ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart19h04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X75778.1|ASTCPP1A A.sativa (Pewi) ASTCP-K36 mRNA for t compl... 266 6e-68
2emb|X75777.1|ASTCPP1 A.sativa (Pewi) ASTCP-K19 mRNA for t comple... 262 9e-67
3dbj|AK105701.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 6e-37
4dbj|AK067114.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 6e-37
5dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
6dbj|AP003714.2| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
7gb|AY103729.1| Zea mays PCO099347 mRNA sequence 131 2e-27
8gb|BT017463.1| Zea mays clone EL01N0407F08.c mRNA sequence 127 3e-26
9gb|AF097668.1|AF097668 Mesembryanthemum crystallinum T-complex p... 107 3e-20
10gb|AC141435.28| Medicago truncatula clone mth2-21i11, complete s... 94 5e-16
11emb|CT030174.3| M.truncatula DNA sequence from clone MTH2-71J12 ... 94 5e-16
12emb|X85013.1|CSRNATCP1 C.sativus mRNA for T-complex polypeptide 1 68 3e-08
13emb|CR734406.2|CNS0GTG5 Tetraodon nigroviridis full-length cDNA 58 3e-05
14emb|CR734368.2|CNS0GTF3 Tetraodon nigroviridis full-length cDNA 58 3e-05
15emb|CR704636.2|CNS0G6NC Tetraodon nigroviridis full-length cDNA 58 3e-05
16emb|CR702647.2|CNS0G543 Tetraodon nigroviridis full-length cDNA 58 3e-05
17emb|CR693702.2|CNS0FY7M Tetraodon nigroviridis full-length cDNA 58 3e-05
18emb|CR693121.2|CNS0FXRH Tetraodon nigroviridis full-length cDNA 58 3e-05
19emb|CR692993.2|CNS0FXNX Tetraodon nigroviridis full-length cDNA 58 3e-05
20emb|CR682065.2|CNS0FP8D Tetraodon nigroviridis full-length cDNA 58 3e-05
21emb|CR664385.2|CNS0FBLZ Tetraodon nigroviridis full-length cDNA 58 3e-05
22emb|CR659491.2|CNS0F7U1 Tetraodon nigroviridis full-length cDNA 58 3e-05
23ref|XM_774923.1| PREDICTED: Strongylocentrotus purpuratus simila... 56 1e-04
24ref|XM_796613.1| PREDICTED: Strongylocentrotus purpuratus simila... 56 1e-04
25gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 gen... 56 1e-04
26dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
27dbj|AK106739.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
28dbj|AK070073.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
29gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 56 1e-04
30emb|BX064596.1|CNS09M08 Single read from an extremity of a full-... 54 4e-04
31emb|BX059609.1|CNS09I5P Single read from an extremity of a full-... 54 4e-04
32emb|BX058534.1|CNS09HBU Single read from an extremity of a full-... 54 4e-04
33emb|BX058090.1|CNS09GZI Single read from an extremity of a full-... 54 4e-04
34emb|BX047036.1|CNS098GG Single read from an extremity of a full-... 54 4e-04
35emb|BX042897.1|CNS0959H Single read from an extremity of a full-... 54 4e-04
36emb|BX037203.1|CNS090VB Single read from an extremity of a full-... 54 4e-04
37emb|BX032800.1|CNS08XH0 Single read from an extremity of a full-... 54 4e-04
38emb|BX022454.1|CNS08PHM Single read from an extremity of a full-... 54 4e-04
39emb|BX025429.1|CNS08RS9 Single read from an extremity of a full-... 54 4e-04
40emb|BX025374.1|CNS08RQQ Single read from an extremity of a full-... 54 4e-04
41emb|BX025373.1|CNS08RQP Single read from an extremity of a full-... 54 4e-04
42emb|BX015203.1|CNS08JW7 Single read from an extremity of a full-... 54 4e-04
43emb|BX013195.1|CNS08ICF Single read from an extremity of a full-... 54 4e-04
44emb|BX010233.1|CNS08G25 Single read from an extremity of a full-... 54 4e-04
45emb|BX009560.1|CNS08FJG Single read from an extremity of a full-... 54 4e-04
46ref|XM_317219.2| Anopheles gambiae str. PEST ENSANGP00000012024 ... 54 4e-04
47ref|XM_307323.1| Anopheles gambiae str. PEST ENSANGP00000001996 ... 54 4e-04
48gb|AY398321.1| Danio rerio clone RK074A2D01 chaperonin containin... 52 0.002
49gb|AY648807.1| Danio rerio TCP-1 epsilon mRNA, complete cds 52 0.002
50gb|BC068037.1| Danio rerio chaperonin containing TCP1, subunit 5... 52 0.002
51emb|BX469922.12| Zebrafish DNA sequence from clone DKEY-30N5 in ... 52 0.002
52ref|NM_212613.1| Danio rerio chaperonin containing TCP1, subunit... 52 0.002
53emb|BX010234.1|CNS08G26 Single read from an extremity of a full-... 50 0.006
54ref|XM_762836.1| Giardia lamblia ATCC 50803 hypothetical protein... 46 0.096
55ref|XM_762838.1| Giardia lamblia ATCC 50803 chaperonin subunit e... 46 0.096
56emb|BX024353.1|CNS08QYD Single read from an extremity of a full-... 46 0.096
57gb|AF226724.1|AF226724 Giardia intestinalis chaperonin subunit e... 46 0.096
58emb|CR699738.2|CNS0G2VA Tetraodon nigroviridis full-length cDNA 44 0.38
59emb|BX033735.1|CNS08Y6Z Single read from an extremity of a full-... 44 0.38
60emb|BX025983.1|CNS08S7N Single read from an extremity of a full-... 44 0.38
61gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.5
62dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
63gb|AC092660.2| Homo sapiens BAC clone RP11-502A5 from 2, complet... 42 1.5
64dbj|AP005848.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
65emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chro... 40 5.9
66gb|AC007155.16| Arabidopsis thaliana chromosome 2 clone T18E17 m... 40 5.9
67gb|AC006437.5| Arabidopsis thaliana chromosome 2 clone T19K21 ma... 40 5.9
68dbj|AP000999.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.9
69dbj|AP002853.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.9
70gb|AC138027.3| Mus musculus BAC clone RP24-100L8 from 12, comple... 40 5.9 
>emb|X75778.1|ASTCPP1A A.sativa (Pewi) ASTCP-K36 mRNA for t complex polypeptide 1
          Length = 2022

