ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart20c11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_185092.1| Oryza sativa (japonica cultivar-group), mRNA 64 4e-07
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 64 4e-07
3gb|AC133339.3| Oryza sativa chromosome 3 BAC OSJNBa0078D06 genom... 64 4e-07
4dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
5gb|AC133778.4| Oryza sativa chromosome 3 BAC OSJNBb0027B08 genom... 64 4e-07
6ref|NM_185094.1| Oryza sativa (japonica cultivar-group), mRNA 62 2e-06
7ref|NM_185098.1| Oryza sativa (japonica cultivar-group), mRNA 58 2e-05
8ref|NM_185093.1| Oryza sativa (japonica cultivar-group), mRNA 54 4e-04
9ref|NM_185091.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.092
10dbj|AK071173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.092
11emb|CR377226.19| Zebrafish DNA sequence from clone DKEY-120I4 in... 44 0.36
12gb|CP000088.1| Thermobifida fusca YX, complete genome 44 0.36
13gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 44 0.36
14dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 44 0.36
15gb|AC169994.1| Rhesus Macaque BAC CH250-169F18 (Children's Hosp... 42 1.4
16emb|CR759789.8| Zebrafish DNA sequence from clone CH211-153M1, c... 42 1.4
17emb|BX901898.15| Zebrafish DNA sequence from clone DKEY-148E3 in... 42 1.4
18emb|BX640416.1| Bordetella pertussis strain Tohama I, complete g... 42 1.4
19emb|CR392032.9| Zebrafish DNA sequence from clone DKEYP-64A3 in ... 42 1.4
20gb|AC008679.5| Homo sapiens chromosome 5 clone CTB-53D8, complet... 42 1.4
21dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 42 1.4
22gb|AC006959.1| Homo sapiens chromosome 5, RP1-117N3 (LBNL h74), ... 42 1.4
23emb|BX005083.10| Zebrafish DNA sequence from clone CH211-220F13 ... 42 1.4
24emb|CR812482.14| Zebrafish DNA sequence from clone CH211-157N19 ... 42 1.4
25gb|AC005071.2|AC005071 Homo sapiens clone RG161A02, complete seq... 42 1.4
26gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 42 1.4
27emb|AL611927.21| Mouse DNA sequence from clone RP23-445E20 on ch... 42 1.4
28gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome... 40 5.7
29gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 40 5.7
30gb|AC102771.13| Mus musculus chromosome 1, clone RP23-175K23, co... 40 5.7
31gb|AC134595.3| Mus musculus BAC clone RP23-388E14 from chromosom... 40 5.7
32gb|AF537915.1| Tillandsia dodsonii chloroplast rps16 gene, intron 40 5.7
33emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 5.7
34emb|AL954222.1| Pan troglodytes chromosome 22 clone q21.2, compl... 40 5.7
35emb|CT010162.2| Pan troglodytes chromosome X BAC RP43-009H04, co... 40 5.7
36gb|AC129024.4| Mus musculus BAC clone RP23-436D14 from chromosom... 40 5.7
37gb|AC122914.4| Mus musculus BAC clone RP23-26F9 from 15, complet... 40 5.7
38gb|AC161500.4| Mus musculus chromosome 7, clone RP23-145H5, comp... 40 5.7
39emb|AL163278.2|HS21C078 Homo sapiens chromosome 21 segment HS21C078 40 5.7
40gb|AC133213.2| Mus musculus chromosome UL clone RP23-60I24, comp... 40 5.7
41emb|BX511036.18| Zebrafish DNA sequence from clone DKEY-279D7 in... 40 5.7
42emb|AL139278.12| Human DNA sequence from clone RP4-639D23 on chr... 40 5.7
43emb|AL031320.6|HS20N2 Human DNA sequence from clone RP1-20N2 on ... 40 5.7
44emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome... 40 5.7
45emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 40 5.7
46emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete ... 40 5.7
47gb|AC010108.6| Drosophila melanogaster 3L BAC RP98-23K9 (Roswell... 40 5.7
48gb|AC154127.2| Ornithorhynchus anatinus BAC clone OABb-20A1 from... 40 5.7
49gb|AC016817.6| Homo sapiens chromosome 10 clone RP11-13G8, compl... 40 5.7
50ref|NM_168454.1| Drosophila melanogaster CG32083-RA (CG32083), mRNA 40 5.7
51gb|AC096506.5| Homo sapiens Xp BAC RP11-64I1 (Roswell Park Cance... 40 5.7
52emb|BX649370.5| Zebrafish DNA sequence from clone DKEY-97I11 in ... 40 5.7
53gb|AF064858.2|AF064858 Homo sapiens chromosome 21 clone BAC 28F9... 40 5.7
54gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 40 5.7
55gb|AC020732.4|AC020732 Homo sapiens BAC clone RP11-556H16 from X... 40 5.7
56dbj|AK085371.1| Mus musculus 0 day neonate kidney cDNA, RIKEN fu... 40 5.7
57emb|BX119996.7| Mouse DNA sequence from clone RP23-352G15 on chr... 40 5.7
58dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
59gb|AC079945.21| Homo sapiens 3 BAC RP11-689D3 (Roswell Park Canc... 40 5.7
60gb|AF121905.1|AF121905 Rhodococcus sp. I24 aromatic compound bio... 40 5.7
61gb|AC018514.7|AC018514 Homo sapiens chromosome 14 clone RP11-76C... 40 5.7
62dbj|AP005862.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
63dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 5.7
64emb|BX005002.9| Zebrafish DNA sequence from clone CH211-130M12, ... 40 5.7
65gb|AC149314.2| Phakopsora pachyrhizi clone JGIAFNA-101K12, compl... 40 5.7
66gb|AC133598.4| Mus musculus BAC clone RP24-374G16 from 13, compl... 40 5.7
67emb|AL954223.1| Pan troglodytes chromosome 22 clone PTB-187O16 m... 40 5.7
68gb|AE003545.3| Drosophila melanogaster chromosome 3L, section 40... 40 5.7
69gb|AC172623.3| Mus musculus chromosome 8, clone RP23-478A9, comp... 40 5.7
70dbj|AP002967.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 5.7
71gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 5.7
72emb|AL806514.8| Mouse DNA sequence from clone RP23-18D24 on chro... 40 5.7
73gb|AC157478.3| Mus musculus BAC clone RP23-33K19 from chromosome... 40 5.7
74emb|AL928967.9| Zebrafish DNA sequence from clone CH211-153A8, c... 40 5.7
75gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 5.7
76gb|AC171502.2| Mus musculus BAC clone RP23-242G4 from chromosome... 40 5.7
77emb|AL449215.3|HS352H24 Homo sapiens chromosome 3 sequence from ... 40 5.7
78gb|AC164983.2| Mus musculus BAC clone RP23-16J24 from chromosome... 40 5.7
79gb|AC136741.24| Mus musculus chromosome 7, clone RP23-172P1, com... 40 5.7
80gb|AY614205.1| Racinaea ropalocarpa MB-57 rps16 gene, intron; ch... 40 5.7
81gb|AY614194.1| Tillandsia dodsonii MB-16 rps16 gene, intron; chl... 40 5.7
82gb|AY614193.1| Tillandsia narthecioides MB-60 rps16 gene, intron... 40 5.7
83dbj|AP003355.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 5.7
84dbj|AP000897.6| Homo sapiens genomic DNA, chromosome 18, clone:R... 40 5.7 
>ref|NM_185092.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 447

