ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart18d03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 896 0.0
2gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 244 2e-61
3gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 244 2e-61
4gb|AY103580.1| Zea mays PCO072544 mRNA sequence 244 2e-61
5gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 228 1e-56
6gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 220 3e-54
7ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 216 5e-53
8gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 216 5e-53
9dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 5e-53
10dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 5e-53
11dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 5e-53
12dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 5e-53
13gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 212 8e-52
14gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 212 8e-52
15emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 210 3e-51
16emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 206 5e-50
17dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 206 5e-50
18dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 206 5e-50
19dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 206 5e-50
20gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 206 5e-50
21dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 206 5e-50
22gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 202 7e-49
23dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 200 3e-48
24emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 188 1e-44
25dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 180 3e-42
26gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 165 2e-37
27emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 161 3e-36
28gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 161 3e-36
29gb|AY107675.1| Zea mays PCO112712 mRNA sequence 161 3e-36
30gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 149 1e-32
31gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 145 1e-31
32ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 141 2e-30
33dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
34dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 141 2e-30
35emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 135 1e-28
36dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 135 1e-28
37gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 129 9e-27
38gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 129 9e-27
39gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 129 9e-27
40gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 129 9e-27
41gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 129 9e-27
42gb|AY109332.1| Zea mays CL502_5 mRNA sequence 129 9e-27
43gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 127 4e-26
44gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 127 4e-26
45gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 125 1e-25
46gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 125 1e-25
47gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 123 5e-25
48dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
49dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
50dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
51gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 119 9e-24
52ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 117 3e-23
53ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 117 3e-23
54ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 117 3e-23
55dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
56dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
57dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
58dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
59dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
60gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 117 3e-23
61ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 113 5e-22
62ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 113 5e-22
63ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 113 5e-22
64gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 113 5e-22
65dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 113 5e-22
66gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 113 5e-22
67dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 113 5e-22
68dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 113 5e-22
69dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 113 5e-22
70dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 5e-22
71dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 5e-22
72gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 109 8e-21
73gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 100 8e-18
74dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 100 8e-18
75ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 98 3e-17
76gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 98 3e-17
77dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 98 3e-17
78gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 98 3e-17
79dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 3e-17
80dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 3e-17
81dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 3e-17
82dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 3e-17
83dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 98 3e-17
84emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 96 1e-16
85dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
86dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 94 5e-16
87dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
88dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 92 2e-15
89dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 92 2e-15
90dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 92 2e-15
91ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 88 3e-14
92emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 88 3e-14
93gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno... 88 3e-14
94gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 88 3e-14
95dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
96dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
97gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 88 3e-14
98ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 86 1e-13
99emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 86 1e-13
100dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
101ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 84 5e-13
102gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 84 5e-13
103gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 84 5e-13
104gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 84 5e-13
105emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 84 5e-13
106emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 84 5e-13
107emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 84 5e-13
108gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 84 5e-13
109gb|AY107589.1| Zea mays PCO085320 mRNA sequence 84 5e-13
110gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 82 2e-12
111emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 82 2e-12
112emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 82 2e-12
113gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 80 7e-12
114gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 80 7e-12
115dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 78 3e-11
116dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
117dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
118dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
119dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
120dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
121dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
122dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
123emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 76 1e-10
124emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
125gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 76 1e-10
126gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 74 5e-10
127gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 74 5e-10
128gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 74 5e-10
129gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co... 74 5e-10
130gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 74 5e-10
131ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 72 2e-09
132emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 72 2e-09
133emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major... 72 2e-09
134emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 72 2e-09
135gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 70 7e-09
136emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 70 7e-09
137gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel... 68 3e-08
138gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins... 68 3e-08
139ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA 66 1e-07
140gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 66 1e-07
141gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 66 1e-07
142emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 66 1e-07
143gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 66 1e-07
144gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 66 1e-07
145dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
146dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
147gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl... 66 1e-07
148gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com... 66 1e-07
149gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 64 4e-07
150emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 64 4e-07
151gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 64 4e-07
152gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 64 4e-07
153dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 64 4e-07
154dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane... 62 2e-06
155dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote... 62 2e-06
156ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6... 60 7e-06
157gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA 60 7e-06
158gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrin... 60 7e-06
159emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene) 60 7e-06
160emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial 60 7e-06
161emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ... 60 7e-06
162gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 60 7e-06
163gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 60 7e-06
164emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co... 60 7e-06
165gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 60 7e-06
166gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mR... 60 7e-06
167gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se... 60 7e-06
168gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA... 60 7e-06
169gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 60 7e-06
170gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 60 7e-06
171gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 60 7e-06
172ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 58 3e-05
173emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protei... 58 3e-05
174emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 58 3e-05
175emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 58 3e-05
176emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BA... 58 3e-05
177emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 58 3e-05
178emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for... 58 3e-05
179gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRN... 58 3e-05
180gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 58 3e-05
181gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 58 3e-05
182emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
183emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
184gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 58 3e-05
185gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 58 3e-05
186gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 58 3e-05
187dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone... 58 3e-05
188gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 56 1e-04
189gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 56 1e-04
190gb|DQ018114.1| Physcomitrella patens plasma membrane aquaporin (... 56 1e-04
191emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic... 56 1e-04
192emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 56 1e-04
193emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 56 1e-04
194gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P... 56 1e-04
195gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 56 1e-04
196dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 56 1e-04
197gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence 54 4e-04
198gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partia... 54 4e-04
199emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 54 4e-04
200gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein ... 54 4e-04
201dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in... 54 4e-04
202gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp... 54 4e-04
203dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote... 54 4e-04
204ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3... 52 0.002
205ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe... 52 0.002
206gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr... 52 0.002
207emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins... 52 0.002
208emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrins... 52 0.002
209gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map... 52 0.002
210emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co... 52 0.002
211emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
212emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co... 52 0.002
213emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
214emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co... 52 0.002
215emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co... 52 0.002
216emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co... 52 0.002
217gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s... 52 0.002
218gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s... 52 0.002
219dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 52 0.002
220emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 52 0.002
221emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co... 50 0.007
222dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 50 0.007
223ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 48 0.026
224gb|AY019116.1| Oryza sativa microsatellite MRG1441 containing (A... 48 0.026
225gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein ... 48 0.026
226dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
227dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 48 0.026
228dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
229dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
230dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
231dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 48 0.026
232gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrins... 48 0.026
233ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA 46 0.10
234gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1... 46 0.10
235ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood g... 46 0.10
236ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1),... 46 0.10
237gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 46 0.10
238emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1 46 0.10
239ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA 46 0.10
240gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, compl... 46 0.10
241gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:1290... 46 0.10
242gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocula... 46 0.10
243gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-... 46 0.10
244gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 46 0.10
245gb|AF051202.1|AF051202 Picea mariana probable aquaporin (Sb01) m... 46 0.10
246gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 m... 46 0.10
247gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 46 0.10
248gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com... 46 0.10
249emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chro... 46 0.10
250dbj|AB012044.1| Raphanus sativus mRNA for plasma membrane aquapo... 46 0.10
251dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, p... 46 0.10
252dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, c... 46 0.10
253ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37... 44 0.41
254gb|AC153004.18| Medicago truncatula clone mth2-101j9, complete s... 44 0.41
255gb|AC138580.19| Medicago truncatula clone mth2-14e15, complete s... 44 0.41
256gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (... 44 0.41
257gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m... 44 0.41
258emb|AL031227.1|DMC66A1 Drosophila melanogaster cosmid 66A1 44 0.41
259emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 44 0.41
260emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 44 0.41
261gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell ... 44 0.41
262ref|NM_131946.3| Drosophila melanogaster CG12184-RA (CG12184), mRNA 44 0.41
263gb|AY051507.1| Drosophila melanogaster GH15731 full length cDNA 44 0.41
264gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 44 0.41
265gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s... 44 0.41
266gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 44 0.41
267dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran... 44 0.41
268gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 ... 44 0.41
269gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 44 0.41
270gb|AY489268.1| Physcomitrella patens aquaporin PIP 2 mRNA, compl... 42 1.6
271ref|NM_184972.2| Oryza sativa (japonica cultivar-group), mRNA 42 1.6
272gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic p... 42 1.6
273gb|DQ018113.1| Physcomitrella patens plasma membrane aquaporin (... 42 1.6
274gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 42 1.6
275gb|AE014075.1| Escherichia coli CFT073, complete genome 42 1.6
276gb|CP000316.1| Polaromonas sp. JS666, complete genome 42 1.6
277emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.6
278emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 42 1.6
279gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot... 42 1.6
280gb|AC084748.11| Oryza sativa chromosome 3 BAC OSJNBa0010I09 geno... 42 1.6
281dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 42 1.6
282gb|AC022118.5| Homo sapiens chromosome 5 clone CTC-548H10, compl... 42 1.6
283gb|AC024248.7| Homo sapiens BAC clone RP11-659O3 from 4, complet... 42 1.6
284gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 1.6
285gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete c... 42 1.6
286ref|NM_211463.1| Eremothecium gossypii AGL266Cp (AGL266C), mRNA 42 1.6
287dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane ... 42 1.6
288gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 6.3
289ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe... 40 6.3
290ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 40 6.3
291ref|XM_550604.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.3
292ref|XM_521983.1| PREDICTED: Pan troglodytes similar to expressed... 40 6.3
293ref|NM_001005210.1| Homo sapiens leucine rich repeat containing ... 40 6.3
294gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 40 6.3
295gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete se... 40 6.3
296gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic... 40 6.3
297gb|AY961919.1| Picea abies probable aquaporin (Aqp) mRNA, comple... 40 6.3
298gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds 40 6.3
299emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in... 40 6.3
300gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Can... 40 6.3
301emb|CR733851.2|CNS0GT0Q Tetraodon nigroviridis full-length cDNA 40 6.3
302emb|X62669.1|MMHOX4 M.musculus genes HOX-4.4 and Hox-4.5 40 6.3
303emb|AL355384.6| Human DNA sequence from clone RP11-626C11 on chr... 40 6.3
304gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)... 40 6.3
305emb|Z93764.1|PAZ93764 P.abies mRNA for membrane intrinsic protein 40 6.3
306emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 40 6.3
307emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 40 6.3
308gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 40 6.3
309emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 40 6.3
310gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 40 6.3
311gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote... 40 6.3
312gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote... 40 6.3
313gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 6.3
314gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 40 6.3
315emb|BX294013.1|NCX4G11 Neurospora crassa DNA linkage group V Cos... 40 6.3
316emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA... 40 6.3
317emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B... 40 6.3
318emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major ... 40 6.3
319gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 6.3
320gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromo... 40 6.3
321dbj|AK127591.1| Homo sapiens cDNA FLJ45686 fis, clone FCBBF3012443 40 6.3
322gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 6.3
323gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 40 6.3
324gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, co... 40 6.3
325gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, co... 40 6.3
326gb|AC093246.3| Homo sapiens chromosome 5 clone RP11-117L6, compl... 40 6.3
327gb|AC091980.4| Homo sapiens chromosome 5 clone RP11-546B8, compl... 40 6.3
328gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, com... 40 6.3
329gb|AF218774.1|AF218774 Lycopersicon esculentum putative water ch... 40 6.3
330gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Canc... 40 6.3
331gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 40 6.3
332gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 40 6.3
333dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial... 40 6.3
334gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 40 6.3
335dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
336emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 40 6.3
337emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 40 6.3
338emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 40 6.3
339emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 40 6.3
340emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co... 40 6.3
341gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, compl... 40 6.3
342gb|AE009619.1| Brucella melitensis 16M chromosome I, section 176... 40 6.3
343gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 40 6.3
344gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s... 40 6.3
345gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 40 6.3
346gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 40 6.3
347dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
348dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
349dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
350emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 i... 40 6.3
351emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 40 6.3
352dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
353dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
354dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
355dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
356dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
357dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
358dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
359dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
360gb|AY109715.1| Zea mays CL333_1 mRNA sequence 40 6.3
361dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 6.3
362gb|DQ151348.1| Petromyzon marinus clone T.D8 variable lymphocyte... 40 6.3
363gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 40 6.3
364gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Can... 40 6.3
365emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 40 6.3
366gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 40 6.3
367dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquapo... 40 6.3