 Score =  266 bits (134), Expect = 6e-68
 Identities = 170/182 (93%)
 Strand = Plus / Minus

                                                                        
Query: 258  gaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaag 317
            |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1730 gaaggcgtgataacatcatcgatcttgaggatcatcttgacgacctgggttgccagcaag 1671

                                                                        
Query: 318  atctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggta 377
            ||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 1670 atctgctgctgcttgccaatcagagtttcgaaaacattctgctctttcatgtcattggta 1611

                                                                        
Query: 378  ccaacatcattgcaatcgatgccacagcgggaattgttctccttgacgtgttgagatttt 437
            || |||||||||||||| ||||| || || ||||||||||||||||| ||||||||||||
Sbjct: 1610 cccacatcattgcaatcaatgccgcaacgagaattgttctccttgacatgttgagatttt 1551

              
Query: 438  ac 439
            ||
Sbjct: 1550 ac 1549



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 46   aaactggtatcgacaggatttgt 68
            |||||||||||||||||||||||
Sbjct: 1956 aaactggtatcgacaggatttgt 1934
to top
>emb|X75777.1|ASTCPP1 A.sativa (Pewi) ASTCP-K19 mRNA for t complex polypeptide 1
          Length = 2039

 Score =  262 bits (132), Expect = 9e-67
 Identities = 177/192 (92%)
 Strand = Plus / Minus

