||||||||||||||| || |  || |||||||||||||  ||||||||||||||
Sbjct: 57758 gtccacagcgtcaggttgtctctcaggagctgcatgatcagggtgctgtccttgta 57703



to top

>gb|AC087181.9| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0018H01
             map R1538, complete sequence
          Length = 142712

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 384   gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
             ||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||||||
Sbjct: 40631 gtccagagagtcagattgtcacgaagaagttgcatgatcaaggtgctgtccttgta 40686



to top

>gb|BT014142.1| Lycopersicon esculentum clone 133261F, mRNA sequence
          Length = 1042

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 710 aggttatcacgcagaagttgcataatcaaagtgctatccttgta 667



to top

>gb|AY573799.1| Solanum chacoense 14-3-3 protein mRNA, complete cds
          Length = 1079

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 745 aggttatcacgcagaagttgcataatcaaagtgctatccttgta 702



to top

>gb|AC127416.7| Mus musculus BAC clone RP23-457J22 from chromosome 8, complete sequence
          Length = 206997

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                      
Query: 384    gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
              ||||||||||||||||| || |  || |||||||||||||  ||||||||||||||
Sbjct: 186859 gtccacagcgtcaggttgtctctcaggagctgcatgatcagggtgctgtccttgta 186804



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                        
Query: 384      gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
                ||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||||||
Sbjct: 28372411 gtccagagagtcagattgtcacgaagaagttgcatgatcaaggtgctgtccttgta 28372356



to top

>gb|AC160547.6| Mus musculus chromosome 8, clone RP23-240F23, complete sequence
          Length = 170722

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                      
Query: 384    gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
              ||||||||||||||||| || |  || |||||||||||||  ||||||||||||||
Sbjct: 157346 gtccacagcgtcaggttgtctctcaggagctgcatgatcagggtgctgtccttgta 157291



to top

>gb|AF424640.1| Phytophthora infestans clone MY-01-D-08 14-3-3-like protein mRNA,
           complete cds
          Length = 1059

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| || |||||||| ||||| || |||||||||||||  ||||||||||||||
Sbjct: 727 gtccagagggtcaggttgtcacgcagcagctgcatgatcagcgtgctgtccttgta 672



to top

>emb|X95903.1|LETFT5 L.esculentum mRNA for 14-3-3 protein, TFT5
          Length = 1000

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 750 aggttatcacgcagaagttgcataatcaaagtgctatccttgta 707



to top

>gb|AF079451.1|AF079451 Lycopersicon esculentum clone SIG5 14-3-3 family protein mRNA,
           complete cds
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 711 aggttatcacgcagaagttgcataatcaaagtgctatccttgta 668



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                        
Query: 384      gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
                ||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||||||
Sbjct: 28463735 gtccagagagtcagattgtcacgaagaagttgcatgatcaaggtgctgtccttgta 28463680



to top

>dbj|AB119479.1| Nicotiana tabacum mRNA for 14-3-3 h-2 protein, complete cds
          Length = 1047

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || |||||||||||||||| |||||| ||||||||
Sbjct: 759 aggttatcgcgaagaagctgcatgatcagagtgctatccttgta 716



to top

>dbj|AB119478.1| Nicotiana tabacum mRNA for 14-3-3 h-1 protein, complete cds
          Length = 1082

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| || |||||||||||||||| |||||| ||||||||
Sbjct: 753 aggttatcgcgaagaagctgcatgatcagagtgctatccttgta 710



to top

>dbj|AB119466.1| Nicotiana tabacum mRNA for 14-3-3 a-1 protein, complete cds
          Length = 1106

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 771 aggttatcacgaagaagttgcataatcaaagtgctatccttgta 728



to top

>dbj|D16140.1|RICS94A Oryza sativa S94 mRNA for brain specific protein, complete cds
          Length = 1455

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||||||
Sbjct: 955 gtccagagagtcagattgtcacgaagaagttgcatgatcaaggtgctgtccttgta 900



to top

>dbj|AK103065.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033117N24, full
           insert sequence
          Length = 1382

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||||||
Sbjct: 920 gtccagagagtcagattgtcacgaagaagttgcatgatcaaggtgctgtccttgta 865



to top

>dbj|AK062077.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-F06, full
           insert sequence
          Length = 1174

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||||||
Sbjct: 923 gtccagagagtcagattgtcacgaagaagttgcatgatcaaggtgctgtccttgta 868



to top

>gb|DQ294278.1| Solanum tuberosum clone 178B04 14-3-3 protein-like protein mRNA,
           complete cds
          Length = 1067

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 744 aggttatcacgcagaagttgcataatcaaagtgctatccttgta 701



to top

>emb|AL590963.11| Mouse DNA sequence from clone RP23-395E10 on chromosome 11, complete
              sequence
          Length = 196724

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 384    gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
              ||||||||||||||||| || |  || |||||||||||||  ||||||||||||||
Sbjct: 132028 gtccacagcgtcaggttgtctctcaggagctgcatgatcagggtgctgtccttgta 132083



to top

>dbj|AB012775.1| Toxoplasma gondii mRNA for 14-3-3 protein homologue, complete cds
          Length = 1471