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 352 gttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctccttgtactcctg 411
           ||||||||||||||||| || ||||||||||||||||||   |||||||  |||||||||
Sbjct: 396 gttgaggtgccagccgagcttggggtcgtagccgcgggcgacgagctcccggtactcctg 337
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                            
Query: 352      gttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctccttgtactcctg 411
                ||||||||||||||||| || ||||||||||||||||||   |||||||  |||||||||
Sbjct: 34574531 gttgaggtgccagccgagcttggggtcgtagccgcgggcgacgagctcccggtactcctg 34574590



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                       
Query: 352      gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
                ||||||||||||||||| || ||||||||||||||||||
Sbjct: 34566847 gttgaggtgccagccgagcttggggtcgtagccgcgggc 34566885



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                            
Query: 340      gcggcgctcctggttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctc 399
                ||||||||||  |||||||||||| || | || ||||||||||||||| ||   ||||||
Sbjct: 34553276 gcggcgctccatgttgaggtgccacccaagcttggggtcgtagccgcgcgcggcgagctc 34553335

                                     
Query: 400      cttgtactcctgcacgagcgc 420
                | |||||||||| | ||||||
Sbjct: 34553336 cctgtactcctggatgagcgc 34553356



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 352      gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
                |||||||||||| |||| || ||||||||||||||||||
Sbjct: 34570131 gttgaggtgccatccgagcttggggtcgtagccgcgggc 34570169