                                                                        
Query: 248  tcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgtgt 307
            |||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 1715 tcaatattcggaaggcgtgataacatcatcgatcttgaggatcatcttgacgacctgggt 1656

                                                                        
Query: 308  tgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcat 367
            ||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 1655 tgccagcaagatctgctgctgcttgccaatcagagtttcaaaaacattctgctctttcat 1596

                                                                        
Query: 368  gtcgttggtaccaacatcattgcaatcgatgccacagcgggaattgttctccttgacgtg 427
            ||| |||||||| ||||| ||||| || ||||| ||||||||||||||||||||||| ||
Sbjct: 1595 gtcattggtacccacatcgttgcagtcaatgccgcagcgggaattgttctccttgacatg 1536

                        
Query: 428  ttgagattttac 439
            ||| ||||||||
Sbjct: 1535 ttgggattttac 1524



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 46   aaactggtatcgacaggatttgt 68
            |||||||||||||||||||||||
Sbjct: 1927 aaactggtatcgacaggatttgt 1905
to top
>dbj|AK105701.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-201-D07, full
            insert sequence
          Length = 2088

 Score =  163 bits (82), Expect = 6e-37
 Identities = 166/194 (85%)
 Strand = Plus / Minus

                                                                        
Query: 246  catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 305
            |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 1703 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 1644

                                                                        
Query: 306  gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttc 365
            |||||||| |||||||||||||||||||| ||||| || || |||||||| || || |||
Sbjct: 1643 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacattttgttccttc 1584

                                                                        
Query: 366  atgtcgttggtaccaacatcattgcaatcgatgccacagcgggaattgttctccttgacg 425
            |||| ||| || |||||||| ||||| || ||||||||| | | |||| ||||||| || 
Sbjct: 1583 atgtggtttgtcccaacatcgttgcagtcaatgccacagtgaggattgctctcctttact 1524

                          
Query: 426  tgttgagattttac 439
            ||||||||||||||
Sbjct: 1523 tgttgagattttac 1510
to top
>dbj|AK067114.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013095K16, full
            insert sequence
          Length = 2100

 Score =  163 bits (82), Expect = 6e-37
 Identities = 166/194 (85%)
 Strand = Plus / Minus

                                                                        
Query: 246  catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 305
            |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 1717 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 1658

                                                                        
Query: 306  gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttc 365
            |||||||| |||||||||||||||||||| ||||| || || |||||||| || || |||
Sbjct: 1657 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacattttgttccttc 1598

                                                                        
Query: 366  atgtcgttggtaccaacatcattgcaatcgatgccacagcgggaattgttctccttgacg 425
            |||| ||| || |||||||| ||||| || ||||||||| | | |||| ||||||| || 
Sbjct: 1597 atgtggtttgtcccaacatcgttgcagtcaatgccacagtgaggattgctctcctttact 1538

                          
Query: 426  tgttgagattttac 439
            ||||||||||||||
Sbjct: 1537 tgttgagattttac 1524
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Plus

                                                                            
Query: 246      catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 305
                |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 21250809 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 21250868

                                                                            
Query: 306      gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttc 365
                |||||||| |||||||||||||||||||| ||||| || || |||||||| || || |||
Sbjct: 21250869 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacattttgttccttc 21250928

                                                       
Query: 366      atgtcgttggtaccaacatcattgcaatcgatgccacag 404
                |||| ||| || |||||||| ||||| || |||||||||
Sbjct: 21250929 atgtggtttgtcccaacatcgttgcagtcaatgccacag 21250967
to top
>dbj|AP003714.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0656E03
          Length = 181786

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Plus

                                                                         
Query: 246   catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 305
             |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 46185 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 46244

                                                                         
Query: 306   gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttc 365
             |||||||| |||||||||||||||||||| ||||| || || |||||||| || || |||
Sbjct: 46245 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacattttgttccttc 46304

