>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
            complete cds
          Length = 1283

 Score =  317 bits (160), Expect = 1e-83
 Identities = 260/288 (90%), Gaps = 9/288 (3%)
 Strand = Plus / Minus

                                                                        
Query: 6    aggaaaaggaatgcgggctaattaagacaagcgatcccatggaccgaattacaacacacg 65
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1189 aggaaaagcaatgcgggctaattaagacaagcgatcccatggaccgaattacaagacacg 1130

                                                                        
Query: 66   gcacgcatgactgggc-acatac---gcatatgcagctgccgacacataaataacacgac 121
            ||||||||||| || | || |||   |||||||||||||||||||||||| |||||||||
Sbjct: 1129 gcacgcatgaccggaccacgtactacgcatatgcagctgccgacacataa-taacacgac 1071

                                                                        
Query: 122  cattgcagcgggc-aactgaactggcgagaagttgcaaaagcggctttctctttggatgg 180
            |||||| |||| | |||||||||| ||||||||||||||||||  ||||||| |||||||
Sbjct: 1070 cattgcggcggccgaactgaactgtcgagaagttgcaaaagcgcatttctctctggatgg 1011

                                                                        
Query: 181  atggacacagcacagggcgccattgcttcaatcttgcatgcacatcacatg---gataac 237
            ||||||||| ||| || ||||||||||||| |||||||| || || |||||   ||||||
Sbjct: 1010 atggacacaacacgggtcgccattgcttcagtcttgcatacagatgacatggatgataac 951

                                                            
Query: 238  tcgttacgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
            | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 950  ttgttacgcgttgctcctgaaggagccgagggccttgatggcgccggc 903

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 43/43 (100%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 926

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                   
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgcc 282
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgcc 885

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                   
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgcc 282
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgcc 833

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggc 936

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggc 938

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggc 939

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                           
Query: 243      acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
                |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggc 15355810



 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 242      tacgcgttgctcctgaaggagccg 265
                ||||||||||||| ||||||||||
Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           |||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggc 502

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                        
Query: 243   acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
             |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggc 62809



 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 242   tacgcgttgctcctgaaggagccg 265
             ||||||||||||| ||||||||||
Sbjct: 13550 tacgcgttgctccggaaggagccg 13527

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggc 936

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggc 530

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggc 936

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           |||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggc 939

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 37/37 (100%)
 Strand = Plus / Minus

                                                
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggc 279
           |||||||||||||||||||||||||||||||||||||
Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggc 907

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 39/40 (97%)
 Strand = Plus / Minus

                                                   
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgcc 282
           ||||||||||||||||||||||||| ||||||||||||||
Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcc 957

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 39/40 (97%)
 Strand = Plus / Minus

                                                    
Query: 243  acgcgttgctcctgaaggagccgagggccttgatggcgcc 282
            ||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcc 1607

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggc 285
           ||||||||||||||| |||||||||||| ||||||||||||||
Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggc 938

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 248 ttgctcctgaaggagccgagggccttgatggc 279
           |||||||||||||| ||||| |||||||||||
Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 247 gttgctcctgaaggagccgagggccttgatggc 279
           |||||||| ||||||||| || |||||||||||
Sbjct: 837 gttgctccggaaggagcccagcgccttgatggc 805

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 247   gttgctcctgaaggagccgagggccttgatggc 279
             |||||||| ||||||||| || |||||||||||
Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggc 91044

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 247     gttgctcctgaaggagccgagggccttgatggc 279
               |||||||| ||||||||| || |||||||||||
Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggc 8906735

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 247 gttgctcctgaaggagccgagggccttgatggc 279
           |||||||| ||||||||| || |||||||||||
Sbjct: 936 gttgctccggaaggagcccagcgccttgatggc 904

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 247 gttgctcctgaaggagccgagggccttgatggc 279
           |||||||| ||||||||| || |||||||||||
Sbjct: 930 gttgctccggaaggagcccagcgccttgatggc 898

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 247 gttgctcctgaaggagccgagggccttgatggc 279
           |||||||| ||||||||| || |||||||||||
Sbjct: 924 gttgctccggaaggagcccagcgccttgatggc 892

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 242 tacgcgttgctcctgaaggagccg 265
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931

>gb|AC129492.6| Homo sapiens chromosome 17, clone RP11-599B13, complete sequence
          Length = 196037

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 179    ggatggacacagcacagggc 198
              ||||||||||||||||||||
Sbjct: 141383 ggatggacacagcacagggc 141402

>emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on chromosome 11 Contains the
             3' end of the Ulk2 gene for Unc-51 like kinase 2 (C.
             elegans), the Prpsap2 gene for phosphoribosyl
             pyrophosphate synthetase-associated protein 2, the gene
             for a novel sodium/glucose cotransporter protein, the gene
             for a novel protein (2310040C09Rik), the Grap gene for
             GRB2-related adaptor protein and a CpG island, complete
             sequence
          Length = 186359

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 166   tttctctttggatggatgga 185
             ||||||||||||||||||||
Sbjct: 79799 tttctctttggatggatgga 79818

>gb|AC104762.7| Homo sapiens chromosome 17, clone RP11-769H22, complete sequence
          Length = 162678

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 179    ggatggacacagcacagggc 198
              ||||||||||||||||||||
Sbjct: 141383 ggatggacacagcacagggc 141402

>dbj|AB030817.1| Homo sapiens hper1 gene for period1, complete cds
          Length = 16682

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   ggatggacacagcacagggc 198
             ||||||||||||||||||||
Sbjct: 10756 ggatggacacagcacagggc 10737

>gb|AC130329.8| Homo sapiens chromosome 17, clone RP13-348C17, complete sequence
          Length = 74378

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   ggatggacacagcacagggc 198
             ||||||||||||||||||||
Sbjct: 36917 ggatggacacagcacagggc 36898

>gb|AF102137.1|AF102137 Homo sapiens PER1 gene, complete cds
          Length = 14867

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 179  ggatggacacagcacagggc 198
            ||||||||||||||||||||
Sbjct: 7794 ggatggacacagcacagggc 7775

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0475E07
          Length = 139961

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 242   tacgcgttgctcctgaaggagccg 265
             ||||||||||||| ||||||||||
Sbjct: 92564 tacgcgttgctccggaaggagccg 92541

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 242 tacgcgttgctcctgaaggagccg 265
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,488,873
Number of Sequences: 3902068
Number of extensions: 2488873
Number of successful extensions: 39391
Number of sequences better than 10.0: 34
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39318
Number of HSP's gapped (non-prelim): 70
length of query: 285
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 263
effective length of database: 17,147,199,772
effective search space: 4509713540036
effective search space used: 4509713540036
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)