 Score = 46.1 bits (23), Expect = 0.092
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 352      gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
                |||||||| ||| |||| || ||||||||||||||||||
Sbjct: 34579982 gttgaggtcccatccgagcttggggtcgtagccgcgggc 34580020
to top
>gb|AC133339.3| Oryza sativa chromosome 3 BAC OSJNBa0078D06 genomic sequence, complete
             sequence
          Length = 164236

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                         
Query: 352   gttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctccttgtactcctg 411
             ||||||||||||||||| || ||||||||||||||||||   |||||||  |||||||||
Sbjct: 32248 gttgaggtgccagccgagcttggggtcgtagccgcgggcgacgagctcccggtactcctg 32307



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                    
Query: 352   gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
             ||||||||||||||||| || ||||||||||||||||||
Sbjct: 24564 gttgaggtgccagccgagcttggggtcgtagccgcgggc 24602



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                         
Query: 340   gcggcgctcctggttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctc 399
             ||||||||||  |||||||||||| || | || ||||||||||||||| ||   ||||||
Sbjct: 10993 gcggcgctccatgttgaggtgccacccaagcttggggtcgtagccgcgcgcggcgagctc 11052

                                  
Query: 400   cttgtactcctgcacgagcgc 420
             | |||||||||| | ||||||
Sbjct: 11053 cctgtactcctggatgagcgc 11073



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                    
Query: 352   gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
             |||||||||||| |||| || ||||||||||||||||||
Sbjct: 27848 gttgaggtgccatccgagcttggggtcgtagccgcgggc 27886



 Score = 46.1 bits (23), Expect = 0.092
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 352   gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
             |||||||| ||| |||| || ||||||||||||||||||
Sbjct: 37699 gttgaggtcccatccgagcttggggtcgtagccgcgggc 37737
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                            
Query: 352      gttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctccttgtactcctg 411
                ||||||||||||||||| || ||||||||||||||||||   |||||||  |||||||||
Sbjct: 34664603 gttgaggtgccagccgagcttggggtcgtagccgcgggcgacgagctcccggtactcctg 34664662



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                       
Query: 352      gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
                ||||||||||||||||| || ||||||||||||||||||
Sbjct: 34656919 gttgaggtgccagccgagcttggggtcgtagccgcgggc 34656957



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                            
Query: 340      gcggcgctcctggttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctc 399
                ||||||||||  |||||||||||| || | || ||||||||||||||| ||   ||||||
Sbjct: 34643348 gcggcgctccatgttgaggtgccacccaagcttggggtcgtagccgcgcgcggcgagctc 34643407

                                     
Query: 400      cttgtactcctgcacgagcgc 420
                | |||||||||| | ||||||
Sbjct: 34643408 cctgtactcctggatgagcgc 34643428



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 352      gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
                |||||||||||| |||| || ||||||||||||||||||
Sbjct: 34660203 gttgaggtgccatccgagcttggggtcgtagccgcgggc 34660241



 Score = 46.1 bits (23), Expect = 0.092
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 352      gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
                |||||||| ||| |||| || ||||||||||||||||||
Sbjct: 34670054 gttgaggtcccatccgagcttggggtcgtagccgcgggc 34670092
to top
>gb|AC133778.4| Oryza sativa chromosome 3 BAC OSJNBb0027B08 genomic sequence, complete
             sequence
          Length = 129302

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                         
Query: 352   gttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctccttgtactcctg 411
             ||||||||||||||||| || ||||||||||||||||||   |||||||  |||||||||
Sbjct: 68802 gttgaggtgccagccgagcttggggtcgtagccgcgggcgacgagctcccggtactcctg 68743



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                    
Query: 352   gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
             ||||||||||||||||| || ||||||||||||||||||
Sbjct: 76486 gttgaggtgccagccgagcttggggtcgtagccgcgggc 76448



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                         
Query: 340   gcggcgctcctggttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctc 399
             ||||||||||  |||||||||||| || | || ||||||||||||||| ||   ||||||
Sbjct: 90057 gcggcgctccatgttgaggtgccacccaagcttggggtcgtagccgcgcgcggcgagctc 89998

                                  
Query: 400   cttgtactcctgcacgagcgc 420
             | |||||||||| | ||||||
Sbjct: 89997 cctgtactcctggatgagcgc 89977



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 352   gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
             |||||||||||| |||| || ||||||||||||||||||
Sbjct: 73202 gttgaggtgccatccgagcttggggtcgtagccgcgggc 73164