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| ||||  || ||||| |||||||||||||| | |||||||||||||||
Sbjct: 860 gtccacagagtcaaattgtcacgcagaagctgcatgatgagagtgctgtccttgta 805



to top

>dbj|AB042193.1| Triticum aestivum TaWIN1 mRNA, complete cds
          Length = 1094

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 tgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcct 435
           ||||||| ||||| || ||||  || ||||| || ||||||||||| |||||||||||||
Sbjct: 770 tgtcggatgtccatagagtcaaattgtcacgcaggagctgcatgattaaagtgctgtcct 711

               
Query: 436 tgta 439
           ||||
Sbjct: 710 tgta 707



to top

>gb|AF529418.1| Echinococcus granulosus putative growth regulator 14-3-3 mRNA,
           complete cds
          Length = 789

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 385 tccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||| |||||||| |||||||| || ||||||||||| | ||| |||||||||||
Sbjct: 721 tccagagcgtcagattatcacgcagtagctgcatgatgagagtactgtccttgta 667



to top

>gb|AY280670.1| Branchiostoma belcheri tsingtaunese 14-3-3 protein mRNA, complete
           cds
          Length = 1335

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 377 gtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcctt 436
           |||||| ||||||||||| ||||| || | ||| ||||||||||| | ||||||||| ||
Sbjct: 823 gtcggacgtccacagcgtgaggttgtctctgagcagctgcatgataagagtgctgtcttt 764

              
Query: 437 gta 439
           |||
Sbjct: 763 gta 761



to top

>emb|CR932957.2| Medicago truncatula chromosome 5 clone mth2-58c3, COMPLETE SEQUENCE
          Length = 136080

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 413   ctgcatgatcaaagtgctgtccttgta 439
             |||||||||||||||||||||||||||
Sbjct: 32004 ctgcatgatcaaagtgctgtccttgta 31978



to top

>gb|DQ444463.1| Camellia sinensis 14-3-3 protein mRNA, complete cds
          Length = 1072

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 393 gtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| |||||||| || || ||||| ||||||||||||||||||||
Sbjct: 771 gtcagattatcacgaaggagttgcattatcaaagtgctgtccttgta 725



to top

>emb|AJ004898.1|GMJ004898 Glycine max mRNA for 14-3-3 protein, partial
          Length = 445

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 369 tccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtg 428
           |||| |||||| || |||||||  ||||| || ||||||||||| ||||||||||| || 
Sbjct: 157 tccgtgatgtctgatgtccacaaagtcagattgtcacggagaagttgcatgatcaacgta 98

                      
Query: 429 ctgtccttgta 439
           || ||||||||
Sbjct: 97  ctatccttgta 87



to top

>gb|BC059441.1| Danio rerio tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
           activation protein, beta polypeptide like, mRNA (cDNA
           clone MGC:73065 IMAGE:4144776), complete cds
          Length = 1764

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||| ||| || || || |||||||||||||| |||||||| |||||
Sbjct: 704 gaagtccacagtgtcaagttgtcccgcagtagctgcatgatcaatgtgctgtctttgta 646



to top

>gb|BC065346.1| Danio rerio tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
           activation protein, beta polypeptide like, mRNA (cDNA
           clone MGC:77351 IMAGE:6968287), complete cds
          Length = 1837

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||| ||| || || || |||||||||||||| |||||||| |||||
Sbjct: 759 gaagtccacagtgtcaagttgtcccgcagtagctgcatgatcaatgtgctgtctttgta 701



to top

>ref|XM_691943.1| PREDICTED: Danio rerio similar to tyrosine
           3-monooxygenase/tryptophan 5-monooxygenase activation
           protein, beta polypeptide like (LOC573690), mRNA
          Length = 1838

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||| ||| || || || |||||||||||||| |||||||| |||||
Sbjct: 802 gaagtccacagtgtcaagttgtcccgcagtagctgcatgatcaatgtgctgtctttgta 744



to top

>gb|AF207904.1|AF207904 Echinococcus granulosus 14-3-3 protein (14-3-3) mRNA, complete cds
          Length = 909

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 385 tccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           |||| |||||||| |||||||| || ||||||||||| | ||| |||||||||||
Sbjct: 709 tccagagcgtcagattatcacgcagtagctgcatgatgagagtactgtccttgta 655



to top

>ref|NM_199562.1| Danio rerio tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
           activation protein, beta polypeptide like (ywhabl), mRNA
          Length = 1764

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| |||| ||| || || || |||||||||||||| |||||||| |||||
Sbjct: 704 gaagtccacagtgtcaagttgtcccgcagtagctgcatgatcaatgtgctgtctttgta 646



to top

>gb|AF066076.1|AF066076 Helianthus annuus 14-3-3-like protein mRNA, complete cds
          Length = 780

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||  || |||||||| || || ||||||||||| | |||||||||||||||
Sbjct: 719 gaagtccacaaagtaaggttatcgcgaagtagctgcatgatgagagtgctgtccttgta 661



to top

>gb|U70533.1|GMU70533 Glycine max 14-3-3 related protein SGF14A mRNA, complete cds
          Length = 1004

