Clone Name | rbart19g08 |
---|---|
Clone Library Name | barley_pub |
>gb|L07941.1|WHTISMT Triticum aestivum L-isoaspartyl methyltransferase mRNA, complete cds Length = 940 Score = 357 bits (180), Expect = 2e-95 Identities = 237/256 (92%), Gaps = 5/256 (1%) Strand = Plus / Minus Query: 196 tatatacacacacatttagagatccagagcgaaggatctcatctcagttgtcttgcagct 255 ||||||||||||||||| |||||||||||||||||||||| || ||| ||||||| Sbjct: 847 tatatacacacacatttccagatccagagcgaaggatctcagct-----gtcctgcagct 793 Query: 256 gagcagagcggctggtcagagggacgtatcggacagaggcatcattgcggacgctggtgg 315 |||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||| Sbjct: 792 gagcagagcggctggtcagagggacgtagcgaacagaggcatcgttgcggacgctggtgg 733 Query: 316 atccgttggcgctcttgtcgatcacctgcaggtcctgagagtatgtgccgacgggtatga 375 |||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||| Sbjct: 732 atccgtcggcgctcttgtcaatcacctgcaggtcctgagagtatgtgccaacgggtatga 673 Query: 376 ccatgcgcccgccaggcttcagctgctccagcagcggccgagggatctcaggtgccgccg 435 |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 672 ccatccgcccgccaggcttcagctgctccagcagtggccgagggatctcaggtgccgctg 613 Query: 436 ctcccacatgaatagc 451 | |||||||||||||| Sbjct: 612 cgcccacatgaatagc 597 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 taaaacatcagacgccacattggta 167 ||||||||||||||||||||||||| Sbjct: 895 taaaacatcagacgccacattggta 871
>emb|AL442104.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0510A06, complete sequence Length = 90767 Score = 133 bits (67), Expect = 5e-28 Identities = 172/207 (83%) Strand = Plus / Plus Query: 249 tgcagctgagcagagcggctggtcagagggacgtatcggacagaggcatcattgcggacg 308 ||||||||||| ||||||||||||||||||||||| ||||| || || || || ||||| Sbjct: 16822 tgcagctgagcggagcggctggtcagagggacgtagcggacggacgcgtcgttctggacg 16881 Query: 309 ctggtggatccgttggcgctcttgtcgatcacctgcaggtcctgagagtatgtgccgacg 368 | || |||| |||| ||||||||| ||||||||| ||||| |||| |||||||| Sbjct: 16882 gtcaccgagccgtcggcgttcttgtcgaccacctgcagctcctggaagtagctgccgacg 16941 Query: 369 ggtatgaccatgcgcccgccaggcttcagctgctccagcagcggccgagggatctcaggt 428 ||||||||||| || ||||| | ||||||||| || | ||| ||| |||||||||| ||| Sbjct: 16942 ggtatgaccatccggccgccggtcttcagctgatcgaccagaggctgagggatctccggt 17001 Query: 429 gccgccgctcccacatgaatagcgtcg 455 ||||| || ||||||||||| |||||| Sbjct: 17002 gccgcggcgcccacatgaatggcgtcg 17028
>ref|XM_472914.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 693 Score = 125 bits (63), Expect = 1e-25 Identities = 171/207 (82%) Strand = Plus / Minus Query: 249 tgcagctgagcagagcggctggtcagagggacgtatcggacagaggcatcattgcggacg 308 ||||||||||| ||||||||||||||||||||||| ||||| || || || || ||||| Sbjct: 683 tgcagctgagcggagcggctggtcagagggacgtagcggacggacgcgtcgttctggacg 624 Query: 309 ctggtggatccgttggcgctcttgtcgatcacctgcaggtcctgagagtatgtgccgacg 368 | || |||| |||| ||||||||| ||||||||| ||||| |||| |||||||| Sbjct: 623 gtcaccgagccgtcggcgttcttgtcgaccacctgcagctcctggaagtagctgccgacg 564 Query: 369 ggtatgaccatgcgcccgccaggcttcagctgctccagcagcggccgagggatctcaggt 428 ||||||||||| || ||||| | ||||||||| || | ||| ||| |||| ||||| ||| Sbjct: 563 ggtatgaccatccggccgccggtcttcagctgatcgaccagaggctgaggaatctccggt 504 Query: 429 gccgccgctcccacatgaatagcgtcg 455 ||||| || ||||||||||| |||||| Sbjct: 503 gccgcggcgcccacatgaatggcgtcg 477
>emb|AL606614.3|OSJN00047 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0011N17, complete sequence Length = 129498 Score = 125 bits (63), Expect = 1e-25 Identities = 171/207 (82%) Strand = Plus / Plus Query: 249 tgcagctgagcagagcggctggtcagagggacgtatcggacagaggcatcattgcggacg 308 ||||||||||| ||||||||||||||||||||||| ||||| || || || || ||||| Sbjct: 47710 tgcagctgagcggagcggctggtcagagggacgtagcggacggacgcgtcgttctggacg 47769 Query: 309 ctggtggatccgttggcgctcttgtcgatcacctgcaggtcctgagagtatgtgccgacg 368 | || |||| |||| ||||||||| ||||||||| ||||| |||| |||||||| Sbjct: 47770 gtcaccgagccgtcggcgttcttgtcgaccacctgcagctcctggaagtagctgccgacg 47829 Query: 369 ggtatgaccatgcgcccgccaggcttcagctgctccagcagcggccgagggatctcaggt 428 ||||||||||| || ||||| | ||||||||| || | ||| ||| |||| ||||| ||| Sbjct: 47830 ggtatgaccatccggccgccggtcttcagctgatcgaccagaggctgaggaatctccggt 47889 Query: 429 gccgccgctcccacatgaatagcgtcg 455 ||||| || ||||||||||| |||||| Sbjct: 47890 gccgcggcgcccacatgaatggcgtcg 47916
