ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart18f06 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_550191.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1332 Score = 85.7 bits (43), Expect = 1e-13 Identities = 111/133 (83%), Gaps = 3/133 (2%) Strand = Plus / Minus Query: 344 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 403 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 973 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 917 Query: 404 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 463 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 916 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 857 Query: 464 tgtcacgggggct 476 | ||||| ||||| Sbjct: 856 tatcacgagggct 844 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 452 tagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggct 506 |||||||||| |||||||||||||||| | |||||||||||||| |||||||||| Sbjct: 808 tagggctgcgactgtcacgggggctccccctagggctgcgactgtcacgggggct 754 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 445 ctcctcctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacggggg 504 |||| |||||||||||| |||||||||||||| | | ||||||| |||||| |||| ||| Sbjct: 785 ctccccctagggctgcgactgtcacgggggcttcccctagggctccgactgtcacgaggg 726 Query: 505 ctc 507 ||| Sbjct: 725 ctc 723 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 450 cctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggctc 507 ||||||||| || |||| || ||||||| | |||||||||||||| ||||||||||| Sbjct: 840 cctagggctctgggtgtcgcgagggctccccttagggctgcgactgtcacgggggctc 783 Score = 46.1 bits (23), Expect = 0.11 Identities = 56/67 (83%) Strand = Plus / Minus Query: 271 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 330 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 1067 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 1008 Query: 331 ctcatgt 337 ||||||| Sbjct: 1007 ctcatgt 1001
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 85.7 bits (43), Expect = 1e-13 Identities = 111/133 (83%), Gaps = 3/133 (2%) Strand = Plus / Plus Query: 344 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 403 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 2985688 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 2985744 Query: 404 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 463 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 2985745 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 2985804 Query: 464 tgtcacgggggct 476 | ||||| ||||| Sbjct: 2985805 tatcacgagggct 2985817 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Plus Query: 452 tagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggct 506 |||||||||| |||||||||||||||| | |||||||||||||| |||||||||| Sbjct: 2985853 tagggctgcgactgtcacgggggctccccctagggctgcgactgtcacgggggct 2985907 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 445 ctcctcctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacggggg 504 |||| |||||||||||| |||||||||||||| | | ||||||| |||||| |||| ||| Sbjct: 2985876 ctccccctagggctgcgactgtcacgggggcttcccctagggctccgactgtcacgaggg 2985935 Query: 505 ctc 507 ||| Sbjct: 2985936 ctc 2985938 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Plus Query: 450 cctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggctc 507 ||||||||| || |||| || ||||||| | |||||||||||||| ||||||||||| Sbjct: 2985821 cctagggctctgggtgtcgcgagggctccccttagggctgcgactgtcacgggggctc 2985878 Score = 46.1 bits (23), Expect = 0.11 Identities = 56/67 (83%) Strand = Plus / Plus Query: 271 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 330 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 2985594 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 2985653 Query: 331 ctcatgt 337 ||||||| Sbjct: 2985654 ctcatgt 2985660
>dbj|AP003225.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0011G08 Length = 139490 Score = 85.7 bits (43), Expect = 1e-13 Identities = 111/133 (83%), Gaps = 3/133 (2%) Strand = Plus / Plus Query: 344 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 403 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 67205 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 67261 Query: 404 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 463 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 67262 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 67321 Query: 464 tgtcacgggggct 476 | ||||| ||||| Sbjct: 67322 tatcacgagggct 67334 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Plus Query: 452 tagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggct 506 |||||||||| |||||||||||||||| | |||||||||||||| |||||||||| Sbjct: 67370 tagggctgcgactgtcacgggggctccccctagggctgcgactgtcacgggggct 67424 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 445 ctcctcctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacggggg 504 |||| |||||||||||| |||||||||||||| | | ||||||| |||||| |||| ||| Sbjct: 67393 ctccccctagggctgcgactgtcacgggggcttcccctagggctccgactgtcacgaggg 67452 Query: 505 ctc 507 ||| Sbjct: 67453 ctc 67455 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Plus Query: 450 cctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggctc 507 ||||||||| || |||| || ||||||| | |||||||||||||| ||||||||||| Sbjct: 67338 cctagggctctgggtgtcgcgagggctccccttagggctgcgactgtcacgggggctc 67395 Score = 46.1 bits (23), Expect = 0.11 Identities = 56/67 (83%) Strand = Plus / Plus Query: 271 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 330 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 67111 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 67170 Query: 331 ctcatgt 337 ||||||| Sbjct: 67171 ctcatgt 67177
>dbj|AK071635.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100L15, full insert sequence Length = 1377 Score = 85.7 bits (43), Expect = 1e-13 Identities = 111/133 (83%), Gaps = 3/133 (2%) Strand = Plus / Minus Query: 344 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 403 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 1018 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 962 Query: 404 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 463 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 961 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 902 Query: 464 tgtcacgggggct 476 | ||||| ||||| Sbjct: 901 tatcacgagggct 889 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 452 tagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggct 506 |||||||||| |||||||||||||||| | |||||||||||||| |||||||||| Sbjct: 853 tagggctgcgactgtcacgggggctccccctagggctgcgactgtcacgggggct 799 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 445 ctcctcctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacggggg 504 |||| |||||||||||| |||||||||||||| | | ||||||| |||||| |||| ||| Sbjct: 830 ctccccctagggctgcgactgtcacgggggcttcccctagggctccgactgtcacgaggg 771 Query: 505 ctc 507 ||| Sbjct: 770 ctc 768 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 450 cctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggctc 507 ||||||||| || |||| || ||||||| | |||||||||||||| ||||||||||| Sbjct: 885 cctagggctctgggtgtcgcgagggctccccttagggctgcgactgtcacgggggctc 828 Score = 46.1 bits (23), Expect = 0.11 Identities = 56/67 (83%) Strand = Plus / Minus Query: 271 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 330 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 1112 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 1053 Query: 331 ctcatgt 337 ||||||| Sbjct: 1052 ctcatgt 1046