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 369 tccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtg 428
           |||| |||||| || |||||||  ||||| || ||||||||||| ||||||||||| || 
Sbjct: 729 tccgtgatgtctgatgtccacaaagtcagattgtcacggagaagttgcatgatcaacgta 670

                      
Query: 429 ctgtccttgta 439
           || ||||||||
Sbjct: 669 ctatccttgta 659



to top

>gb|DQ415922.1| Cleome spinosa clone BAC Cs1, complete sequence
          Length = 146078

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                          
Query: 374    gatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtc 433
              |||||| |||||||| || || ||||| || ||||| || ||||||||||| || |||||
Sbjct: 120333 gatgtcagaagtccatagggtgaggttgtcccggaggagttgcatgatcaatgtactgtc 120392

                    
Query: 434    cttgta 439
              ||||||
Sbjct: 120393 cttgta 120398



to top

>emb|AM040266.1| Capsicum chinense 14-3-3 gene, 5'UTR region
          Length = 775

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 414 tgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||||||||||||
Sbjct: 725 tgcatgatcaaagtgctgtccttgta 700



to top

>gb|DQ115331.1| Caenorhabditis remanei 14-3-3 protein (ftt-2) mRNA, partial cds
          Length = 645

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 396 aggttatcacggagaagctgcatgat 421
           ||||||||||||||||||||||||||
Sbjct: 403 aggttatcacggagaagctgcatgat 378



to top

>emb|Y11687.1|ST34G1433 Solanum tuberosum mRNA for 14-3-3 protein, isolate 34G
          Length = 1163

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 868 tcacgaagaagttgcatgatcaaagtgctatccttgta 831



to top

>emb|Y11686.1|ST27G1433 Solanum tuberosum mRNA for 14-3-3 protein, isolate 30G
          Length = 1107

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 704 tcacgaagaagttgcatgatcaaagtgctatccttgta 667



to top

>emb|X95901.2|LETFT2 L.esculentum mRNA for 14-3-3 protein, TFT2
          Length = 1120

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 759 tcacgaagaagttgcatgatcaaagtgctatccttgta 722



to top

>emb|X95902.1|LETFT3 L.esculentum mRNA for 14-3-3 protein, TFT3
          Length = 1054

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 791 tcacgaagaagttgcatgatcaaagtgctatccttgta 754



to top

>emb|AJ270959.1|LES270959 Lycopersicon esculentum partial mRNA for tft3 14-3-3 protein (tft3
           gene), clone mo5-3T12
          Length = 690

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 668 tcacgaagaagttgcatgatcaaagtgctatccttgta 631



to top

>gb|AF121194.2|AF121194 Populus x canescens 14-3-3 protein (14-3-3P20-2) mRNA, complete cds
          Length = 1051

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 414 tgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||||||||||||
Sbjct: 691 tgcatgatcaaagtgctgtccttgta 666



to top

>gb|DQ063576.1| Caenorhabditis remanei strain EM464 14-3-3 (ftt-2) mRNA, partial
           cds
          Length = 766

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 396 aggttatcacggagaagctgcatgat 421
           ||||||||||||||||||||||||||
Sbjct: 622 aggttatcacggagaagctgcatgat 597



to top

>dbj|AB119470.1| Nicotiana tabacum mRNA for 14-3-3 c-2 protein, complete cds
          Length = 1134

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 756 tcacgaagaagttgcatgatcaaagtgctatccttgta 719



to top

>dbj|AB119469.1| Nicotiana tabacum mRNA for 14-3-3 c-1 protein, complete cds
          Length = 1027

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 765 tcacgaagaagttgcatgatcaaagtgctatccttgta 728



to top

>dbj|AB117745.1| Nicotiana tabacum Nt14-3-3omega2 gene for 14-3-3 protein, complete
           cds
          Length = 1048

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 736 tcacgaagaagttgcatgatcaaagtgctatccttgta 699



to top

>emb|Y11211.1|NT1433LB N.tabacum mRNA for 14-3-3-like protein (B)
          Length = 1055

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 773 tcacgaagaagttgcatgatcaaagtgctatccttgta 736



to top

>gb|U91724.1|NTU91724 Nicotiana tabacum 14-3-3 isoform c T14-3c mRNA, complete cds
          Length = 1038

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 759 tcacgaagaagttgcatgatcaaagtgctatccttgta 722



to top

>gb|L29151.1|TOMPBLT3A Solanum lycopersicum (clone pBLT3) 14-3-3 protein homologue mRNA,
           complete cds
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 611 tcacgaagaagttgcatgatcaaagtgctatccttgta 574



to top

>dbj|AB042194.1| Triticum aestivum TaWIN2 mRNA, complete cds
          Length = 984

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 402 tcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||||||||  ||||||||||||||
Sbjct: 705 tcacggagaagttgcatgatcagggtgctgtccttgta 668



to top

>ref|NM_103213.2| Arabidopsis thaliana GRF4; protein phosphorylated amino acid
           binding AT1G35160 (GRF4) mRNA, complete cds
          Length = 1166