 Score = 46.1 bits (23), Expect = 0.092
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 352   gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
             |||||||| ||| |||| || ||||||||||||||||||
Sbjct: 63351 gttgaggtcccatccgagcttggggtcgtagccgcgggc 63313
to top
>ref|NM_185094.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 453

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 352 gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
           ||||||||||||||||| || ||||||||||||||||||
Sbjct: 396 gttgaggtgccagccgagcttggggtcgtagccgcgggc 358
to top
>ref|NM_185098.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 570

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 340 gcggcgctcctggttgaggtgccagccgatctcggggtcgtagccgcgggccttgagctc 399
           ||||||||||  |||||||||||| || | || ||||||||||||||| ||   ||||||
Sbjct: 521 gcggcgctccatgttgaggtgccacccaagcttggggtcgtagccgcgcgcggcgagctc 462

                                
Query: 400 cttgtactcctgcacgagcgc 420
           | |||||||||| | ||||||
Sbjct: 461 cctgtactcctggatgagcgc 441
to top
>ref|NM_185093.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 501

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 352 gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
           |||||||||||| |||| || ||||||||||||||||||
Sbjct: 394 gttgaggtgccatccgagcttggggtcgtagccgcgggc 356
to top
>ref|NM_185091.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 522

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 352 gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
           |||||||| ||| |||| || ||||||||||||||||||
Sbjct: 465 gttgaggtcccatccgagcttggggtcgtagccgcgggc 427
to top
>dbj|AK071173.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023082F07, full
           insert sequence
          Length = 828

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 352 gttgaggtgccagccgatctcggggtcgtagccgcgggc 390
           |||||||| ||| |||| || ||||||||||||||||||
Sbjct: 478 gttgaggtcccatccgagcttggggtcgtagccgcgggc 440
to top
>emb|CR377226.19| Zebrafish DNA sequence from clone DKEY-120I4 in linkage group 8, complete
              sequence
          Length = 173122

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 9      agcaaacacgattttttattcaaaac 34
              ||||||||||||||||| ||||||||
Sbjct: 112673 agcaaacacgatttttttttcaaaac 112648
to top
>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 370     ctcggggtcgtagccgcgggccttga 395
               ||||||||||||| ||||||||||||
Sbjct: 2264484 ctcggggtcgtaggcgcgggccttga 2264509
to top
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 376     gtcgtagccgcgggccttgagc 397
               ||||||||||||||||||||||
Sbjct: 2448278 gtcgtagccgcgggccttgagc 2448299
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 364    gccgatctcggggtcgtagccgcggg 389
              ||||||||||| ||||||||||||||
Sbjct: 810716 gccgatctcggagtcgtagccgcggg 810691
to top
>gb|AC169994.1| Rhesus Macaque  BAC CH250-169F18 (Children's Hospital Oakland Research
              Institute Rhesus macaque Adult Male BAC Library) complete
              sequence
          Length = 169688

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 115    gcaaagaagaagaaaaaagta 135
              |||||||||||||||||||||
Sbjct: 143674 gcaaagaagaagaaaaaagta 143654
to top
>emb|CR759789.8| Zebrafish DNA sequence from clone CH211-153M1, complete sequence
          Length = 165831

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 115    gcaaagaagaagaaaaaagta 135
              |||||||||||||||||||||
Sbjct: 126893 gcaaagaagaagaaaaaagta 126913
to top
>emb|BX901898.15| Zebrafish DNA sequence from clone DKEY-148E3 in linkage group 1, complete
              sequence
          Length = 249378

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 118    aagaagaagaaaaaagtacac 138
              |||||||||||||||||||||
Sbjct: 120442 aagaagaagaaaaaagtacac 120462
to top
>emb|BX640416.1| Bordetella pertussis strain Tohama I, complete genome; segment 6/12
          Length = 349354

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 376    gtcgtagccgcgggccttgagctcc 400
              |||||||||||| ||||||||||||
Sbjct: 256923 gtcgtagccgcgcgccttgagctcc 256947
to top
>emb|CR392032.9| Zebrafish DNA sequence from clone DKEYP-64A3 in linkage group 2, complete
              sequence
          Length = 191649

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 117    aaagaagaagaaaaaagtaca 137
              |||||||||||||||||||||
Sbjct: 172987 aaagaagaagaaaaaagtaca 172967
to top
>gb|AC008679.5| Homo sapiens chromosome 5 clone CTB-53D8, complete sequence
          Length = 232613