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 125 bits (63), Expect = 1e-25 Identities = 171/207 (82%) Strand = Plus / Plus Query: 249 tgcagctgagcagagcggctggtcagagggacgtatcggacagaggcatcattgcggacg 308 ||||||||||| ||||||||||||||||||||||| ||||| || || || || ||||| Sbjct: 24050731 tgcagctgagcggagcggctggtcagagggacgtagcggacggacgcgtcgttctggacg 24050790 Query: 309 ctggtggatccgttggcgctcttgtcgatcacctgcaggtcctgagagtatgtgccgacg 368 | || |||| |||| ||||||||| ||||||||| ||||| |||| |||||||| Sbjct: 24050791 gtcaccgagccgtcggcgttcttgtcgaccacctgcagctcctggaagtagctgccgacg 24050850 Query: 369 ggtatgaccatgcgcccgccaggcttcagctgctccagcagcggccgagggatctcaggt 428 ||||||||||| || ||||| | ||||||||| || | ||| ||| |||| ||||| ||| Sbjct: 24050851 ggtatgaccatccggccgccggtcttcagctgatcgaccagaggctgaggaatctccggt 24050910 Query: 429 gccgccgctcccacatgaatagcgtcg 455 ||||| || ||||||||||| |||||| Sbjct: 24050911 gccgcggcgcccacatgaatggcgtcg 24050937
>dbj|AK105549.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-128-A09, full insert sequence Length = 2141 Score = 125 bits (63), Expect = 1e-25 Identities = 171/207 (82%) Strand = Plus / Minus Query: 249 tgcagctgagcagagcggctggtcagagggacgtatcggacagaggcatcattgcggacg 308 ||||||||||| ||||||||||||||||||||||| ||||| || || || || ||||| Sbjct: 1905 tgcagctgagcggagcggctggtcagagggacgtagcggacggacgcgtcgttctggacg 1846 Query: 309 ctggtggatccgttggcgctcttgtcgatcacctgcaggtcctgagagtatgtgccgacg 368 | || |||| |||| ||||||||| ||||||||| ||||| |||| |||||||| Sbjct: 1845 gtcaccgagccgtcggcgttcttgtcgaccacctgcagctcctggaagtagctgccgacg 1786 Query: 369 ggtatgaccatgcgcccgccaggcttcagctgctccagcagcggccgagggatctcaggt 428 ||||||||||| || ||||| | ||||||||| || | ||| ||| |||| ||||| ||| Sbjct: 1785 ggtatgaccatccggccgccggtcttcagctgatcgaccagaggctgaggaatctccggt 1726 Query: 429 gccgccgctcccacatgaatagcgtcg 455 ||||| || ||||||||||| |||||| Sbjct: 1725 gccgcggcgcccacatgaatggcgtcg 1699
>emb|BX071631.1|CNS09RFN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 337 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 378
>emb|BX071630.1|CNS09RFM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 840 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 799
>emb|BX067103.1|CNS09NXV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 848 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 807
>emb|BX065811.1|CNS09MXZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 701 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 333 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 374
>emb|BX060428.1|CNS09ISG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1022 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 379 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 420
>emb|BX060427.1|CNS09ISF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1030 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 869 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 828
>emb|BX054121.1|CNS09DX9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 385 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 426
>emb|BX054120.1|CNS09DX8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 821 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 780
>emb|BX054084.1|CNS09DW8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32AD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 360 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 401
>emb|BX054083.1|CNS09DW7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 828 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 787
>emb|BX050962.1|CNS09BHI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27DE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 840 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 366 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 407
>emb|BX050961.1|CNS09BHH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27DE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 798 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 757