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| |||||||| || || || || ||||| ||||||||||||||||| || || |||
Sbjct: 814 atgtcagaagtccagagagtaagattgtcacgaagaagctgcatgatcaaggtactatcc 755

                
Query: 435 ttgta 439
           |||||
Sbjct: 754 ttgta 750



to top

>gb|AF272573.1|AF272573 Populus x canescens clone INRA717-1-B4 14-3-3 protein (14-3-3P20-4)
           mRNA, complete cds
          Length = 1000

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||| ||||||||||||||||||||
Sbjct: 695 agctgcataatcaaagtgctgtccttgta 667



to top

>gb|AY060534.1| Arabidopsis thaliana At1g35160/T32G9_30 mRNA, complete cds
          Length = 804

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| |||||||| || || || || ||||| ||||||||||||||||| || || |||
Sbjct: 731 atgtcagaagtccagagagtaagattgtcacgaagaagctgcatgatcaaggtactatcc 672

                
Query: 435 ttgta 439
           |||||
Sbjct: 671 ttgta 667



to top

>gb|AY039845.1| Arabidopsis thaliana At1g35160/T32G9_30 mRNA, complete cds
          Length = 1140

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| |||||||| || || || || ||||| ||||||||||||||||| || || |||
Sbjct: 801 atgtcagaagtccagagagtaagattgtcacgaagaagctgcatgatcaaggtactatcc 742

                
Query: 435 ttgta 439
           |||||
Sbjct: 741 ttgta 737



to top

>emb|BX814586.1|CNS0AC9T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB82ZF10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1077

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| |||||||| || || || || ||||| ||||||||||||||||| || || |||
Sbjct: 783 atgtcagaagtccagagagtaagattgtcacgaagaagctgcatgatcaaggtactatcc 724

                
Query: 435 ttgta 439
           |||||
Sbjct: 723 ttgta 719



to top

>emb|BX813581.1|CNS0AC0Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB25ZG05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1376

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| |||||||| || ||||  || ||||| ||||||||||||||||| || || |||
Sbjct: 886 atgtcagaagtccagagagtcaaattgtcacgaagaagctgcatgatcaaggtactatcc 827

                
Query: 435 ttgta 439
           |||||
Sbjct: 826 ttgta 822



to top

>gb|AC079605.13|AC079605 Arabidopsis thaliana chromosome 1 BAC T32G9 genomic sequence, complete
             sequence
          Length = 104807

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                         
Query: 375   atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
             ||||| |||||||| || || || || ||||| ||||||||||||||||| || || |||
Sbjct: 43156 atgtcagaagtccagagagtaagattgtcacgaagaagctgcatgatcaaggtactatcc 43215

                  
Query: 435   ttgta 439
             |||||
Sbjct: 43216 ttgta 43220



to top

>dbj|AB120322.1| Nicotiana tabacum mRNA for 14-3-3 f-2 protein, partial cds
          Length = 732

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| || |||||||  ||||| ||||| || ||||||||||| ||||| ||||| |||
Sbjct: 693 atgtccgaggtccacaaagtcagattatcgcgaagaagctgcattatcaacgtgctatcc 634

                
Query: 435 ttgta 439
           |||||
Sbjct: 633 ttgta 629



to top

>dbj|AB119476.1| Nicotiana tabacum mRNA for 14-3-3 f-1 protein, complete cds
          Length = 1131

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           |||||||| |||||||  ||||| ||||| || ||||||||||| ||||| || || |||
Sbjct: 735 atgtcggaggtccacaaagtcagattatcgcgaagaagctgcattatcaacgtactatcc 676

                
Query: 435 ttgta 439
           |||||
Sbjct: 675 ttgta 671



to top

>gb|AY084342.1| Arabidopsis thaliana clone 104934 mRNA, complete sequence
          Length = 1153

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| |||||||| || || || || ||||| ||||||||||||||||| || || |||
Sbjct: 814 atgtcagaagtccagagagtaagattgtcacgaagaagctgcatgatcaaggtactatcc 755

                
Query: 435 ttgta 439
           |||||
Sbjct: 754 ttgta 750



to top

>dbj|AB117746.1| Nicotiana tabacum Nt14-3-3omega3 gene for 14-3-3 protein, complete
           cds
          Length = 1161

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| || |||||||  ||||| ||||| || ||||||||||| ||||| ||||| |||
Sbjct: 793 atgtccgaggtccacaaagtcagattatcgcgaagaagctgcattatcaacgtgctatcc 734

                
Query: 435 ttgta 439
           |||||
Sbjct: 733 ttgta 729



to top

>gb|AF222805.1|AF222805 Euphorbia esula 14-3-3-like protein mRNA, complete cds
          Length = 1098

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||| ||||||||||||||
Sbjct: 752 agctgcatgatcaaggtgctgtccttgta 724



to top

>gb|AY111491.1| Zea mays CL2549_2 mRNA sequence
          Length = 882

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 411 agctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||| |||||||||||||||
Sbjct: 343 agctgcatgatcagagtgctgtccttgta 315



to top

>gb|AY105971.1| Zea mays PCO076386 mRNA sequence
          Length = 615

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| ||||||||||  || ||||| ||||| |||||||||||||| |  ||||| |||
Sbjct: 335 atgtcagaagtccacaaggtgaggttgtcacgaagaagctgcatgatgagtgtgctatcc 276