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    aaagaagaagaaaaaagtaca 137
              |||||||||||||||||||||
Sbjct: 182486 aaagaagaagaaaaaagtaca 182506
to top
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 326    gcggctgcgccgttgcggcgc 346
              |||||||||||||||||||||
Sbjct: 798083 gcggctgcgccgttgcggcgc 798063
to top
>gb|AC006959.1| Homo sapiens chromosome 5, RP1-117N3 (LBNL h74), complete sequence
          Length = 100987

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 117   aaagaagaagaaaaaagtaca 137
             |||||||||||||||||||||
Sbjct: 26152 aaagaagaagaaaaaagtaca 26172
to top
>emb|BX005083.10| Zebrafish DNA sequence from clone CH211-220F13 in linkage group 2,
              complete sequence
          Length = 212081

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    aaagaagaagaaaaaagtaca 137
              |||||||||||||||||||||
Sbjct: 172099 aaagaagaagaaaaaagtaca 172119
to top
>emb|CR812482.14| Zebrafish DNA sequence from clone CH211-157N19 in linkage group 1,
              complete sequence
          Length = 179573

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 118    aagaagaagaaaaaagtacac 138
              |||||||||||||||||||||
Sbjct: 172384 aagaagaagaaaaaagtacac 172364
to top
>gb|AC005071.2|AC005071 Homo sapiens clone RG161A02, complete sequence
          Length = 209382

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 38    aggctggctggctggctagcc 58
             |||||||||||||||||||||
Sbjct: 28245 aggctggctggctggctagcc 28265
to top
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 326    gcggctgcgccgttgcggcgc 346
              |||||||||||||||||||||
Sbjct: 829733 gcggctgcgccgttgcggcgc 829713
to top
>emb|AL611927.21| Mouse DNA sequence from clone RP23-445E20 on chromosome 4, complete
             sequence
          Length = 111802

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 34    ccagaggctggctggctggct 54
             |||||||||||||||||||||
Sbjct: 79735 ccagaggctggctggctggct 79715
to top
>gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome 17, complete sequence
          Length = 199737

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    aggctggctggctggctagc 57
             ||||||||||||||||||||
Sbjct: 51811 aggctggctggctggctagc 51792
to top
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 314     cccccggcaccggcggctgcgccgttgc 341
               |||||||||||| ||||| |||||||||
Sbjct: 3929696 cccccggcaccgccggctccgccgttgc 3929669
to top
>gb|AC102771.13| Mus musculus chromosome 1, clone RP23-175K23, complete sequence
          Length = 226416

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 248    agagcaaggcaataagcagc 267
              ||||||||||||||||||||
Sbjct: 146495 agagcaaggcaataagcagc 146476
to top
>gb|AC134595.3| Mus musculus BAC clone RP23-388E14 from chromosome 15, complete
             sequence
          Length = 189263

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    ttttattcaaaaccagaggc 41
             ||||||||||||||||||||
Sbjct: 29113 ttttattcaaaaccagaggc 29094
to top
>gb|AF537915.1| Tillandsia dodsonii chloroplast rps16 gene, intron
          Length = 866

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 aaagaagaagaaaaaagtac 136
           ||||||||||||||||||||
Sbjct: 668 aaagaagaagaaaaaagtac 687
to top
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 327     cggctgcgccgttgcggcgc 346
               ||||||||||||||||||||
Sbjct: 4263919 cggctgcgccgttgcggcgc 4263938
to top
>emb|AL954222.1| Pan troglodytes chromosome 22 clone q21.2, complete sequence
          Length = 208827

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 19     attttttattcaaaaccaga 38
              ||||||||||||||||||||
Sbjct: 151454 attttttattcaaaaccaga 151473
to top
>emb|CT010162.2| Pan troglodytes chromosome X BAC RP43-009H04, complete sequence
          Length = 195301

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    tattcaaaaccagaggctgg 44
             ||||||||||||||||||||
Sbjct: 46851 tattcaaaaccagaggctgg 46870
to top
>gb|AC129024.4| Mus musculus BAC clone RP23-436D14 from chromosome 6, complete sequence
          Length = 202285

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    aggctggctggctggctagc 57
             ||||||||||||||||||||
Sbjct: 42320 aggctggctggctggctagc 42301
to top
>gb|AC122914.4| Mus musculus BAC clone RP23-26F9 from 15, complete sequence
          Length = 207417

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  aaagtctaaacaagaattta 201
            ||||||||||||||||||||
Sbjct: 4290 aaagtctaaacaagaattta 4309
to top
>gb|AC161500.4| Mus musculus chromosome 7, clone RP23-145H5, complete sequence
          Length = 223833