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  896 bits (452), Expect = 0.0
 Identities = 461/464 (99%)
 Strand = Plus / Minus

                                                                        
Query: 7    aacaactttgctggatttgcacaacaacgagcagtactacacaacaactgagcactgatg 66
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1199 aacaactttgctggatttgcacaacaacgagcagtactacacaacaactgagcactgatg 1140

                                                                        
Query: 67   agattacatacaagtcctctgtctgggttcaggtgaatacagagcaagagcaagagtagc 126
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1139 agattacatacaagtcctctgtctgggttcaggtgaatacagagcaagagcaagagtagt 1080

                                                                        
Query: 127  gcatcaaacttggaagacaaattggaattccacggtaacacggacgatgggaagagaggg 186
             ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1079 acatcaaacttggaagacaaattggaattccacggtaacagggacgatgggaagagaggg 1020

                                                                        
Query: 187  ccgcccccatcagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatgg 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1019 ccgcccccatcagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatgg 960

                                                                        
Query: 247  catctttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgacca 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 959  catctttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgacca 900

                                                                        
Query: 307  cctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 899  cctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagt 840

                                                                        
Query: 367  ggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggt 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 839  ggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggt 780

                                                        
Query: 427  tgatgccggtgccggtgatggggatggtggccaggtggaccagg 470
            ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 779  tgatgccggtgccggtgatggggatggtggccaggtggaccagg 736



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  244 bits (123), Expect = 2e-61
 Identities = 186/207 (89%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 984 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 925

                                                                       
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
           ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 924 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 865

                                                                       
Query: 384 tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtg 443
           |||| ||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||
Sbjct: 864 tcccggttgtagatgatggcggcgccaaggctcctagccgggttgatgccggtgccggtg 805

                                      
Query: 444 atggggatggtggccaggtggaccagg 470
           |||||||||||||| ||||||||||||
Sbjct: 804 atggggatggtggcaaggtggaccagg 778



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  244 bits (123), Expect = 2e-61
 Identities = 186/207 (89%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 979 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 920

                                                                       
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
           ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 919 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 860

                                                                       
Query: 384 tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtg 443
           |||| ||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||
Sbjct: 859 tcccggttgtagatgatggcggcgccaaggctcctagccgggttgatgccggtgccggtg 800

                                      
Query: 444 atggggatggtggccaggtggaccagg 470
           |||||||||||||| ||||||||||||
Sbjct: 799 atggggatggtggcaaggtggaccagg 773



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  244 bits (123), Expect = 2e-61
 Identities = 186/207 (89%)
 Strand = Plus / Minus

                                                                        
Query: 264  gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
            |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 1308 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 1249

                                                                        
Query: 324  gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
            ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 1248 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 1189

                                                                        
Query: 384  tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtg 443
            |||| ||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||
Sbjct: 1188 tcccggttgtagatgatggcggcgccaaggctcctagccgggttgatgccggtgccggtg 1129

                                       
Query: 444  atggggatggtggccaggtggaccagg 470
            |||||||||||||| ||||||||||||
Sbjct: 1128 atggggatggtggcaaggtggaccagg 1102



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  228 bits (115), Expect = 1e-56
 Identities = 184/207 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| |||||||||| |||||||||||||||||| 
Sbjct: 935 gcagcttaagacctgctcttgaacgggatggctctgatgatcacctggtggtagatggca 876

                                                                       
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
           ||||| || ||||| |||||||||||||||||||||||||| |||||   ||||||||| 
Sbjct: 875 gccagggcagcgccaatgaaggggccgacccagaagatccaatggtcgttccaggcgtga 816

                                                                       
Query: 384 tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtg 443
           |||||||||||||||||||| ||||| |||||||| || ||||||||||| ||||| || 
Sbjct: 815 tccctgttgtagatgatggcagcgccaaggctcctagctgggttgatgccagtgccagta 756

                                      
Query: 444 atggggatggtggccaggtggaccagg 470
           |||||||||||||| ||||||||||||
Sbjct: 755 atggggatggtggcaaggtggaccagg 729



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  220 bits (111), Expect = 3e-54
 Identities = 183/207 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 834 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 775

                                                                       
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
           ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 774 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 715

                                                                       
Query: 384 tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtg 443
           |||| ||||||||||||||| ||||| ||||||||    |||||||||||||||||||||
Sbjct: 714 tcccggttgtagatgatggcggcgccaaggctcctaaaggggttgatgccggtgccggtg 655

                                      
Query: 444 atggggatggtggccaggtggaccagg 470
           |||||||||||||| ||||||||||||
Sbjct: 654 atggggatggtggcaaggtggaccagg 628



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  216 bits (109), Expect = 5e-53
 Identities = 169/189 (89%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 838 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 779

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 778 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 719

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 718 tggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggcca 659

                    
Query: 460 ggtggacca 468
           |||| ||||
Sbjct: 658 ggtgaacca 650



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score =  216 bits (109), Expect = 5e-53
 Identities = 169/189 (89%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| ||||| || ||||||| ||||||||||||||||||||| || || ||||| |
Sbjct: 412 tcttgaacgggatggccctgatgatcacctggtggtagatggcggctagggcagcgccaa 353