                
Query: 435 ttgta 439
           |||||
Sbjct: 275 ttgta 271



to top

>gb|U91727.1|NTU91727 Nicotiana tabacum 14-3-3 isoform f T14-3f mRNA, complete cds
          Length = 927

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| || |||||||  ||||| ||||| || ||||||||||| ||||| ||||| |||
Sbjct: 765 atgtccgaggtccacaaagtcagattatcgcgaagaagctgcattatcaacgtgctatcc 706

                
Query: 435 ttgta 439
           |||||
Sbjct: 705 ttgta 701



to top

>gb|AF001414.1|AF001414 Arabidopsis thaliana 14-3-3-like protein GF14 phi (GRF4) gene,
            complete cds
          Length = 4429

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 375  atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
            ||||| |||||||| || || || || ||||| ||||||||||||||||| || || |||
Sbjct: 2601 atgtcagaagtccagagagtaagattgtcacgaagaagctgcatgatcaaggtactatcc 2542

                 
Query: 435  ttgta 439
            |||||
Sbjct: 2541 ttgta 2537



to top

>gb|L09111.1|ATHGFPHI Arabidopsis thaliana GF14 protein phi chain mRNA, complete cds
          Length = 1126

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcc 434
           ||||| |||||||| || || || || ||||| ||||||||||||||||| || || |||
Sbjct: 782 atgtcagaagtccagagagtaagattgtcacgaagaagctgcatgatcaaggtactatcc 723

                
Query: 435 ttgta 439
           |||||
Sbjct: 722 ttgta 718



to top

>ref|NM_213145.1| Danio rerio tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
           activation protein, beta polypeptide (ywhab), mRNA
          Length = 1455

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 408 agaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| |||||||| |||||
Sbjct: 726 agaagctgcatgatcaaggtgctgtctttgta 695



to top

>ref|XM_482989.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1152

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 408 agaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||  ||||||||||||||
Sbjct: 796 agaagctgcatgatcagggtgctgtccttgta 765



to top

>ref|NM_018754.1| Mus musculus stratifin (Sfn), mRNA
          Length = 1430

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 855 gtccacagcgtcaggttgtctctcaggagctgcatgatgagggtgctgtccttgta 800



to top

>gb|AY224524.1| Oryza sativa (japonica cultivar-group) isolate 20818 TaWIN2-like
           protein mRNA, complete cds
          Length = 795

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 408 agaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||  ||||||||||||||
Sbjct: 704 agaagctgcatgatcagggtgctgtccttgta 673



to top

>gb|AC084162.3| Mus musculus strain C57BL6/J chromosome 5 clone RP23-11P12, complete
              sequence
          Length = 159180

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                      
Query: 384    gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
              ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 111862 gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 111917



to top

>emb|CT010208.1| Mus musculus full open reading frame cDNA clone RZPDo836G0950D for
           gene Ywhag, 3-monooxgenase/tryptophan 5-monooxgenase
           activation protein, gamma polypeptide; complete cds,
           incl. stopcodon
          Length = 744

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 701 gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 646



to top

>ref|XM_546936.2| PREDICTED: Canis familiaris similar to 14-3-3 protein gamma
           (LOC489818), mRNA
          Length = 1646

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| |||||||| ||||||||||| | ||||  |||||||||
Sbjct: 989 gtccagagcgttaggttgtcacggaggagctgcatgatgagagtggagtccttgta 934



to top

>gb|AC092728.2| Canis familiaris clone RP81-237O17, complete sequence
          Length = 141578

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                      
Query: 384    gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
              ||||| ||||| ||||| |||||||| ||||||||||| | ||||  |||||||||
Sbjct: 133160 gtccagagcgttaggttgtcacggaggagctgcatgatgagagtggagtccttgta 133215



to top

>ref|NM_019376.1| Rattus norvegicus tyrosine 3-monooxygenase/tryptophan
           5-monooxygenase activation protein, gamma polypeptide
           (Ywhag), mRNA
          Length = 3410

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 809 gtccagagcgttaggttgtctcggagcagctgcatgatcagagtggagtccttgta 754



to top

>gb|BC099129.1| Rattus norvegicus cDNA clone IMAGE:7461680, **** WARNING: chimeric
           clone ****
          Length = 3544

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 862 gtccacagcgtcaggttgtctctcagcagctgcatgatgagggtgctgtccttgta 807



to top

>gb|AC091514.2| Rattus norvegicus strain Brown Norway clone RP31-223K12, complete
            sequence
          Length = 148370

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 384  gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
            ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 4775 gtccagagcgttaggttgtctcggagcagctgcatgatcagagtggagtccttgta 4830



to top

>emb|BX058218.1|CNS09H32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 247