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 38   aggctggctggctggctagc 57
            ||||||||||||||||||||
Sbjct: 6796 aggctggctggctggctagc 6815
to top
>emb|AL163278.2|HS21C078 Homo sapiens chromosome 21 segment HS21C078
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 19     attttttattcaaaaccaga 38
              ||||||||||||||||||||
Sbjct: 155905 attttttattcaaaaccaga 155924
to top
>gb|AC133213.2| Mus musculus chromosome UL clone RP23-60I24, complete sequence
          Length = 150628

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   agagcaaggcaataagcagc 267
             ||||||||||||||||||||
Sbjct: 80415 agagcaaggcaataagcagc 80434
to top
>emb|BX511036.18| Zebrafish DNA sequence from clone DKEY-279D7 in linkage group 6, complete
              sequence
          Length = 164653

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 189    aaacaagaatttacaaagcacgaa 212
              |||||||||| |||||||||||||
Sbjct: 113516 aaacaagaatctacaaagcacgaa 113539
to top
>emb|AL139278.12| Human DNA sequence from clone RP4-639D23 on chromosome Xp21.1-21.3
             Contains part of the DMD gene for dystrophin (muscular
             dystrophy, Duchenne and Becker types), complete sequence
          Length = 95866

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    tattcaaaaccagaggctgg 44
             ||||||||||||||||||||
Sbjct: 27182 tattcaaaaccagaggctgg 27163
to top
>emb|AL031320.6|HS20N2 Human DNA sequence from clone RP1-20N2 on chromosome 6q24 Contains the
             gene for a novel protein similar to yeast and bacterial
             cytosine deaminase, a novel protein similar to tubulin
             beta polypeptide 4 member Q (TUBB4Q) (probably a
             pseudogene), the PEX3 gene for peroxisomal biogenesis
             factor 3 (peroxin 3), a VDAC1 (voltage-dependent anion
             channel 1 (Plasmalemmal porin)) pseudogene, the gene for a
             novel protein similar to tissue fucosidase alpha-L-1, a
             novel gene and two CpG islands, complete sequence
          Length = 133574

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   caaagaagaagaaaaaagta 135
             ||||||||||||||||||||
Sbjct: 20684 caaagaagaagaaaaaagta 20665
to top
>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13
          Length = 349606

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 314    cccccggcaccggcggctgcgccgttgc 341
              |||||||||||| ||||| |||||||||
Sbjct: 119275 cccccggcaccgccggctccgccgttgc 119248
to top
>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14
          Length = 316050

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 314    cccccggcaccggcggctgcgccgttgc 341
              |||||||||||| ||||| |||||||||
Sbjct: 129688 cccccggcaccgccggctccgccgttgc 129661
to top
>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29
          Length = 309050

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 369    tctcggggtcgtagccgcgg 388
              ||||||||||||||||||||
Sbjct: 249353 tctcggggtcgtagccgcgg 249372
to top
>gb|AC010108.6| Drosophila melanogaster 3L BAC RP98-23K9 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 167187

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    cagaggctggctggctggct 54
             ||||||||||||||||||||
Sbjct: 52411 cagaggctggctggctggct 52392
to top
>gb|AC154127.2| Ornithorhynchus anatinus BAC clone OABb-20A1 from chromosome unknown,
              complete sequence
          Length = 188107

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 39     ggctggctggctggctagcc 58
              ||||||||||||||||||||
Sbjct: 127466 ggctggctggctggctagcc 127485
to top
>gb|AC016817.6| Homo sapiens chromosome 10 clone RP11-13G8, complete sequence
          Length = 159981

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 110   ccatcgcaaagaagaagaaaaaagtaca 137
             |||||||||| ||||| |||||||||||
Sbjct: 50377 ccatcgcaaaaaagaaaaaaaaagtaca 50350
to top
>ref|NM_168454.1| Drosophila melanogaster CG32083-RA (CG32083), mRNA
          Length = 662

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 35  cagaggctggctggctggct 54
           ||||||||||||||||||||
Sbjct: 149 cagaggctggctggctggct 168
to top
>gb|AC096506.5| Homo sapiens Xp BAC RP11-64I1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 120135

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    tattcaaaaccagaggctgg 44
             ||||||||||||||||||||
Sbjct: 70705 tattcaaaaccagaggctgg 70686
to top
>emb|BX649370.5| Zebrafish DNA sequence from clone DKEY-97I11 in linkage group 24,
              complete sequence
          Length = 167578

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 38     aggctggctggctggctagc 57
              ||||||||||||||||||||
Sbjct: 103461 aggctggctggctggctagc 103442
to top
>gb|AF064858.2|AF064858 Homo sapiens chromosome 21 clone BAC 28F9, map 21q22.3, complete
             sequence
          Length = 194769