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           ||||||||||||||||||||||||| |||||   ||||||||||||||||||||||||||
Sbjct: 352 tgaaggggccgacccagaagatccaatggtcattccaggcgtgctccctgttgtagatga 293

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||| ||||| |||||||| || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 292 tggcagcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggcaa 233

                    
Query: 460 ggtggacca 468
           |||||||||
Sbjct: 232 ggtggacca 224



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  216 bits (109), Expect = 5e-53
 Identities = 169/189 (89%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 915 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 856

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 855 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 796

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 795 tggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggcca 736

                    
Query: 460 ggtggacca 468
           |||| ||||
Sbjct: 735 ggtgaacca 727



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  216 bits (109), Expect = 5e-53
 Identities = 169/189 (89%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 916 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 857

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 856 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 797

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 796 tggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggcca 737

                    
Query: 460 ggtggacca 468
           |||| ||||
Sbjct: 736 ggtgaacca 728



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  216 bits (109), Expect = 5e-53
 Identities = 169/189 (89%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 918 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 859

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 858 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 799

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 798 tggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggcca 739

                    
Query: 460 ggtggacca 468
           |||| ||||
Sbjct: 738 ggtgaacca 730



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score =  216 bits (109), Expect = 5e-53
 Identities = 169/189 (89%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
            |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 1214 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 1155

                                                                        
Query: 340  tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
            |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 1154 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 1095

                                                                        
Query: 400  tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
            |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1094 tggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggcca 1035

                     
Query: 460  ggtggacca 468
            |||| ||||
Sbjct: 1034 ggtgaacca 1026



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  212 bits (107), Expect = 8e-52
 Identities = 167/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 425 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 366

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           ||||||||||||||||||||||||||||||| | |||||| || | |  |||||| || |
Sbjct: 365 tgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaaatta 306

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
            ||| ||||| ||||||| ||| ||||||||||||||||||||||| |||||||||||||
Sbjct: 305 cggcggcgccaaggctccgcgcggggttgatgccggtgccggtgatagggatggtggcca 246

                  
Query: 460 ggtggac 466
           |||||||
Sbjct: 245 ggtggac 239



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  212 bits (107), Expect = 8e-52
 Identities = 167/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 856 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 797

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           ||||||||||||||||||||||||||||||| | |||||| || | |  |||||| || |
Sbjct: 796 tgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaaatta 737

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
            ||| ||||| ||||||| ||| ||||||||||||||||||||||| |||||||||||||
Sbjct: 736 cggcggcgccaaggctccgcgcggggttgatgccggtgccggtgatagggatggtggcca 677

                  
Query: 460 ggtggac 466
           |||||||
Sbjct: 676 ggtggac 670



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score =  210 bits (106), Expect = 3e-51
 Identities = 106/106 (100%)
 Strand = Plus / Minus

                                                                       
Query: 365 gtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgg 424
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 680 gtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgg 621

                                                         
Query: 425 gttgatgccggtgccggtgatggggatggtggccaggtggaccagg 470
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 620 gttgatgccggtgccggtgatggggatggtggccaggtggaccagg 575



 Score =  113 bits (57), Expect = 5e-22
 Identities = 57/57 (100%)
 Strand = Plus / Minus

                                                                     
Query: 308  ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 1235



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  206 bits (104), Expect = 5e-50
 Identities = 179/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 896 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 837

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 836 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 777

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatg 446
            |||||||||||||||| ||||| |||||||| || ||||||||||| || |||||||||
Sbjct: 776 ttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatg 717

                                   
Query: 447 gggatggtggccaggtggaccagg 470
           ||||||||||||||||||||||||
Sbjct: 716 gggatggtggccaggtggaccagg 693



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  206 bits (104), Expect = 5e-50
 Identities = 179/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatg 446
            |||||||||||||||| ||||| |||||||| || ||||||||||| || |||||||||
Sbjct: 809 ttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatg 750

                                   
Query: 447 gggatggtggccaggtggaccagg 470
           ||||||||||||||||||||||||
Sbjct: 749 gggatggtggccaggtggaccagg 726



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  206 bits (104), Expect = 5e-50
 Identities = 179/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 984 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 925

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 924 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 865

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatg 446
            |||||||||||||||| ||||| |||||||| || ||||||||||| || |||||||||
Sbjct: 864 ttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatg 805

                                   
Query: 447 gggatggtggccaggtggaccagg 470
           ||||||||||||||||||||||||
Sbjct: 804 gggatggtggccaggtggaccagg 781



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  206 bits (104), Expect = 5e-50
 Identities = 179/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatg 446
            |||||||||||||||| ||||| |||||||| || ||||||||||| || |||||||||
Sbjct: 809 ttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatg 750

                                   
Query: 447 gggatggtggccaggtggaccagg 470
           ||||||||||||||||||||||||
Sbjct: 749 gggatggtggccaggtggaccagg 726



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  206 bits (104), Expect = 5e-50
 Identities = 179/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 924 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 865

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 864 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 805

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatg 446
            |||||||||||||||| ||||| |||||||| || ||||||||||| || |||||||||
Sbjct: 804 ttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatg 745

                                   
Query: 447 gggatggtggccaggtggaccagg 470
           ||||||||||||||||||||||||
Sbjct: 744 gggatggtggccaggtggaccagg 721



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  206 bits (104), Expect = 5e-50
 Identities = 179/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 927 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 868

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 867 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 808

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatg 446
            |||||||||||||||| ||||| |||||||| || ||||||||||| || |||||||||
Sbjct: 807 ttgttgtagatgatggcagcgccaaggctcctggctgggttgatgccagtaccggtgatg 748

                                   
Query: 447 gggatggtggccaggtggaccagg 470
           ||||||||||||||||||||||||
Sbjct: 747 gggatggtggccaggtggaccagg 724