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 205 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 162



to top

>emb|BX031038.1|CNS08W42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 898 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 941



to top

>emb|BX031037.1|CNS08W41 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 742 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 699



to top

>emb|BX049248.1|CNS09A5W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 861 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 818



to top

>emb|BX029843.1|CNS08V6V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 848 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 805



to top

>emb|BX026330.1|CNS08SHA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 885 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 928



to top

>emb|BX026329.1|CNS08SH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 370 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 327



to top

>emb|X87370.1|ST1433PRO Solanum tuberosum mRNA for 14-3-3 protein, clone 20R
          Length = 1106

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 396 aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||| ||||| ||||| || |||||||| ||||||||
Sbjct: 749 aggttatcacgcagaagttgcataattaaagtgctatccttgta 706



to top

>gb|DQ445254.1| Sus scrofa stratifin (Sfn) mRNA, complete cds
          Length = 1310

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || || || ||||||||||| |  |||||||| |||||
Sbjct: 736 gtccacagcgtcaggttgtcccgcagcagctgcatgatgagggtgctgtctttgta 681



to top

>gb|BC053247.1| Danio rerio tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
           activation protein, beta polypeptide, mRNA (cDNA clone
           MGC:64092 IMAGE:6794927), complete cds
          Length = 1455

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 408 agaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| |||||||| |||||
Sbjct: 726 agaagctgcatgatcaaggtgctgtctttgta 695



to top

>emb|AJ504807.1|LES504807 Lycopersicon esculentum mRNA for 14-3-3 protein (tft4 gene)
          Length = 1104

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 tgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcct 435
           |||| |||||||| || || || || || |||||||| ||||||||||| || |||||||
Sbjct: 774 tgtcagaagtccaaagagtgagattgtctcggagaagttgcatgatcaatgtactgtcct 715

               
Query: 436 tgta 439
           ||||
Sbjct: 714 tgta 711



to top

>gb|AF532628.1| Glycine max 14-.3.3 protein mRNA, complete cds
          Length = 1073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 369 tccgagatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaa 424
           |||| |||||| || |||||||  ||||| || ||||||||||| |||||||||||
Sbjct: 777 tccgtgatgtctgatgtccacaaagtcagattgtcacggagaagttgcatgatcaa 722



to top

>gb|BC008129.1| Mus musculus 3-monooxygenase/tryptophan 5-monooxygenase activation
           protein, gamma polypeptide, mRNA (cDNA clone MGC:5794
           IMAGE:3498633), complete cds
          Length = 3510

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 816 gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 761



to top

>dbj|AK148618.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
           full-length enriched library, clone:7120424H12
           product:3-monooxgenase/tryptophan 5-monooxgenase
           activation protein, gamma polypeptide, full insert
           sequence
          Length = 1242

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 892 gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 837



to top

>dbj|AK146490.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920013G12 product:stratifin, full insert
           sequence
          Length = 1279

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 765 gtccacagcgtcaggttgtctctcaggagctgcatgatgagggtgctgtccttgta 710



to top

>dbj|AK153307.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830136H11
           product:3-monooxgenase/tryptophan 5-monooxgenase
           activation protein, gamma polypeptide, full insert
           sequence
          Length = 3516

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 892 gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 837



to top

>dbj|AK164356.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130065L17
           product:3-monooxgenase/tryptophan 5-monooxgenase
           activation protein, gamma polypeptide, full insert
           sequence
          Length = 3391

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 884 gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 829



to top

>dbj|AK169358.1| Mus musculus 17 days embryo stomach cDNA, RIKEN full-length
           enriched library, clone:I920192D20 product:stratifin,
           full insert sequence
          Length = 1272

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 756 gtccacagcgtcaggttgtctctcaggagctgcatgatgagggtgctgtccttgta 701



to top

>gb|S55305.1| Rattus sp. 14-3-3 protein gamma subtype mRNA, complete cds
          Length = 3410

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 809 gtccagagcgttaggttgtctcggagcagctgcatgatcagagtggagtccttgta 754



to top

>ref|NM_018871.2| Mus musculus 3-monooxygenase/tryptophan 5-monooxygenase activation
           protein, gamma polypeptide (Ywhag), mRNA
          Length = 3510

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 816 gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 761



to top

>dbj|AK088847.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430028K10
           product:3-monooxgenase/tryptophan 5-monooxgenase
           activation protein, gamma polypeptide, full insert
           sequence
          Length = 3474

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 846 gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 791



to top

>gb|AY224434.1| Oryza sativa (japonica cultivar-group) isolate 20818 WIN2-like
           protein mRNA, complete cds
          Length = 795

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 408 agaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||  ||||||||||||||
Sbjct: 704 agaagctgcatgatcagggtgctgtccttgta 673



to top

>ref|NM_174793.1| Bos taurus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
           activation protein, gamma polypeptide (YWHAG), mRNA
          Length = 744

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatca 423
           ||||| ||||| ||||| |||||||| |||||||||||||
Sbjct: 701 gtccagagcgtgaggttgtcacggagcagctgcatgatca 662



to top

>gb|AY973204.1| Haematococcus pluvialis Flotow NIES-144 14-3-3 protein mRNA,
           complete cds
          Length = 1020

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatca 423
           |||||||| |||||||| ||||| || |||||||||||||
Sbjct: 752 gtccacagggtcaggttgtcacgaagcagctgcatgatca 713



to top

>ref|XM_232745.3| PREDICTED: Rattus norvegicus stratifin (predicted) (Sfn_predicted),
            mRNA
          Length = 1644