                                                    
Query: 366   atgtcgttggtaccaacatcattgcaatcgatgccacag 404
             |||| ||| || |||||||| ||||| || |||||||||
Sbjct: 46305 atgtggtttgtcccaacatcgttgcagtcaatgccacag 46343
to top
>gb|AY103729.1| Zea mays PCO099347 mRNA sequence
          Length = 2083

 Score =  131 bits (66), Expect = 2e-27
 Identities = 144/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 270  acatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgc 329
            ||||| |||||||| ||||||||||| || ||||| || || ||||||||||| ||||||
Sbjct: 1706 acatcgtcgatcttcaggatcatcttcaccacctgggtggcaagcaagatctgttgctgc 1647

                                                                        
Query: 330  ttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatcattg 389
            ||||| ||||| |||||||| || ||||| |||||||||||| |||| ||||| || |||
Sbjct: 1646 ttgccaatcagggtctcgaagacgttctgttctttcatgtcggtggtgccaacgtcgttg 1587

                                                              
Query: 390  caatcgatgccacagcgggaattgttctccttgacgtgttgagattttac 439
            || || ||||| ||| |||  ||| |||||||||| ||||||| ||||||
Sbjct: 1586 cagtctatgccgcagtgggggttgctctccttgacttgttgagcttttac 1537
to top
>gb|BT017463.1| Zea mays clone EL01N0407F08.c mRNA sequence
          Length = 710

 Score =  127 bits (64), Expect = 3e-26
 Identities = 139/164 (84%)
 Strand = Plus / Minus

                                                                       
Query: 276 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
           |||||||| ||||||||||| || ||||| ||||| |||| |||||||||||||||||| 
Sbjct: 379 tcgatcttcaggatcatcttcaccacctgagttgctagcaggatctgctgctgcttgcca 320

                                                                       
Query: 336 atcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatcattgcaatcg 395
           ||||| ||||| || || ||||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 319 atcagggtctcaaagacgttctgctctttcatgtcgttggtgcctacatcgttgcagtct 260

                                                       
Query: 396 atgccacagcgggaattgttctccttgacgtgttgagattttac 439
           ||||| ||| |||  ||| ||||||| || || |||| ||||||
Sbjct: 259 atgccgcagtgggggttgctctccttaacttgctgagcttttac 216
to top
>gb|AF097668.1|AF097668 Mesembryanthemum crystallinum T-complex protein 1 epsilon subunit
            (TCP-1-EPSILON) mRNA, partial cds
          Length = 1458

 Score =  107 bits (54), Expect = 3e-20
 Identities = 141/170 (82%)
 Strand = Plus / Minus

                                                                        
Query: 267  ataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgc 326
            ||||||||||||||||| |  |||||||| |||||||| || |||||||| | ||| |||
Sbjct: 1238 ataacatcatcgatcttcaaaatcatcttcacaacctgagtagccagcaaaagctgttgc 1179

                                                                        
Query: 327  tgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatca 386
            | ||| || ||||  ||||||||||||||||||||   ||||||||| || |||||||| 
Sbjct: 1178 ttctttccaatcaatgtctcgaaaacattctgctcacgcatgtcgtttgtgccaacatcg 1119

                                                              
Query: 387  ttgcaatcgatgccacagcgggaattgttctccttgacgtgttgagattt 436
            ||||| || || |||||||  | |||||||||||| || || ||||||||
Sbjct: 1118 ttgcagtctataccacagcatggattgttctccttaacttgctgagattt 1069
to top
>gb|AC141435.28| Medicago truncatula clone mth2-21i11, complete sequence
          Length = 132497

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 113/135 (83%)
 Strand = Plus / Minus

                                                                          
Query: 267    ataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgc 326
              ||||||||||| || || |  |||||||||||||| || || || ||||||||||| |||
Sbjct: 107610 ataacatcatcaatttttaatatcatcttgacaacttgagtagcaagcaagatctgttgc 107551