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score =  202 bits (102), Expect = 7e-49
 Identities = 180/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 265 cagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcgg 324
           ||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| |
Sbjct: 359 cagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggcag 300

                                                                       
Query: 325 ccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgct 384
           |||| || || || |||||||||||||||||||||||||| |||||   |||||| || |
Sbjct: 299 ccagggcagcaccaatgaaggggccgacccagaagatccaatggtcgctccaggcatgat 240

                                                                       
Query: 385 ccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtga 444
           ||||||||||||||||||| ||||| |||||||| || ||||||||||| ||||| || |
Sbjct: 239 ccctgttgtagatgatggcagcgccaaggctcctagctgggttgatgccagtgccagtaa 180

                                     
Query: 445 tggggatggtggccaggtggaccagg 470
           ||||||||||||| ||||||||||||
Sbjct: 179 tggggatggtggcaaggtggaccagg 154



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  200 bits (101), Expect = 3e-48
 Identities = 158/177 (89%)
 Strand = Plus / Minus

                                                                       
Query: 294 gctctgatgaccacctggtggtagatggcggccagcgcggcgccgatgaaggggccgacc 353
           |||||||||| |||||||||||||| ||| ||||| |||||||| | ||||||||| |||
Sbjct: 927 gctctgatgatcacctggtggtagacggctgccagggcggcgccaacgaaggggcccacc 868

                                                                       
Query: 354 cagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgagg 413
           ||||||||||| |||||   |||||| || |||||||||||||||||||| || || |||
Sbjct: 867 cagaagatccaatggtcattccaggcatggtccctgttgtagatgatggcagccccaagg 808

                                                                    
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggaccagg 470
           ||||| || |||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 807 ctcctagctgggttgatgccggtgccggtgatgggaatggtggccaggtggaccagg 751



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  188 bits (95), Expect = 1e-44
 Identities = 164/187 (87%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 913 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 854

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           ||||||||||||||||||||||||||||||| | |||||| || | |  |||||| || |
Sbjct: 853 tgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaaatta 794

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
            ||| ||||| ||||||| ||| |||||||||||||||||||||||    ||||||||||
Sbjct: 793 cggcggcgccaaggctccgcgcggggttgatgccggtgccggtgatacccatggtggcca 734

                  
Query: 460 ggtggac 466
           |||||||
Sbjct: 733 ggtggac 727



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  180 bits (91), Expect = 3e-42
 Identities = 166/191 (86%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| |||||||| ||||| ||||||  ||||||||| || |||||||| |||||||
Sbjct: 945 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 886

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || ||||||||||||||||||||   ||| || |||| | ||||||||||||
Sbjct: 885 tgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 826

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||| |||||||||  |||||||||||||||||||||||| ||||||||||| || ||||
Sbjct: 825 tggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatggggatcgtcgcca 766

                      
Query: 460 ggtggaccagg 470
           |||| ||||||
Sbjct: 765 ggtgcaccagg 755



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score =  165 bits (83), Expect = 2e-37
 Identities = 164/191 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| ||||| || ||||| ||||||  |||||||||||| |||||||| || ||||
Sbjct: 930 tcttgaaggggatggccctgatcaccaccacgtggtagatggccgccagcgccgcaccga 871

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || ||||||||||||||||||||   ||| || |||| | ||||||||||||
Sbjct: 870 tgaacggaccaacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 811

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||| |||||||||  ||||||||||||||||||||| || ||||||||||| || ||||
Sbjct: 810 tggcggcgccgagggacctcgccgggttgatgccggtccccgtgatggggatcgtcgcca 751

                      
Query: 460 ggtggaccagg 470
           |||| ||||||
Sbjct: 750 ggtgcaccagg 740



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score =  161 bits (81), Expect = 3e-36
 Identities = 135/153 (88%)
 Strand = Plus / Minus

                                                                       
Query: 311 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           ||||||||||||||| || || || |||||||||||||| ||||||||||||||||||||
Sbjct: 906 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 847

                                                                       
Query: 371 tgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgat 430
              ||| |||||   ||||||||||| |||||| ||||||||||| | ||| ||||||||
Sbjct: 846 gttccatgcgtgggacctgttgtagacgatggcggcgccgaggctgcgcgcggggttgat 787

                                            
Query: 431 gccggtgccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||||||| ||||||||
Sbjct: 786 gccggtgccggtgatggggatggtcgccaggtg 754



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score =  161 bits (81), Expect = 3e-36
 Identities = 135/153 (88%)
 Strand = Plus / Minus

                                                                       
Query: 311 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           ||||||||||||||| || || || |||||||||||||| ||||||||||||||||||||
Sbjct: 897 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 838

                                                                       
Query: 371 tgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgat 430
              ||| |||||   ||||||||||| |||||| ||||||||||| | ||| ||||||||
Sbjct: 837 gttccatgcgtgggacctgttgtagacgatggcggcgccgaggctgcgcgcggggttgat 778

                                            
Query: 431 gccggtgccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||||||| ||||||||
Sbjct: 777 gccggtgccggtgatggggatggtcgccaggtg 745



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score =  161 bits (81), Expect = 3e-36
 Identities = 135/153 (88%)
 Strand = Plus / Minus

                                                                       
Query: 311 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           ||||||||||||||| || || || |||||||||||||| ||||||||||||||||||||
Sbjct: 330 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 271

                                                                       
Query: 371 tgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgat 430
              ||| |||||   ||||||||||| |||||| ||||||||||| | ||| ||||||||
Sbjct: 270 gttccatgcgtgggacctgttgtagacgatggcggcgccgaggctgcgcgcggggttgat 211

                                            
Query: 431 gccggtgccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||||||| ||||||||
Sbjct: 210 gccggtgccggtgatggggatggtcgccaggtg 178



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score =  149 bits (75), Expect = 1e-32
 Identities = 165/195 (84%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 333
           |||||| |||||| || || ||||||||||||||||||||||| |  || || || ||||
Sbjct: 887 acttggacttgaagggaatggctctgatgaccacctggtggtataaagctgctagtgcgg 828

