>gb|AC008732.9| Homo sapiens chromosome 16 clone CTD-2519M14, complete sequence
          Length = 185158

 Score = 40.1 bits (20), Expect = 0.25
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     ttccttggggcctggaggaa 36
              ||||||||||||||||||||
Sbjct: 110658 ttccttggggcctggaggaa 110677

>gb|AC098656.2| Homo sapiens chromosome 1 clone RP11-297I23, complete sequence
          Length = 172210

 Score = 38.2 bits (19), Expect = 1.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    acttccttggggcctggag 33
             |||||||||||||||||||
Sbjct: 20963 acttccttggggcctggag 20981

>gb|AC151796.1| Ornithorhynchus anatinus chromosome UNK clone OABb-11A1, complete
             sequence
          Length = 130877

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 20    cttggggcctggaggaaa 37
             ||||||||||||||||||
Sbjct: 48326 cttggggcctggaggaaa 48343

>ref|XM_510277.1| PREDICTED: Pan troglodytes similar to Cell death regulator Aven
           (LOC453297), mRNA
          Length = 992

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 19  ccttggggcctggaggaa 36
           ||||||||||||||||||
Sbjct: 784 ccttggggcctggaggaa 801

>gb|AC130658.36| Mus musculus chromosome 1, clone RP23-309D5, complete sequence
          Length = 184094

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 4     taactctagatacttcct 21
             ||||||||||||||||||
Sbjct: 43587 taactctagatacttcct 43570

>gb|BC063533.1| Homo sapiens apoptosis, caspase activation inhibitor, mRNA (cDNA
           clone MGC:74954 IMAGE:4425400), complete cds
          Length = 1535

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 19  ccttggggcctggaggaa 36
           ||||||||||||||||||
Sbjct: 735 ccttggggcctggaggaa 752

>ref|NM_020371.2| Homo sapiens apoptosis, caspase activation inhibitor (AVEN), mRNA
          Length = 1551

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 19  ccttggggcctggaggaa 36
           ||||||||||||||||||
Sbjct: 751 ccttggggcctggaggaa 768

>emb|AL663123.1| Human DNA sequence from clone RP11-4K3 on chromosome 1 Contains the 3'
             end of a novel gene (KIAA1037), a novel gene, a SMT3
             suppressor of mif two 3 homolog 2 (yeast) (SMT3H2)
             pseudogene, a novel gene (DKFZP564D0478), an  actin, beta
             (ACTB) pseudogene, the gene for  NADPH oxidase-related, C2
             domain-containing protein (JFC1), the MAP3K6 gene for
             mitogen-activated protein kinase kinase kinase 6, the FCN3
             gene for ficolin (collagen/fibrinogen domain containing) 3
             (Hakata antigen) and a CpG island, complete sequence
          Length = 81740

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 17    ttccttggggcctggagg 34
             ||||||||||||||||||
Sbjct: 14644 ttccttggggcctggagg 14661

>emb|AL445426.20| Human DNA sequence from clone RP11-62J10 on chromosome 1 Contains the
             3' end of a novel gene and a CpG island, complete sequence
          Length = 159117

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    acttccttggggcctgga 32
             ||||||||||||||||||
Sbjct: 35535 acttccttggggcctgga 35552

>emb|AL445531.10| Human DNA sequence from clone RP11-546O6 on chromosome 9 Contains the
             3' end of the NCBP1 gene for nuclear cap binding protein
             subunit 1, 80kDa (NCBP, CBP80), the XPA gene for xeroderma
             pigmentosum, complementation group A (XP1, XPAC), a
             keratin 18 (KRT18) pseudogene and two CpG islands,
             complete sequence
          Length = 111345

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 16    cttccttggggcctggag 33
             ||||||||||||||||||
Sbjct: 99902 cttccttggggcctggag 99885

>gb|AC116544.1| Homo sapiens 3 BAC RP11-21M4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 112189

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 2     tctaactctagatacttccttg 23
             |||||||||| |||||||||||
Sbjct: 19486 tctaactctacatacttccttg 19465

>emb|AL954189.5| Mouse DNA sequence from clone RP23-405M24 on chromosome 4 Contains the
             5' end of the Ptprd gene for receptor type protein
             tyrosine phosphatase D, complete sequence
          Length = 172364

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     ttctaactctagatactt 18
             ||||||||||||||||||
Sbjct: 35212 ttctaactctagatactt 35195

>gb|BC010488.1| Homo sapiens apoptosis, caspase activation inhibitor, mRNA (cDNA
           clone MGC:16897 IMAGE:2900586), complete cds
          Length = 1549

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 19  ccttggggcctggaggaa 36
           ||||||||||||||||||
Sbjct: 745 ccttggggcctggaggaa 762

>gb|AC093420.2| Homo sapiens chromosome 1 clone RP11-282K6, complete sequence
          Length = 193766

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    ccttggggcctggaggaa 36
             ||||||||||||||||||
Sbjct: 92438 ccttggggcctggaggaa 92421

>gb|AC114761.3| Homo sapiens BAC clone RP11-354G23 from 4, complete sequence
          Length = 70709

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    atacttccttggggcctg 30
             ||||||||||||||||||
Sbjct: 43738 atacttccttggggcctg 43755

>emb|CR619789.1| full-length cDNA clone CS0DE006YI19 of Placenta of Homo sapiens
           (human)
          Length = 1019

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 19  ccttggggcctggaggaa 36
           ||||||||||||||||||
Sbjct: 252 ccttggggcctggaggaa 269

>emb|CR618548.1| full-length cDNA clone CS0DC003YC18 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1017

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 19  ccttggggcctggaggaa 36
           ||||||||||||||||||
Sbjct: 252 ccttggggcctggaggaa 269

>gb|AC010809.10| Homo sapiens, clone RP11-3D4, complete sequence
          Length = 173087

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 19    ccttggggcctggaggaa 36
             ||||||||||||||||||
Sbjct: 28222 ccttggggcctggaggaa 28239

>gb|AC109039.10| Rattus norvegicus 1 BAC CH230-145B9 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 215780

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 10     tagatacttccttggggcctgg 31
              |||||||| |||||||||||||
Sbjct: 199250 tagatactcccttggggcctgg 199229

>gb|AC009268.10| Homo sapiens chromosome 15, clone RP11-74D7, complete sequence
          Length = 162840

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 19     ccttggggcctggaggaa 36
              ||||||||||||||||||
Sbjct: 143237 ccttggggcctggaggaa 143254

>gb|AF283508.1|AF283508 Homo sapiens cell death regulator aven mRNA, complete cds
          Length = 1549

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 19  ccttggggcctggaggaa 36
           ||||||||||||||||||
Sbjct: 747 ccttggggcctggaggaa 764


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 268,709
Number of Sequences: 3902068
Number of extensions: 268709
Number of successful extensions: 67809
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67776
Number of HSP's gapped (non-prelim): 33
length of query: 38
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 18
effective length of database: 17,155,003,908
effective search space: 308790070344
effective search space used: 308790070344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)