                                                                          
Query: 327    tgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatca 386
              ||||| ||||||| ||| || || || || |||||  ||||||| ||||| |||||||||
Sbjct: 107550 tgctttccgatcaaagtttcaaagacgttttgctccctcatgtcattggtgccaacatca 107491

                             
Query: 387    ttgcaatcgatgcca 401
              |||||||| ||||||
Sbjct: 107490 ttgcaatcaatgcca 107476
to top
>emb|CT030174.3| M.truncatula DNA sequence from clone MTH2-71J12 on chromosome 3,
             complete sequence
          Length = 133240

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 113/135 (83%)
 Strand = Plus / Plus

                                                                         
Query: 267   ataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgc 326
             ||||||||||| || || |  |||||||||||||| || || || ||||||||||| |||
Sbjct: 96253 ataacatcatcaatttttaatatcatcttgacaacttgagtagcaagcaagatctgttgc 96312

                                                                         
Query: 327   tgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatca 386
             ||||| ||||||| ||| || || || || |||||  ||||||| ||||| |||||||||
Sbjct: 96313 tgctttccgatcaaagtttcaaagacgttttgctccctcatgtcattggtgccaacatca 96372

                            
Query: 387   ttgcaatcgatgcca 401
             |||||||| ||||||
Sbjct: 96373 ttgcaatcaatgcca 96387
to top
>emb|X85013.1|CSRNATCP1 C.sativus mRNA for T-complex polypeptide 1
          Length = 2030

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 136/170 (80%)
 Strand = Plus / Minus

                                                                        
Query: 270  acatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgc 329
            |||||||| ||||| || |||||||| || ||||| |||||||| || ||||| || |||
Sbjct: 1630 acatcatcaatcttcagaatcatcttcacgacctgagttgccagtaaaatctgttgttgc 1571

                                                                        
Query: 330  ttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggtaccaacatcattg 389
            || ||||||| |||||| || || || |||||  ||||||| || || |||| |||||||
Sbjct: 1570 ttaccgatcaaagtctcaaatacgttttgctccctcatgtcatttgtgccaatatcattg 1511

                                                              
Query: 390  caatcgatgccacagcgggaattgttctccttgacgtgttgagattttac 439
            || || || |||||    | |||||||||||| |  || |||||||||||
Sbjct: 1510 cagtcaattccacaataaggattgttctccttaatttgctgagattttac 1461
to top
>emb|CR734406.2|CNS0GTG5 Tetraodon nigroviridis full-length cDNA
          Length = 275

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 276 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 95  tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 36

                        
Query: 336 atcagagtctcga 348
           ||||| |||||||
Sbjct: 35  atcagggtctcga 23
to top
>emb|CR734368.2|CNS0GTF3 Tetraodon nigroviridis full-length cDNA
          Length = 1888

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 276  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1708 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1649

                         
Query: 336  atcagagtctcga 348
            ||||| |||||||
Sbjct: 1648 atcagggtctcga 1636
to top
>emb|CR704636.2|CNS0G6NC Tetraodon nigroviridis full-length cDNA
          Length = 1816

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 276  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1697 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1638

                         
Query: 336  atcagagtctcga 348
            ||||| |||||||
Sbjct: 1637 atcagggtctcga 1625
to top
>emb|CR702647.2|CNS0G543 Tetraodon nigroviridis full-length cDNA
          Length = 1848

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 276  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1676 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1617

                         
Query: 336  atcagagtctcga 348
            ||||| |||||||
Sbjct: 1616 atcagggtctcga 1604
to top
>emb|CR693702.2|CNS0FY7M Tetraodon nigroviridis full-length cDNA
          Length = 1102

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 276 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 918 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 859

                        
Query: 336 atcagagtctcga 348
           ||||| |||||||
Sbjct: 858 atcagggtctcga 846
to top
>emb|CR693121.2|CNS0FXRH Tetraodon nigroviridis full-length cDNA
          Length = 1851

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 276  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1691 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1632