>emb|BX049334.1|CNS09A8A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC25AH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 537 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 171 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 212
>emb|BX047388.1|CNS098Q8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 341 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 382
>emb|BX047387.1|CNS098Q7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 813 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 772
>emb|BX043271.1|CNS095JV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 367 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 408
>emb|BX035401.1|CNS08ZH9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6CH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 548 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 109 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 150
>emb|BX035400.1|CNS08ZH8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6CH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 817 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 776
>emb|BX026214.1|CNS08SE2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA4BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 366 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 407
>emb|BX026213.1|CNS08SE1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 849 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 808
>emb|BX026193.1|CNS08SDH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA4BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 364 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 405
>emb|BX026192.1|CNS08SDG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 854 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 813
>emb|BX024424.1|CNS08R0C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA37BA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 871 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 388 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 429
>emb|BX024423.1|CNS08R0B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37BA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 856 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 815
>emb|BX020446.1|CNS08NXU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 416 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 333 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 374
>emb|BX020260.1|CNS08NSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA3DC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 470 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 358 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 399
>emb|BX016216.1|CNS08KOC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24BC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 346 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 387
>emb|BX016215.1|CNS08KOB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24BC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 836 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 795
>emb|BX014515.1|CNS08JD3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA21DD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 835 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 286 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 327
>emb|BX014514.1|CNS08JD2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA21DD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 802 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 643 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 602
>emb|BX013699.1|CNS08IQF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA20CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 625 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 342 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 383
>emb|BX009707.1|CNS08FNJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 352 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 393