                                                                       
Query: 334 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 393
           | || ||||| || || ||||||||||||||||||||   ||| ||||| ||| ||||||
Sbjct: 827 ccccaatgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttgttgt 768

                                                                       
Query: 394 agatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatgg 453
           ||||||||||||| || |||||||  || |||||||||||||| ||||| ||||||||||
Sbjct: 767 agatgatggccgcacccaggctccgagctgggttgatgccggttccggttatggggatgg 708

                          
Query: 454 tggccaggtggacca 468
           |||||| ||| ||||
Sbjct: 707 tggccaagtgcacca 693



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score =  145 bits (73), Expect = 1e-31
 Identities = 139/161 (86%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 890 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 831

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
            ||   |||||| |  ||| |||||||||||| ||| || || |||||||  ||||||||
Sbjct: 830 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctccgggccgggtt 771

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 770 gatgccggtgccggtgatggggatggtggccaggtggacca 730



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score =  141 bits (71), Expect = 2e-30
 Identities = 158/187 (84%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1008 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 949

                                                                        
Query: 340  tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
            |||| || || |||||||| |||||||||||   ||| |||||  | | ||| |||| ||
Sbjct: 948  tgaacggaccaacccagaaaatccagtggtcgtgccatgcgtgggcgcggttatagacga 889

                                                                        
Query: 400  tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
            |||| ||||||||||| |  || ||||||||||||||||||||||||||||||||||| |
Sbjct: 888  tggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcga 829

                   
Query: 460  ggtggac 466
            |||||||
Sbjct: 828  ggtggac 822



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
            insert sequence
          Length = 1318

 Score =  141 bits (71), Expect = 2e-30
 Identities = 158/187 (84%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1007 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 948

                                                                        
Query: 340  tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
            |||| || || |||||||| |||||||||||   ||| |||||  | | ||| |||| ||
Sbjct: 947  tgaacggaccaacccagaaaatccagtggtcgtgccatgcgtgggcgcggttatagacga 888

                                                                        
Query: 400  tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
            |||| ||||||||||| |  || ||||||||||||||||||||||||||||||||||| |
Sbjct: 887  tggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcga 828

                   
Query: 460  ggtggac 466
            |||||||
Sbjct: 827  ggtggac 821



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score =  141 bits (71), Expect = 2e-30
 Identities = 158/187 (84%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 985 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 926

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || |||||||| |||||||||||   ||| |||||  | | ||| |||| ||
Sbjct: 925 tgaacggaccaacccagaaaatccagtggtcgtgccatgcgtgggcgcggttatagacga 866

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||| ||||||||||| |  || ||||||||||||||||||||||||||||||||||| |
Sbjct: 865 tggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcga 806

                  
Query: 460 ggtggac 466
           |||||||
Sbjct: 805 ggtggac 799



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score =  135 bits (68), Expect = 1e-28
 Identities = 80/84 (95%)
 Strand = Plus / Minus

                                                                         
Query: 385   ccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtga 444
             ||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 28003 ccctgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccggtga 27944

                                     
Query: 445   tggggatggtggccaggtggacca 468
             ||||||||||||||||||| ||||
Sbjct: 27943 tggggatggtggccaggtgaacca 27920



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 76/85 (89%)
 Strand = Plus / Minus

                                                                         
Query: 280   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
             |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28669 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28610

                                      
Query: 340   tgaaggggccgacccagaagatcca 364
             |||||||||| ||||||||||||||
Sbjct: 28609 tgaaggggccaacccagaagatcca 28585



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  135 bits (68), Expect = 1e-28
 Identities = 80/84 (95%)
 Strand = Plus / Minus

                                                                            
Query: 385      ccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtga 444
                ||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 28020777 ccctgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccggtga 28020718

                                        
Query: 445      tggggatggtggccaggtggacca 468
                ||||||||||||||||||| ||||
Sbjct: 28020717 tggggatggtggccaggtgaacca 28020694



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 76/85 (89%)
 Strand = Plus / Minus

                                                                            
Query: 280      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
                |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28021443 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28021384

                                         
Query: 340      tgaaggggccgacccagaagatcca 364
                |||||||||| ||||||||||||||
Sbjct: 28021383 tgaaggggccaacccagaagatcca 28021359



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                           
Query: 389     gttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
               ||||||||||| ||| ||||||| |||||  || ||||||||||| ||||||||||||||
Sbjct: 8906918 gttgtagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggg 8906977

                                   
Query: 449     gatggtggccaggtggacca 468
               ||||||||||||||| ||||
Sbjct: 8906978 gatggtggccaggtgcacca 8906997



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 413      gctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
                |||||| |||||||||||||||||||||||||| ||||| ||||||| ||| ||||
Sbjct: 26074194 gctccttgccgggttgatgccggtgccggtgatcgggatcgtggccaagtgaacca 26074139



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 308      ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
                ||||||||||  |||||| |  ||||||||||||| ||| || ||||||||||||||
Sbjct: 26074808 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 26074752



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  129 bits (65), Expect = 9e-27
 Identities = 110/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggc 403
           |||||| ||||||||||||||||||||   |||||  |  ||| |||||||||||| |||
Sbjct: 833 ggggcccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggc 774

                                                                       
Query: 404 cgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtg 463
            ||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 773 ggcgcccaggctcctggccgggttgatgccggtgccggtgacggggatggtggccaggtg 714

                
Query: 464 gacca 468
            ||||
Sbjct: 713 cacca 709



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score =  129 bits (65), Expect = 9e-27
 Identities = 92/101 (91%)
 Strand = Plus / Plus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 244 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 303

                                                    
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatcca 364
           ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 304 gccagggcggcgccgatgaaggggccgacccagaagatcca 344