                         
Query: 336  atcagagtctcga 348
            ||||| |||||||
Sbjct: 1631 atcagggtctcga 1619
to top
>emb|CR692993.2|CNS0FXNX Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 276 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 830 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 771

                        
Query: 336 atcagagtctcga 348
           ||||| |||||||
Sbjct: 770 atcagggtctcga 758
to top
>emb|CR682065.2|CNS0FP8D Tetraodon nigroviridis full-length cDNA
          Length = 1001

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 276 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 824 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 765

                        
Query: 336 atcagagtctcga 348
           ||||| |||||||
Sbjct: 764 atcagggtctcga 752
to top
>emb|CR664385.2|CNS0FBLZ Tetraodon nigroviridis full-length cDNA
          Length = 1196

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 276  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1013 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 954

                         
Query: 336  atcagagtctcga 348
            ||||| |||||||
Sbjct: 953  atcagggtctcga 941
to top
>emb|CR659491.2|CNS0F7U1 Tetraodon nigroviridis full-length cDNA
          Length = 1879

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 276  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 335
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1703 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1644

                         
Query: 336  atcagagtctcga 348
            ||||| |||||||
Sbjct: 1643 atcagggtctcga 1631
to top
>ref|XM_774923.1| PREDICTED: Strongylocentrotus purpuratus similar to chaperonin
            containing TCP1, subunit 5 (epsilon), transcript variant
            1 (LOC575808), mRNA
          Length = 2235

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 317  gatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggt 376
            |||||| |||| |||||| ||||||||||| || |||| |||||| |||||||| |||||
Sbjct: 1650 gatctgttgcttcttgccaatcagagtctcaaacacatgctgctccttcatgtcattggt 1591
to top
>ref|XM_796613.1| PREDICTED: Strongylocentrotus purpuratus similar to chaperonin
            containing TCP1, subunit 5 (epsilon), transcript variant
            2 (LOC575808), mRNA
          Length = 2250

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 317  gatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcatgtcgttggt 376
            |||||| |||| |||||| ||||||||||| || |||| |||||| |||||||| |||||
Sbjct: 1665 gatctgttgcttcttgccaatcagagtctcaaacacatgctgctccttcatgtcattggt 1606
to top
>gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 genomic sequence, complete
             sequence
          Length = 187707

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 273   tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
             ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 15677 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 15618
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 273      tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
                ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 22011133 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 22011074
to top
>dbj|AK106739.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-B02, full
           insert sequence
          Length = 1961

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
           ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 388 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 329
to top
>dbj|AK070073.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043F15, full
            insert sequence
          Length = 3156

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 273  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
            ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 2027 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 1968
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 273      tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
                ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 22022796 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 22022737
to top
>emb|BX064596.1|CNS09M08 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 345 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 399
to top
>emb|BX059609.1|CNS09I5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 544 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 490
to top
>emb|BX058534.1|CNS09HBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 384 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 438
to top
>emb|BX058090.1|CNS09GZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 416 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 470
to top
>emb|BX047036.1|CNS098GG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 592

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 351 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 405
to top
>emb|BX042897.1|CNS0959H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 686

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 358 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 412
to top
>emb|BX037203.1|CNS090VB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 404 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 458
to top
>emb|BX032800.1|CNS08XH0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 470

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 341 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 395
to top
>emb|BX022454.1|CNS08PHM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 360 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 414
to top
>emb|BX025429.1|CNS08RS9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 161 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 215
to top
>emb|BX025374.1|CNS08RQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 402 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 456
to top
>emb|BX025373.1|CNS08RQP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 671 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 617
to top
>emb|BX015203.1|CNS08JW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 329 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 383
to top
>emb|BX013195.1|CNS08ICF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 347 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 401
to top
>emb|BX010233.1|CNS08G25 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 670 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 616
to top
>emb|BX009560.1|CNS08FJG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 325 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 379
to top
>ref|XM_317219.2| Anopheles gambiae str. PEST ENSANGP00000012024 (ENSANGG00000009535),
            partial mRNA
          Length = 1779