>emb|BX009706.1|CNS08FNI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA15CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 809 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 768
>ref|XM_310636.2| Anopheles gambiae str. PEST ENSANGP00000020776 (ENSANGG00000018287), mRNA Length = 1236 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgctc 403 |||||| ||||||| |||||| ||||| |||||||||||||| Sbjct: 861 gccgaccggtatgatcatgcggccgccgggcttcagctgctc 820
>emb|BX067104.1|CNS09NXW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 601 Score = 48.1 bits (24), Expect = 0.025 Identities = 36/40 (90%) Strand = Plus / Plus Query: 362 gccgacgggtatgaccatgcgcccgccaggcttcagctgc 401 |||||| ||||||| |||||| ||||| |||||||||||| Sbjct: 317 gccgaccggtatgatcatgcggccgccgggcttcagctgc 356
>ref|NM_170825.2| Caenorhabditis elegans Y39G10AR.18b (Y39G10AR.18) mRNA, complete cds Length = 1821 Score = 46.1 bits (23), Expect = 0.099 Identities = 23/23 (100%) Strand = Plus / Plus Query: 388 caggcttcagctgctccagcagc 410 ||||||||||||||||||||||| Sbjct: 934 caggcttcagctgctccagcagc 956
>ref|NM_170824.2| Caenorhabditis elegans Y39G10AR.18a (Y39G10AR.18) mRNA, complete cds Length = 3327 Score = 46.1 bits (23), Expect = 0.099 Identities = 23/23 (100%) Strand = Plus / Plus Query: 388 caggcttcagctgctccagcagc 410 ||||||||||||||||||||||| Sbjct: 1954 caggcttcagctgctccagcagc 1976
>gb|AC025716.2| Caenorhabditis elegans cosmid Y39G10AR, complete sequence Length = 132558 Score = 46.1 bits (23), Expect = 0.099 Identities = 23/23 (100%) Strand = Plus / Minus Query: 388 caggcttcagctgctccagcagc 410 ||||||||||||||||||||||| Sbjct: 106915 caggcttcagctgctccagcagc 106893
>ref|XM_580425.2| PREDICTED: Bos taurus similar to Thrombospondin-3 precursor, transcript variant 1 (LOC504323), mRNA Length = 3143 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 gtcgatcacctgcaggtcctga 353 |||||||||||||||||||||| Sbjct: 121 gtcgatcacctgcaggtcctga 100
>ref|XM_882196.1| PREDICTED: Bos taurus similar to Thrombospondin-3 precursor, transcript variant 6 (LOC504323), mRNA Length = 3030 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 gtcgatcacctgcaggtcctga 353 |||||||||||||||||||||| Sbjct: 121 gtcgatcacctgcaggtcctga 100
>ref|XM_882180.1| PREDICTED: Bos taurus similar to Thrombospondin-3 precursor, transcript variant 5 (LOC504323), mRNA Length = 2265 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 gtcgatcacctgcaggtcctga 353 |||||||||||||||||||||| Sbjct: 121 gtcgatcacctgcaggtcctga 100
>ref|XM_882163.1| PREDICTED: Bos taurus similar to Thrombospondin-3 precursor, transcript variant 4 (LOC504323), mRNA Length = 1425 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 gtcgatcacctgcaggtcctga 353 |||||||||||||||||||||| Sbjct: 121 gtcgatcacctgcaggtcctga 100
>ref|XM_882152.1| PREDICTED: Bos taurus similar to Thrombospondin-3 precursor, transcript variant 3 (LOC504323), mRNA Length = 2822 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 gtcgatcacctgcaggtcctga 353 |||||||||||||||||||||| Sbjct: 121 gtcgatcacctgcaggtcctga 100
>ref|XM_546774.2| PREDICTED: Canis familiaris similar to Protein C16orf7 homolog (5-day ovary-specific transcript 1 protein) (LOC489654), mRNA Length = 1077 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 392 cttcagctgctccagcagcggc 413 |||||||||||||||||||||| Sbjct: 411 cttcagctgctccagcagcggc 390
>emb|AL356461.15| Human DNA sequence from clone RP11-180D15 on chromosome Xq13.2-21.2 Contains a purinergic receptor P2Y G-protein coupled 10 (P2RY10) pseudogene, complete sequence Length = 127615 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 196 tatatacacacacatttagaga 217 |||||||||||||||||||||| Sbjct: 104450 tatatacacacacatttagaga 104471
>gb|BC058966.1| Mus musculus protein-L-isoaspartate (D-aspartate) O-methyltransferase 1, mRNA (cDNA clone MGC:67096 IMAGE:5717963), complete cds Length = 1668 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 623 gctcccacatgaatagcgtcg 603
>ref|NM_008786.1| Mus musculus protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 (Pcmt1), mRNA Length = 1580 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 598 gctcccacatgaatagcgtcg 578