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score =  129 bits (65), Expect = 9e-27
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 533 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 474

                                                    
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatcca 364
           ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 473 gccagggcggcgccgatgaaggggccgacccagaagatcca 433



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  129 bits (65), Expect = 9e-27
 Identities = 137/161 (85%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  |||||||| || |  ||||| |||||||||||||| ||
Sbjct: 900 ctggtggtaggcggcggcgatggcggcgccaatcagtgggcccacccagaagatccattg 841

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| ||||||||||||  || || || |||||||||||||||||
Sbjct: 840 gtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaggctcctcgccgggtt 781

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 780 gatgccggtgccggtgatggggatggtggccaggtgcacca 740



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  129 bits (65), Expect = 9e-27
 Identities = 137/161 (85%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  ||||| |||||||||||||| ||
Sbjct: 890 ctggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatccattg 831

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| ||||||||||||  || || || | |||||||||||||||
Sbjct: 830 gtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgggtt 771

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 770 gatgccggtgccggtgatggggatggtggccaggtgcacca 730



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  129 bits (65), Expect = 9e-27
 Identities = 137/161 (85%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  ||||| |||||||||||||| ||
Sbjct: 318 ctggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatccattg 259

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| ||||||||||||  || || || | |||||||||||||||
Sbjct: 258 gtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgggtt 199

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 198 gatgccggtgccggtgatggggatggtggccaggtgcacca 158



 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                        
Query: 388  tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
            ||||||||| || ||| ||||| |||||||| ||||||||||||||||||||||||| ||
Sbjct: 1511 tgttgtagacgacggcggcgcccaggctcctggccgggttgatgccggtgccggtgacgg 1452

                                 
Query: 448  ggatggtggccaggtggacca 468
            |||||||||||||||||||||
Sbjct: 1451 ggatggtggccaggtggacca 1431



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  127 bits (64), Expect = 4e-26
 Identities = 109/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 345 gggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggcc 404
           ||||| ||||||||||||||||||||   |||||  |  ||| |||||||||||| ||| 
Sbjct: 780 gggcccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcg 721

                                                                       
Query: 405 gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgg 464
           ||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||| 
Sbjct: 720 gcgcccaggctcctggccgggttgatgccggtgccggtgacggggatggtggccaggtgc 661

               
Query: 465 acca 468
           ||||
Sbjct: 660 acca 657



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  127 bits (64), Expect = 4e-26
 Identities = 109/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 345 gggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggcc 404
           ||||| ||||||||||||||||||||   |||||  |  ||| |||||||||||| ||| 
Sbjct: 851 gggcccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcg 792

                                                                       
Query: 405 gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgg 464
           ||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||| 
Sbjct: 791 gcgcccaggctcctggccgggttgatgccggtgccggtgacggggatggtggccaggtgc 732

               
Query: 465 acca 468
           ||||
Sbjct: 731 acca 728



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  125 bits (63), Expect = 1e-25
 Identities = 120/139 (86%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||||||| || || ||||||||||||||||||||   |||||| |  ||  ||
Sbjct: 782 gcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggccttgtcgttg 723

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||||||||||  || ||||| | |||||| ||||||||||||||||||||||||||||||
Sbjct: 722 ttgtagatgacagcagcgcccaagctcctggccgggttgatgccggtgccggtgatgggg 663

                              
Query: 450 atggtggccaggtggacca 468
           || |||||||| |||||||
Sbjct: 662 atcgtggccagatggacca 644



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  125 bits (63), Expect = 1e-25
 Identities = 120/139 (86%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||||||| || || ||||||||||||||||||||   |||||| |  ||  ||
Sbjct: 837 gcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggccttgtcgttg 778

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||||||||||  || ||||| | |||||| ||||||||||||||||||||||||||||||
Sbjct: 777 ttgtagatgacagcagcgcccaagctcctggccgggttgatgccggtgccggtgatgggg 718

                              
Query: 450 atggtggccaggtggacca 468
           || |||||||| |||||||
Sbjct: 717 atcgtggccagatggacca 699



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds
          Length = 1325

 Score =  123 bits (62), Expect = 5e-25
 Identities = 158/190 (83%)
 Strand = Plus / Minus

                                                                        
Query: 281  cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
            |||||| ||||| || |||| ||| ||||||||||| |  || || ||||| || |||  
Sbjct: 1074 cttgaaggggatggccctgaggacgacctggtggtacaccgccgcaagcgccgctccggc 1015

                                                                        
Query: 341  gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
            ||| ||||| |||||||||||||||||| |   |||  |||||    ||| |||||||||
Sbjct: 1014 gaacgggcccacccagaagatccagtggccgtgccacccgtgcgggttgtcgtagatgat 955

                                                                        
Query: 401  ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 460
            ||| |||||||||||||| || ||||||||||||||||||||||||||||||||||| ||
Sbjct: 954  ggcggcgccgaggctcctggcggggttgatgccggtgccggtgatggggatggtggcgag 895

                      
Query: 461  gtggaccagg 470
            ||| ||||||
Sbjct: 894  gtgcaccagg 885



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  121 bits (61), Expect = 2e-24
 Identities = 88/97 (90%)
 Strand = Plus / Minus

                                                                            
Query: 374      ccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgcc 433
                |||||| || ||| |||||||||||||||| ||||| |||||||| || |||||||||||
Sbjct: 27065059 ccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttgatgcc 27065000

                                                     
Query: 434      ggtgccggtgatggggatggtggccaggtggaccagg 470
                 || |||||||||||||||||||||||||||||||||
Sbjct: 27064999 agtaccggtgatggggatggtggccaggtggaccagg 27064963



 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                            
Query: 267      gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
                ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 27065653 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 27065594

                                                      
Query: 327      agcgcggcgccgatgaaggggccgacccagaagatcca 364
                || || ||||| | |||||| || ||||||||||||||
Sbjct: 27065593 agggcagcgccaacgaagggaccaacccagaagatcca 27065556