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 384  gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
            ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 1124 gtccacagcgtcaggttgtctctcagcagctgcatgatgagggtgctgtccttgta 1069



to top

>gb|AF152893.1|AF152893 Mus musculus 14-3-3 protein sigma (Mme1) mRNA, complete cds
          Length = 747

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 692 gtccacagcgtcaggttgtctctcaggagctgcatgatgagggtgctgtccttgta 637



to top

>dbj|AP005391.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0092C08
          Length = 131049

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 408   agaagctgcatgatcaaagtgctgtccttgta 439
             ||||||||||||||||  ||||||||||||||
Sbjct: 34013 agaagctgcatgatcagggtgctgtccttgta 33982



to top

>dbj|AP004643.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1113_A10
          Length = 160089

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 408    agaagctgcatgatcaaagtgctgtccttgta 439
              ||||||||||||||||  ||||||||||||||
Sbjct: 152409 agaagctgcatgatcagggtgctgtccttgta 152378



to top

>dbj|AK210653.1| Mus musculus cDNA, clone:Y2G0119C12, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000055808, based on BLAT search
          Length = 399

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 57  gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 2



to top

>dbj|AK186099.1| Mus musculus cDNA, clone:Y0G0136E11, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000067664, based on BLAT search
          Length = 183

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 375 atgtcggaagtccacagcgtcaggttatcacg 406
           ||||| || |||||||||||||||||||||||
Sbjct: 32  atgtctgaggtccacagcgtcaggttatcacg 1



to top

>gb|BC089860.1| Rattus norvegicus similar to 14-3-3 protein sigma, mRNA (cDNA clone
           MGC:108952 IMAGE:7112967), complete cds
          Length = 1299

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 726 gtccacagcgtcaggttgtctctcagcagctgcatgatgagggtgctgtccttgta 671



to top

>gb|BC079389.1| Rattus norvegicus similar to 14-3-3 protein sigma, mRNA (cDNA clone
           IMAGE:7111773), partial cds
          Length = 1291

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 715 gtccacagcgtcaggttgtctctcagcagctgcatgatgagggtgctgtccttgta 660



to top

>ref|XM_564583.1| Anopheles gambiae str. PEST ENSANGP00000009311
           (ENSANGG00000006970), partial mRNA
          Length = 839

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 793 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 750



to top

>ref|XM_564585.1| Anopheles gambiae str. PEST ENSANGP00000027944
           (ENSANGG00000006970), mRNA
          Length = 953

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 848 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 805



to top

>ref|XM_564587.1| Anopheles gambiae str. PEST ENSANGP00000029364
           (ENSANGG00000006970), mRNA
          Length = 1463

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 801 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 758



to top

>ref|XM_564586.1| Anopheles gambiae str. PEST ENSANGP00000028977
           (ENSANGG00000006970), mRNA
          Length = 1471

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 809 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 766



to top

>ref|XM_564584.1| Anopheles gambiae str. PEST ENSANGP00000026603
           (ENSANGG00000006970), mRNA
          Length = 910

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 tcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 862 tcggacgtccacagcgtcaggttgtctcgcagcagctgcatgat 819



to top

>dbj|AK101599.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033051I09, full
           insert sequence
          Length = 1152

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 408 agaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||  ||||||||||||||
Sbjct: 796 agaagctgcatgatcagggtgctgtccttgta 765



to top

>gb|AF058799.1|AF058799 Mus musculus 14-3-3 protein gamma mRNA, complete cds
          Length = 1134

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 883 gtccagagcgtgaggttgtctcggagcagctgcatgatcagagtggagtccttgta 828



to top

>gb|AF058798.1|AF058798 Mus musculus 14-3-3 protein sigma mRNA, complete cds
          Length = 1430

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 855 gtccacagcgtcaggttgtctctcaggagctgcatgatgagggtgctgtccttgta 800



to top

>gb|AF043737.1|AF043737 Bos taurus 14-3-3 protein gamma mRNA, complete cds
          Length = 744

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatca 423
           ||||| ||||| ||||| |||||||| |||||||||||||
Sbjct: 701 gtccagagcgtgaggttgtcacggagcagctgcatgatca 662



to top

>emb|CT009705.9| Zebrafish DNA sequence from clone DKEYP-81C5 in linkage group 14,
              complete sequence
          Length = 200808

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 408    agaagctgcatgatcaaagtgctgtccttgta 439
              ||||||||||||||||| |||||||| |||||
Sbjct: 179365 agaagctgcatgatcaaggtgctgtctttgta 179334



to top

>emb|AL627228.31| Mouse DNA sequence from clone RP23-137L22 on chromosome 4, complete
              sequence
          Length = 193813

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                      
Query: 384    gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
              ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 176993 gtccacagcgtcaggttgtctctcaggagctgcatgatgagggtgctgtccttgta 177048



to top

>gb|L29150.1|TOMPBLT4A Solanum lycopersicum (clone pBLT4) 14-3-3 protein homologue mRNA,
           complete cds
          Length = 1094