>gb|AC087430.3| Homo sapiens chromosome 3 clone RP11-242C8 map 3p, complete sequence Length = 152289 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 189 acactcgtatatacacacaca 209 ||||||||||||||||||||| Sbjct: 44988 acactcgtatatacacacaca 45008
>gb|BC085283.1| Mus musculus cDNA clone IMAGE:30750945, **** WARNING: chimeric clone **** Length = 1630 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 927 gctcccacatgaatagcgtcg 907
>emb|AL445929.5| Human DNA sequence from clone RP11-408M7 on chromosome 13 Contains a CpG island, complete sequence Length = 169403 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 actcgtatatacacacacatt 211 ||||||||||||||||||||| Sbjct: 152490 actcgtatatacacacacatt 152470
>dbj|AK140684.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930089B07 product:unclassifiable, full insert sequence Length = 1754 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 1320 gctcccacatgaatagcgtcg 1300
>dbj|AK138093.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130090I24 product:protein-L-isoaspartate (D-aspartate) O-methyltransferase 1, full insert sequence Length = 4596 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 3703 gctcccacatgaatagcgtcg 3683
>dbj|AK148789.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN full-length enriched library, clone:7120446L02 product:protein-L-isoaspartate (D-aspartate) O-methyltransferase 1, full insert sequence Length = 1370 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 959 gctcccacatgaatagcgtcg 939
>emb|BX255965.12| Zebrafish DNA sequence from clone CH211-270C19, complete sequence Length = 148298 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 189 acactcgtatatacacacacattta 213 |||||| |||||||||||||||||| Sbjct: 98342 acactcttatatacacacacattta 98366
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome Length = 3570858 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 372 atgaccatgcgcccgccaggcttca 396 |||||||||||||||||| |||||| Sbjct: 1339226 atgaccatgcgcccgccaagcttca 1339202
>dbj|AK006162.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700020H09 product:protein-L-isoaspartate (D-aspartate) O-methyltransferase 1, full insert sequence Length = 948 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 612 gctcccacatgaatagcgtcg 592
>dbj|AK075632.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110021O13 product:protein-L-isoaspartate (D-aspartate) O-methyltransferase 1, full insert sequence Length = 2258 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 421 gctcccacatgaatagcgtcg 401
>gb|AC156391.6| Mus musculus 10 BAC RP24-258P4 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 186703 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 136320 gctcccacatgaatagcgtcg 136300
>gb|BC049613.1| Mus musculus, protein-L-isoaspartate (D-aspartate) O-methyltransferase 1, clone IMAGE:6771467, mRNA, partial cds Length = 1144 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 638 gctcccacatgaatagcgtcg 618
>dbj|AK208253.1| Mus musculus cDNA, clone:Y2G0110J09, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000019930, based on BLAT search Length = 228 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 67 gctcccacatgaatagcgtcg 47
>gb|M60320.1|MUSPCMAA Mouse protein carboxyl methyltransferase mRNA, complete cds Length = 1580 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtcg 455 ||||||||||||||||||||| Sbjct: 598 gctcccacatgaatagcgtcg 578
>gb|AC113586.14| Mus musculus chromosome 8, clone RP23-17D24, complete sequence Length = 206445 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 117 cattacaaaaccaaacgatctaaa 140 ||||||||||||||| |||||||| Sbjct: 192231 cattacaaaaccaaaagatctaaa 192254
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 390 ggcttcagctgctccagcagcggc 413 ||||||| |||||||||||||||| Sbjct: 2993795 ggcttcaactgctccagcagcggc 2993818
>gb|AC112997.10| Mus musculus chromosome 8, clone RP24-484I6, complete sequence Length = 191413 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 117 cattacaaaaccaaacgatctaaa 140 ||||||||||||||| |||||||| Sbjct: 139294 cattacaaaaccaaaagatctaaa 139271