>dbj|AK060171.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F07, full insert sequence Length = 1332 Score = 85.7 bits (43), Expect = 1e-13 Identities = 111/133 (83%), Gaps = 3/133 (2%) Strand = Plus / Minus Query: 344 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 403 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 973 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 917 Query: 404 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 463 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 916 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 857 Query: 464 tgtcacgggggct 476 | ||||| ||||| Sbjct: 856 tatcacgagggct 844 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 452 tagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggct 506 |||||||||| |||||||||||||||| | |||||||||||||| |||||||||| Sbjct: 808 tagggctgcgactgtcacgggggctccccctagggctgcgactgtcacgggggct 754 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 445 ctcctcctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacggggg 504 |||| |||||||||||| |||||||||||||| | | ||||||| |||||| |||| ||| Sbjct: 785 ctccccctagggctgcgactgtcacgggggcttcccctagggctccgactgtcacgaggg 726 Query: 505 ctc 507 ||| Sbjct: 725 ctc 723 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 450 cctagggctgcggctgtcacgggggctcctcatagggctgcgactgccacgggggctc 507 ||||||||| || |||| || ||||||| | |||||||||||||| ||||||||||| Sbjct: 840 cctagggctctgggtgtcgcgagggctccccttagggctgcgactgtcacgggggctc 783 Score = 46.1 bits (23), Expect = 0.11 Identities = 56/67 (83%) Strand = Plus / Minus Query: 271 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 330 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 1067 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 1008 Query: 331 ctcatgt 337 ||||||| Sbjct: 1007 ctcatgt 1001
>gb|AC165346.4| Mus musculus BAC clone RP23-354N5 from chromosome 13, complete sequence Length = 233740 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 384 tgcagggcttctgctgccagga 405 |||||||||||||||||||||| Sbjct: 143566 tgcagggcttctgctgccagga 143545
>gb|AC124183.4| Mus musculus BAC clone RP23-213I18 from 13, complete sequence Length = 215251 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 384 tgcagggcttctgctgccagga 405 |||||||||||||||||||||| Sbjct: 150987 tgcagggcttctgctgccagga 151008
>gb|AC118591.7| Mus musculus chromosome 3, clone RP24-93G19, complete sequence Length = 208878 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 atgattccatgtgcacatagt 42 ||||||||||||||||||||| Sbjct: 83259 atgattccatgtgcacatagt 83239
>gb|AC164555.2| Mus musculus BAC clone RP23-346G13 from chromosome 17, complete sequence Length = 211631 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 39 tagtacaacagatattatggtctg 62 |||||||||||| ||||||||||| Sbjct: 190485 tagtacaacagaaattatggtctg 190462
>gb|DQ415920.1| Cleome spinosa clone BAC Cs3, complete sequence Length = 141360 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 154 gtaggaagaatttgatcgac 173 |||||||||||||||||||| Sbjct: 83348 gtaggaagaatttgatcgac 83367
>gb|AC073089.5| Homo sapiens BAC clone RP11-324F21 from 7, complete sequence Length = 171788 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 179 actctcaccaggtgatgcac 198 |||||||||||||||||||| Sbjct: 90667 actctcaccaggtgatgcac 90686
>gb|AC123044.4| Mus musculus BAC clone RP24-548B7 from chromosome 5, complete sequence Length = 184772 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 197 actcccactgggtgaacact 216 |||||||||||||||||||| Sbjct: 99002 actcccactgggtgaacact 99021
>gb|AC144532.4| Homo sapiens 12 BAC RP11-613J12 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 131101 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 7 tgtagaaactgcaaaatgat 26 |||||||||||||||||||| Sbjct: 119211 tgtagaaactgcaaaatgat 119192
>gb|AC110283.4| Homo sapiens chromosome 11, clone RP11-350A7, complete sequence Length = 162170 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 7 tgtagaaactgcaaaatgat 26 |||||||||||||||||||| Sbjct: 98136 tgtagaaactgcaaaatgat 98117
>gb|AE002160.2| Chlamydia muridarum Nigg, complete genome Length = 1072950 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 383 gtgcagggcttctgctgcca 402 |||||||||||||||||||| Sbjct: 408265 gtgcagggcttctgctgcca 408284
>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome Length = 5751492 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 214 actggaagaatttgatccacttaa 237 |||||||||||||||||| ||||| Sbjct: 759706 actggaagaatttgatccgcttaa 759683
>gb|AC138697.2| Homo sapiens chromosome 11, clone RP11-242O20, complete sequence Length = 149516 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 7 tgtagaaactgcaaaatgat 26 |||||||||||||||||||| Sbjct: 136646 tgtagaaactgcaaaatgat 136665
>gb|AC154260.2| Mus musculus BAC clone RP24-225C5 from 17, complete sequence Length = 187652 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 39 tagtacaacagatattatggtctg 62 |||||||||||| ||||||||||| Sbjct: 145526 tagtacaacagaaattatggtctg 145549 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,186,593 Number of Sequences: 3902068 Number of extensions: 4186593 Number of successful extensions: 75177 Number of sequences better than 10.0: 18 Number of HSP's better than 10.0 without gapping: 18 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 75061 Number of HSP's gapped (non-prelim): 111 length of query: 510 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 488 effective length of database: 17,147,199,772 effective search space: 8367833488736 effective search space used: 8367833488736 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