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 273  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
            |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 1769 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 1715
to top
>ref|XM_307323.1| Anopheles gambiae str. PEST ENSANGP00000001996 (ENSANGG00000001693),
            partial mRNA
          Length = 1515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 273  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
            |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 1505 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 1451
to top
>gb|AY398321.1| Danio rerio clone RK074A2D01 chaperonin containing TCP1, subunit 5
            (epsilon) (CCT5) mRNA, complete cds
          Length = 1896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 273  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1709 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1650

                                                  
Query: 333  ccgatcagagtctcgaaaacattctgctctttcatgtc 370
            ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 1649 ccgataagggtctcgattacatgctgctgcttcatgtc 1612
to top
>gb|AY648807.1| Danio rerio TCP-1 epsilon mRNA, complete cds
          Length = 1853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 273  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1684 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1625

                                                  
Query: 333  ccgatcagagtctcgaaaacattctgctctttcatgtc 370
            ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 1624 ccgataagggtctcgattacatgctgctgcttcatgtc 1587
to top
>gb|BC068037.1| Danio rerio chaperonin containing TCP1, subunit 5 (epsilon), mRNA
            (cDNA clone MGC:77639 IMAGE:6996933), complete cds
          Length = 1879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 273  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1694 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1635

                                                  
Query: 333  ccgatcagagtctcgaaaacattctgctctttcatgtc 370
            ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 1634 ccgataagggtctcgattacatgctgctgcttcatgtc 1597
to top
>emb|BX469922.12| Zebrafish DNA sequence from clone DKEY-30N5 in linkage group 24, complete
              sequence
          Length = 200409

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                          
Query: 273    tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
              ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 165976 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 166035

                                                    
Query: 333    ccgatcagagtctcgaaaacattctgctctttcatgtc 370
              ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 166036 ccgataagggtctcgattacatgctgctgcttcatgtc 166073
to top
>ref|NM_212613.1| Danio rerio chaperonin containing TCP1, subunit 5 (epsilon) (cct5),
            mRNA
          Length = 1896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 273  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 332
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1709 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1650

                                                  
Query: 333  ccgatcagagtctcgaaaacattctgctctttcatgtc 370
            ||||| || |||||||  |||| |||||  ||||||||
Sbjct: 1649 ccgataagggtctcgattacatgctgctgcttcatgtc 1612
to top
>emb|BX010234.1|CNS08G26 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 275 atcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 407 atcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 459
to top
>ref|XM_762836.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_549_7513_8304)
           partial mRNA
          Length = 792

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagca 315
           ||||||||||||||||||||   ||| |||||||| |||||||
Sbjct: 593 tcatcgatcttgaggatcatgcggacgacctgtgtggccagca 635
to top
>ref|XM_762838.1| Giardia lamblia ATCC 50803 chaperonin subunit epsilon
            (GLP_549_9744_8083) partial mRNA
          Length = 1662

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 273  tcatcgatcttgaggatcatcttgacaacctgtgttgccagca 315
            ||||||||||||||||||||   ||| |||||||| |||||||
Sbjct: 1640 tcatcgatcttgaggatcatgcggacgacctgtgtggccagca 1598
to top
>emb|BX024353.1|CNS08QYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 273 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 327
           |||||||||||||| ||||||||||| | ||| || || |||| | |||||||||
Sbjct: 339 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgttctgctgct 393
to top
>gb|AF226724.1|AF226724 Giardia intestinalis chaperonin subunit epsilon CCTepsilon (Ccte)
            gene, complete cds
          Length = 1829

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 273  tcatcgatcttgaggatcatcttgacaacctgtgttgccagca 315
            ||||||||||||||||||||   ||| |||||||| |||||||
Sbjct: 1730 tcatcgatcttgaggatcatgcggacgacctgtgtggccagca 1688
to top
>emb|CR699738.2|CNS0G2VA Tetraodon nigroviridis full-length cDNA
          Length = 1834

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 62/74 (83%), Gaps = 1/74 (1%)
 Strand = Plus / Minus