>ref|XM_423167.1| PREDICTED: Gallus gallus similar to solute carrier family 9 (sodium/hydrogen exchanger), isoform 5 (LOC425403), partial mRNA Length = 2402 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 331 tgtcgatcacctgcaggtcc 350 |||||||||||||||||||| Sbjct: 1482 tgtcgatcacctgcaggtcc 1463
>ref|XM_425545.1| PREDICTED: Gallus gallus similar to Protein KIAA0539 (LOC427975), mRNA Length = 6876 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 gtactgtagatcagaagata 184 |||||||||||||||||||| Sbjct: 4574 gtactgtagatcagaagata 4593
>gb|AC138381.10| Mus musculus chromosome 6, clone RP24-328J8, complete sequence Length = 130895 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 194 cgtatatacacacacattta 213 |||||||||||||||||||| Sbjct: 20452 cgtatatacacacacattta 20471
>gb|AC113497.6| Mus musculus chromosome 10, clone RP23-365G13, complete sequence Length = 218508 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 190 cactcgtatatacacacaca 209 |||||||||||||||||||| Sbjct: 17652 cactcgtatatacacacaca 17633
>gb|AC165163.2| Mus musculus BAC clone RP23-146B12 from chromosome 14, complete sequence Length = 178254 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 187 agacactcgtatatacacacacat 210 |||||| ||||||||||||||||| Sbjct: 35306 agacacacgtatatacacacacat 35329
>gb|AC126782.23| Medicago truncatula clone mth2-14p11, complete sequence Length = 135659 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 339 acctgcaggtcctgagagta 358 |||||||||||||||||||| Sbjct: 97206 acctgcaggtcctgagagta 97225
>emb|AL451131.5| Human DNA sequence from clone RP11-30C23 on chromosome 9 Contains the 3' end of the AGTPBP1 gene for ATP/GTP binding protein 1 (NNA1, KIAA1035) and two CpG islands, complete sequence Length = 84023 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 tgccgtaagaaggccacaca 39 |||||||||||||||||||| Sbjct: 25238 tgccgtaagaaggccacaca 25257
>emb|AL365255.25| Human DNA sequence from clone RP11-154H17 on chromosome 1 Contains a novel gene, complete sequence Length = 107587 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 ctcgtatatacacacacatt 211 |||||||||||||||||||| Sbjct: 78982 ctcgtatatacacacacatt 79001
>gb|AC159882.2| Mus musculus BAC clone RP24-480A4 from chromosome 9, complete sequence Length = 178827 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tcacatattctaagcaacat 99 |||||||||||||||||||| Sbjct: 155512 tcacatattctaagcaacat 155493
>emb|CR543861.1| Acinetobacter sp. ADP1 complete genome Length = 3598621 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 142 gtaaaacatcagacgccaca 161 |||||||||||||||||||| Sbjct: 2161169 gtaaaacatcagacgccaca 2161150
>emb|CR380956.1| Candida glabrata strain CBS138 chromosome J complete sequence Length = 1192501 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 cacacaaatgctagcggttt 53 |||||||||||||||||||| Sbjct: 243580 cacacaaatgctagcggttt 243599
>emb|CR376736.5| Zebrafish DNA sequence from clone DKEYP-86G11 in linkage group 24, complete sequence Length = 204538 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 196 tatatacacacacatttaga 215 |||||||||||||||||||| Sbjct: 170014 tatatacacacacatttaga 169995
>gb|AC153914.5| Mus musculus 10 BAC RP23-297H17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 174199 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 190 cactcgtatatacacacaca 209 |||||||||||||||||||| Sbjct: 77556 cactcgtatatacacacaca 77575
>emb|AL604002.8| Mouse DNA sequence from clone RP23-386F6 on chromosome 11, complete sequence Length = 142134 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 tagacactcgtatatacacacaca 209 ||||||||| |||||||||||||| Sbjct: 18437 tagacactcatatatacacacaca 18460
>emb|CR380839.1|PTB083D21 Pan troglodytes chromosome X BAC PTB-083D21, complete sequence Length = 186291 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 193 tcgtatatacacacacattt 212 |||||||||||||||||||| Sbjct: 118810 tcgtatatacacacacattt 118829