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    attttttattcaaaaccaga 38
             ||||||||||||||||||||
Sbjct: 43189 attttttattcaaaaccaga 43208
to top
>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 114     cgcaaagaagaagaaaaaagtaca 137
               |||||| |||||||||||||||||
Sbjct: 1642760 cgcaaataagaagaaaaaagtaca 1642737
to top
>gb|AC020732.4|AC020732 Homo sapiens BAC clone RP11-556H16 from X, complete sequence
          Length = 181559

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    tattcaaaaccagaggctgg 44
             ||||||||||||||||||||
Sbjct: 68705 tattcaaaaccagaggctgg 68686
to top
>dbj|AK085371.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched
           library, clone:D630017K22 product:unclassifiable, full
           insert sequence
          Length = 2996

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 184 agtctaaacaagaatttacaaagc 207
           ||||||||||| ||||||||||||
Sbjct: 670 agtctaaacaaaaatttacaaagc 693
to top
>emb|BX119996.7| Mouse DNA sequence from clone RP23-352G15 on chromosome X, complete
             sequence
          Length = 191635

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   agagcaaggcaataagcagc 267
             ||||||||||||||||||||
Sbjct: 76419 agagcaaggcaataagcagc 76438
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 117      aaagaagaagaaaaaagtac 136
                ||||||||||||||||||||
Sbjct: 21311432 aaagaagaagaaaaaagtac 21311451
to top
>gb|AC079945.21| Homo sapiens 3 BAC RP11-689D3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 149249

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 64     aatacaatgatcaaattcag 83
              ||||||||||||||||||||
Sbjct: 125706 aatacaatgatcaaattcag 125725
to top
>gb|AF121905.1|AF121905 Rhodococcus sp. I24 aromatic compound bioconversion gene cluster,
             complete sequence
          Length = 11465

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 366   cgatctcggggtcgtagccg 385
             ||||||||||||||||||||
Sbjct: 10224 cgatctcggggtcgtagccg 10205
to top
>gb|AC018514.7|AC018514 Homo sapiens chromosome 14 clone RP11-76C24 map 14q24.3-31, complete
             sequence
          Length = 157144

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 283   gcccatctcctgcatgcctg 302
             ||||||||||||||||||||
Sbjct: 32036 gcccatctcctgcatgcctg 32017
to top
>dbj|AP005862.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0038K02
          Length = 118635

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   aaagaagaagaaaaaagtac 136
             ||||||||||||||||||||
Sbjct: 43811 aaagaagaagaaaaaagtac 43830
to top
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 385    gcgggccttgagctccttgt 404
              ||||||||||||||||||||
Sbjct: 818886 gcgggccttgagctccttgt 818905



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 377    tcgtagccgcgggccttgagctcc 400
              |||| |||||||||||||||||||
Sbjct: 544565 tcgtggccgcgggccttgagctcc 544588
to top
>emb|BX005002.9| Zebrafish DNA sequence from clone CH211-130M12, complete sequence
          Length = 170274

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    cagaggctggctggctggct 54
             ||||||||||||||||||||
Sbjct: 45235 cagaggctggctggctggct 45254
to top
>gb|AC149314.2| Phakopsora pachyrhizi clone JGIAFNA-101K12, complete sequence
          Length = 35483

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   atcgcaaagaagaagaaaaa 131
             ||||||||||||||||||||
Sbjct: 11394 atcgcaaagaagaagaaaaa 11413
to top
>gb|AC133598.4| Mus musculus BAC clone RP24-374G16 from 13, complete sequence
          Length = 170544

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   agagcaaggcaataagcagc 267
             ||||||||||||||||||||
Sbjct: 91651 agagcaaggcaataagcagc 91632
to top
>emb|AL954223.1| Pan troglodytes chromosome 22 clone PTB-187O16 map q21.2, complete
             sequence
          Length = 165877

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    attttttattcaaaaccaga 38
             ||||||||||||||||||||
Sbjct: 13700 attttttattcaaaaccaga 13719
to top
>gb|AE003545.3| Drosophila melanogaster chromosome 3L, section 40 of 83 of the complete
              sequence
          Length = 282115

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 35     cagaggctggctggctggct 54
              ||||||||||||||||||||
Sbjct: 111010 cagaggctggctggctggct 110991
to top
>gb|AC172623.3| Mus musculus chromosome 8, clone RP23-478A9, complete sequence
          Length = 182316