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 tgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtcct 435
           |||| |||||||| || || || || || |||||||| ||||||||||| || |||||||
Sbjct: 764 tgtcagaagtccaaagagtgagattgtctcggagaagttgcatgatcaatgtactgtcct 705

               
Query: 436 tgta 439
           ||||
Sbjct: 704 tgta 701



to top

>ref|NM_001013941.1| Rattus norvegicus similar to 14-3-3 protein sigma (LOC298795), mRNA
          Length = 1299

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||||||||| || |  || ||||||||||| |  ||||||||||||||
Sbjct: 726 gtccacagcgtcaggttgtctctcagcagctgcatgatgagggtgctgtccttgta 671



to top

>dbj|D17447.1| Rattus norvegicus mRNA for 14-3-3 protein gamma-subtype, complete
           cds
          Length = 3410

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 384 gtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||| ||||| ||||| || ||||| ||||||||||||| ||||  |||||||||
Sbjct: 809 gtccagagcgttaggttgtctcggagcagctgcatgatcagagtggagtccttgta 754



to top

>gb|AY518222.1| Solanum tuberosum cultivar Desiree 14-3-3 protein isoform 20R gene,
            complete cds
          Length = 3959

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 396  aggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
            ||||||||||| ||||| ||||| || |||||||| ||||||||
Sbjct: 2304 aggttatcacgcagaagttgcataattaaagtgctatccttgta 2261



to top

>gb|DQ443318.1| Bombyx mori tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
           activation protein epsilon polypeptide mRNA, complete
           cds
          Length = 1576

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           |||||||| ||||||||||| ||||| || || || |||||||||||
Sbjct: 824 atgtcggaggtccacagcgtgaggttgtcccgcagcagctgcatgat 778



to top

>gb|DQ113651.1| Mus musculus Ywhae-like mRNA, partial sequence
          Length = 143

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 42/47 (89%), Gaps = 1/47 (2%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtca-ggttatcacggagaagctgcatga 420
           ||||| || ||||||||||||| |||||||||| || ||||||||||
Sbjct: 123 atgtctgaggtccacagcgtcagggttatcacgtagcagctgcatga 77



to top

>emb|Z48505.1|VFA1433B V.faba mRNA for 14-3-3 brain protein homolog (clone Vfa-1433b)
          Length = 1105

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 374 gatgtcggaagtccacagcgtcaggttatcacggagaagctgcatgatcaa 424
           |||||| |||||||| || |||||||| || | |||||| |||||||||||
Sbjct: 765 gatgtcagaagtccagagagtcaggttgtccctgagaagttgcatgatcaa 715



to top

>emb|X97724.1|ST1433 S.tuberosum mRNA for 14-3-3 protein
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 405 cggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||||||||| ||||| || |||||||||||
Sbjct: 733 cggagaagctgcataatcaatgtactgtccttgta 699



to top

>gb|DQ122865.1| Chlamydomonas incerta 14-3-3-like protein-related protein mRNA,
           complete cds
          Length = 1423

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 375 atgtcggaagtccacagcgtcaggttatcacggagaagctgcatgat 421
           |||||||| |||||||| || ||||| || ||||| |||||||||||
Sbjct: 735 atgtcggaggtccacagtgtgaggttgtcgcggagcagctgcatgat 689



to top

>gb|AF426249.1|AF426249 Fritillaria cirrhosa 14-3-3 protein (GF14) mRNA, complete cds
          Length = 1133

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 413 ctgcatgatcaaagtgctgtccttgta 439
           |||||| ||||||||||||||||||||
Sbjct: 709 ctgcataatcaaagtgctgtccttgta 683



to top

>dbj|AB119480.1| Nicotiana tabacum mRNA for 14-3-3 i-1 protein, complete cds
          Length = 1145

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 405 cggagaagctgcatgatcaaagtgctgtccttgta 439
           |||||||| ||||||||||| || |||||||||||
Sbjct: 735 cggagaagttgcatgatcaatgtactgtccttgta 701



to top

>dbj|AP006081.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT32P24, TM0120,
            complete sequence
          Length = 137804

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 413  ctgcatgatcaaagtgctgtccttgta 439
            ||||||||||||||| |||||||||||
Sbjct: 8425 ctgcatgatcaaagtactgtccttgta 8399



to top

>dbj|AB050953.1| Vicia faba mRNA for vf14-3-3d protein, complete cds
          Length = 1214

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 381 gaagtccacagcgtcaggttatcacggagaagctgcatgatcaaagtgctgtccttgta 439
           ||||||||||  |||||||| || |  ||||||||||||||||  |||||||| |||||
Sbjct: 774 gaagtccacaatgtcaggttgtccctcagaagctgcatgatcagtgtgctgtctttgta 716


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,600,559
Number of Sequences: 3902068
Number of extensions: 4600559
Number of successful extensions: 94756
Number of sequences better than 10.0: 374
Number of HSP's better than 10.0 without gapping: 373
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 94063
Number of HSP's gapped (non-prelim): 694
length of query: 439
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 417
effective length of database: 17,147,199,772
effective search space: 7150382304924
effective search space used: 7150382304924
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top