>gb|AC025822.7| Homo sapiens chromosome 10 clone RP11-433J20, complete sequence Length = 220031 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 186 tagacactcgtatatacacacaca 209 ||||||| |||||||||||||||| Sbjct: 57732 tagacacacgtatatacacacaca 57709
>gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 25586, complete genome Length = 2174500 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 atctaaaagtaaaacatcag 153 |||||||||||||||||||| Sbjct: 1958348 atctaaaagtaaaacatcag 1958329
>gb|AC027306.3|AC027306 Homo sapiens chromosome 5 clone CTB-18O10, complete sequence Length = 124510 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 196 tatatacacacacatttaga 215 |||||||||||||||||||| Sbjct: 80414 tatatacacacacatttaga 80433
>gb|AY095488.1| Panthera leo persica isolate Ple30 microsatellite CA13 sequence Length = 441 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 acacacaacacgtattcaca 84 |||||||||||||||||||| Sbjct: 186 acacacaacacgtattcaca 205
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 agctgctccagcagcggccg 415 |||||||||||||||||||| Sbjct: 937871 agctgctccagcagcggccg 937852
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 406 gcagcggccgagggatctcaggtg 429 ||||||||||||||||||| |||| Sbjct: 918815 gcagcggccgagggatctccggtg 918792
>emb|X15120.1|HEPVIE Pseudorabies virus immediate-early gene Length = 5123 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 390 ggcttcagctgctccagcagcggc 413 ||||||||| |||||||||||||| Sbjct: 1316 ggcttcagcagctccagcagcggc 1339
>gb|AC134339.6| Mus musculus BAC clone RP23-5F21 from 8, complete sequence Length = 229073 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 195 gtatatacacacacatttag 214 |||||||||||||||||||| Sbjct: 55967 gtatatacacacacatttag 55986
>emb|BX510913.9| Zebrafish DNA sequence from clone CH211-202D4 in linkage group 22, complete sequence Length = 203952 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 116 gcattacaaaaccaaacgat 135 |||||||||||||||||||| Sbjct: 61205 gcattacaaaaccaaacgat 61186
>gb|AC162375.2| Mus musculus BAC clone RP24-466F1 from chromosome 9, complete sequence Length = 164119 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 tcacatattctaagcaacat 99 |||||||||||||||||||| Sbjct: 3380 tcacatattctaagcaacat 3361
>gb|AC101349.8| Mus musculus chromosome 6, clone RP23-111E12, complete sequence Length = 196303 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 194 cgtatatacacacacattta 213 |||||||||||||||||||| Sbjct: 25742 cgtatatacacacacattta 25723
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 agctgctccagcagcggccg 415 |||||||||||||||||||| Sbjct: 2362811 agctgctccagcagcggccg 2362830
>gb|AC004383.1|AC004383 Human Chromosome X clone bWXD187, complete sequence Length = 156461 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 193 tcgtatatacacacacattt 212 |||||||||||||||||||| Sbjct: 23626 tcgtatatacacacacattt 23607
>dbj|AP006366.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT35C03, TM0176a, complete sequence Length = 119525 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 aaatgctagcggttttcaaa 58 |||||||||||||||||||| Sbjct: 35910 aaatgctagcggttttcaaa 35929
>gb|M57505.1|SH1LLT Pseudorabies virus ORF1, ORF2, and ORF3 mRNA, complete cds Length = 8438 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 390 ggcttcagctgctccagcagcggc 413 ||||||||| |||||||||||||| Sbjct: 5748 ggcttcagcagctccagcagcggc 5725
>dbj|D38023.1|MUSBALBCA Mouse PIMT mRNA Length = 1630 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 435 gctcccacatgaatagcgtc 454 |||||||||||||||||||| Sbjct: 608 gctcccacatgaatagcgtc 589 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,399,742 Number of Sequences: 3902068 Number of extensions: 4399742 Number of successful extensions: 170709 Number of sequences better than 10.0: 101 Number of HSP's better than 10.0 without gapping: 101 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 170321 Number of HSP's gapped (non-prelim): 387 length of query: 455 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 433 effective length of database: 17,147,199,772 effective search space: 7424737501276 effective search space used: 7424737501276 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)