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 184   agtctaaacaagaatttacaaagc 207
             ||||||||||| ||||||||||||
Sbjct: 76375 agtctaaacaaaaatttacaaagc 76352
to top
>dbj|AP002967.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-648O15, complete
             sequence
          Length = 187568

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   aaagaagaagaaaaaagtac 136
             ||||||||||||||||||||
Sbjct: 67852 aaagaagaagaaaaaagtac 67871
to top
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 43      ggctggctggctagccatac 62
               ||||||||||||||||||||
Sbjct: 4182622 ggctggctggctagccatac 4182641
to top
>emb|AL806514.8| Mouse DNA sequence from clone RP23-18D24 on chromosome 2, complete
              sequence
          Length = 206358

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 37     gaggctggctggctggctag 56
              ||||||||||||||||||||
Sbjct: 196684 gaggctggctggctggctag 196703
to top
>gb|AC157478.3| Mus musculus BAC clone RP23-33K19 from chromosome 15, complete sequence
          Length = 229783

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    ttttattcaaaaccagaggc 41
             ||||||||||||||||||||
Sbjct: 10567 ttttattcaaaaccagaggc 10586
to top
>emb|AL928967.9| Zebrafish DNA sequence from clone CH211-153A8, complete sequence
          Length = 186487

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 35   cagaggctggctggctggct 54
            ||||||||||||||||||||
Sbjct: 1497 cagaggctggctggctggct 1516
to top
>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 385    gcgggccttgagctccttgt 404
              ||||||||||||||||||||
Sbjct: 489966 gcgggccttgagctccttgt 489985
to top
>gb|AC171502.2| Mus musculus BAC clone RP23-242G4 from chromosome 6, complete
            sequence
          Length = 209147

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 38   aggctggctggctggctagc 57
            ||||||||||||||||||||
Sbjct: 7390 aggctggctggctggctagc 7409
to top
>emb|AL449215.3|HS352H24 Homo sapiens chromosome 3 sequence from BAC 352H24 map 3q21 region
             D3S3607-D3S1587, complete sequence
          Length = 134296

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    aatacaatgatcaaattcag 83
             ||||||||||||||||||||
Sbjct: 21500 aatacaatgatcaaattcag 21481
to top
>gb|AC164983.2| Mus musculus BAC clone RP23-16J24 from chromosome 17, complete sequence
          Length = 224370

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 38     aggctggctggctggctagc 57
              ||||||||||||||||||||
Sbjct: 119903 aggctggctggctggctagc 119884
to top
>gb|AC136741.24| Mus musculus chromosome 7, clone RP23-172P1, complete sequence
          Length = 211802

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    aggctggctggctggctagc 57
             ||||||||||||||||||||
Sbjct: 48800 aggctggctggctggctagc 48781
to top
>gb|AY614205.1| Racinaea ropalocarpa MB-57 rps16 gene, intron; chloroplast
          Length = 841

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 aaagaagaagaaaaaagtac 136
           ||||||||||||||||||||
Sbjct: 658 aaagaagaagaaaaaagtac 677
to top
>gb|AY614194.1| Tillandsia dodsonii MB-16 rps16 gene, intron; chloroplast
          Length = 837

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 aaagaagaagaaaaaagtac 136
           ||||||||||||||||||||
Sbjct: 654 aaagaagaagaaaaaagtac 673
to top
>gb|AY614193.1| Tillandsia narthecioides MB-60 rps16 gene, intron; chloroplast
          Length = 838

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 aaagaagaagaaaaaagtac 136
           ||||||||||||||||||||
Sbjct: 655 aaagaagaagaaaaaagtac 674
to top
>dbj|AP003355.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1517D11
          Length = 153728

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 26    attcaaaaccagaggctggctggc 49
             ||||||| ||||||||||||||||
Sbjct: 37950 attcaaagccagaggctggctggc 37973
to top
>dbj|AP000897.6| Homo sapiens genomic DNA, chromosome 18, clone:RP11-678G15, complete
              sequence
          Length = 187987

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     cagaggctggctggctggct 54
              ||||||||||||||||||||
Sbjct: 131313 cagaggctggctggctggct 131332


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,970,225
Number of Sequences: 3902068
Number of extensions: 4970225
Number of successful extensions: 141904
Number of sequences better than 10.0: 84
Number of HSP's better than 10.0 without gapping: 84
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 141052
Number of HSP's gapped (non-prelim): 852
length of query: 423
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 401
effective length of database: 17,147,199,772
effective search space: 6876027108572
effective search space used: 6876027108572
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top