                                                                        
Query: 276  tcgatcttgaggatcatct-tgacaacctgtgttgccagcaagatctgctgctgcttgcc 334
            |||||||| |||||||||| |||| || || || || |||| ||| |||||||  |||||
Sbjct: 1669 tcgatcttaaggatcatctatgacgacttgggtggcgagcaggatttgctgctttttgcc 1610

                          
Query: 335  gatcagagtctcga 348
            |||||| |||||||
Sbjct: 1609 gatcagggtctcga 1596
to top
>emb|BX033735.1|CNS08Y6Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 273 tcatcgatcttgaggatcatcttgac 298
           |||||||||||||| |||||||||||
Sbjct: 330 tcatcgatcttgagaatcatcttgac 355
to top
>emb|BX025983.1|CNS08S7N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 148

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 273 tcatcgatcttgaggatcatcttgac 298
           |||||||||||||| |||||||||||
Sbjct: 79  tcatcgatcttgagaatcatcttgac 104
to top
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 363     ttcatgtcgttggtaccaaca 383
               |||||||||||||||||||||
Sbjct: 4018074 ttcatgtcgttggtaccaaca 4018094
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 320      ctgctgctgcttgccgatcag 340
                |||||||||||||||||||||
Sbjct: 31442963 ctgctgctgcttgccgatcag 31442983
to top
>gb|AC092660.2| Homo sapiens BAC clone RP11-502A5 from 2, complete sequence
          Length = 154704

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 305    tgttgccagcaagatctgctg 325
              |||||||||||||||||||||
Sbjct: 104641 tgttgccagcaagatctgctg 104621
to top
>dbj|AP005848.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0078N11
          Length = 155168

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 320   ctgctgctgcttgccgatcag 340
             |||||||||||||||||||||
Sbjct: 78360 ctgctgctgcttgccgatcag 78380
to top
>emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chromosome 1 Contains part of
              the PLXNA2 gene for plexin A2, complete sequence
          Length = 164057

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 310    ccagcaagatctgctgctgcttgc 333
              ||||||| ||||||||||||||||
Sbjct: 116407 ccagcaacatctgctgctgcttgc 116430
to top
>gb|AC007155.16| Arabidopsis thaliana chromosome 2 clone T18E17 map PR1, complete
             sequence
          Length = 96095

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 316   agatctgctgctgcttgccgatca 339
             ||||||||||||||| ||||||||
Sbjct: 27576 agatctgctgctgctcgccgatca 27553
to top
>gb|AC006437.5| Arabidopsis thaliana chromosome 2 clone T19K21 map mi421, complete
             sequence
          Length = 76713

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 316   agatctgctgctgcttgccgatca 339
             ||||||||||||||| ||||||||
Sbjct: 71220 agatctgctgctgctcgccgatca 71197
to top
>dbj|AP000999.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-667I23, complete
              sequence
          Length = 189892

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 175    taacacaataaatgtgcacc 194
              ||||||||||||||||||||
Sbjct: 100507 taacacaataaatgtgcacc 100488
to top
>dbj|AP002853.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-46K15, complete
             sequence
          Length = 177463

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   taacacaataaatgtgcacc 194
             ||||||||||||||||||||
Sbjct: 18067 taacacaataaatgtgcacc 18048
to top
>gb|AC138027.3| Mus musculus BAC clone RP24-100L8 from 12, complete sequence
          Length = 201839

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 175    taacacaataaatgtgcacc 194
              ||||||||||||||||||||
Sbjct: 111526 taacacaataaatgtgcacc 111545


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,856,297
Number of Sequences: 3902068
Number of extensions: 3856297
Number of successful extensions: 61801
Number of sequences better than 10.0: 70
Number of HSP's better than 10.0 without gapping: 68
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 61641
Number of HSP's gapped (non-prelim): 162
length of query: 440
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 418
effective length of database: 17,147,199,772
effective search space: 7167529504696
effective search space used: 7167529504696
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top