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 54/56 (96%)
 Strand = Plus / Minus

                                                                        
Query: 413      gctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
                ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||
Sbjct: 25183994 gctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggacca 25183939



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                            
Query: 393      tagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatg 452
                |||| |||||| ||||||||||| |  || ||||||||||||||||||||||||||||||
Sbjct: 35369057 tagacgatggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatg 35368998

                              
Query: 453      gtggccaggtggac 466
                ||||| ||||||||
Sbjct: 35368997 gtggcgaggtggac 35368984



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                            
Query: 280      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
                ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 35369403 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 35369344

                                         
Query: 340      tgaaggggccgacccagaagatcca 364
                |||| || || |||||||| |||||
Sbjct: 35369343 tgaacggaccaacccagaaaatcca 35369319



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 308      ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
                ||||||||||  |||||| |  ||||||||||| | |||||| ||||||||||||||
Sbjct: 25184661 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 25184605



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score =  121 bits (61), Expect = 2e-24
 Identities = 88/97 (90%)
 Strand = Plus / Minus

                                                                         
Query: 374   ccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgcc 433
             |||||| || ||| |||||||||||||||| ||||| |||||||| || |||||||||||
Sbjct: 36708 ccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttgatgcc 36649

                                                  
Query: 434   ggtgccggtgatggggatggtggccaggtggaccagg 470
              || |||||||||||||||||||||||||||||||||
Sbjct: 36648 agtaccggtgatggggatggtggccaggtggaccagg 36612



 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                         
Query: 267   gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
             ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 37302 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 37243

                                                   
Query: 327   agcgcggcgccgatgaaggggccgacccagaagatcca 364
             || || ||||| | |||||| || ||||||||||||||
Sbjct: 37242 agggcagcgccaacgaagggaccaacccagaagatcca 37205



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score =  121 bits (61), Expect = 2e-24
 Identities = 88/97 (90%)
 Strand = Plus / Minus

                                                                          
Query: 374    ccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgcc 433
              |||||| || ||| |||||||||||||||| ||||| |||||||| || |||||||||||
Sbjct: 118261 ccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttgatgcc 118202

                                                   
Query: 434    ggtgccggtgatggggatggtggccaggtggaccagg 470
               || |||||||||||||||||||||||||||||||||
Sbjct: 118201 agtaccggtgatggggatggtggccaggtggaccagg 118165



 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                          
Query: 267    gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
              ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 118855 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 118796

                                                    
Query: 327    agcgcggcgccgatgaaggggccgacccagaagatcca 364
              || || ||||| | |||||| || ||||||||||||||
Sbjct: 118795 agggcagcgccaacgaagggaccaacccagaagatcca 118758



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score =  119 bits (60), Expect = 9e-24
 Identities = 153/184 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 tggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgc 336
           |||||||||||||||| |||||||| || | ||||||||| | ||| || || || || |
Sbjct: 907 tggtcttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctc 848

                                                                       
Query: 337 cgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtaga 396
           | |||||||| || |||||||| |||||   |||   |||||| ||||| ||||||||||
Sbjct: 847 caatgaagggtcccacccagaaaatccacatgtcatcccaggcatgctctctgttgtaga 788

                                                                       
Query: 397 tgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtgg 456
           ||||||| || || || ||||| || |||||||||||||| ||||||||||||||||| |
Sbjct: 787 tgatggcggcccccagactcctagcagggttgatgccggttccggtgatggggatggttg 728

               
Query: 457 ccag 460
           ||||
Sbjct: 727 ccag 724



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 842

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 841 ttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcggg 782

                              
Query: 450 atggtggccaggtggacca 468
           || || |||||||||||||
Sbjct: 781 atcgtcgccaggtggacca 763



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 844

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 843 ttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcggg 784

                              
Query: 450 atggtggccaggtggacca 468
           || || |||||||||||||
Sbjct: 783 atcgtcgccaggtggacca 765



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 845

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 844 ttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcggg 785

                              
Query: 450 atggtggccaggtggacca 468
           || || |||||||||||||
Sbjct: 784 atcgtcgccaggtggacca 766



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 842

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 841 ttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcggg 782

                              
Query: 450 atggtggccaggtggacca 468
           || || |||||||||||||
Sbjct: 781 atcgtcgccaggtggacca 763



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 495 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 436

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 435 ttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcggg 376

                              
Query: 450 atggtggccaggtggacca 468
           || || |||||||||||||
Sbjct: 375 atcgtcgccaggtggacca 357



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 842

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 841 ttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcggg 782

                              
Query: 450 atggtggccaggtggacca 468
           || || |||||||||||||
Sbjct: 781 atcgtcgccaggtggacca 763



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 844

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 843 ttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcggg 784

                              
Query: 450 atggtggccaggtggacca 468
           || || |||||||||||||
Sbjct: 783 atcgtcgccaggtggacca 765



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 845

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 844 ttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcggg 785

                              
Query: 450 atggtggccaggtggacca 468
           || || |||||||||||||
Sbjct: 784 atcgtcgccaggtggacca 766



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 891 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 832

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 831 ttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcggg 772

                              
Query: 450 atggtggccaggtggacca 468
           || || |||||||||||||
Sbjct: 771 atcgtcgccaggtggacca 753



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  113 bits (57), Expect = 5e-22
 Identities = 135/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| | |||||| |||||||||||||| ||
Sbjct: 880 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatccattg 821

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| |||||||||| |  || |  || | |||||||||||||||
Sbjct: 820 gtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtt 761

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
            |||||||||||||||||||||||||||||||| |||||||
Sbjct: 760 aatgccggtgccggtgatggggatggtggccagatggacca 720



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||||||| || ||| |||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 718 tgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacgg 659

                                
Query: 448 ggatggtggccaggtggacca 468
           ||||||| |||||||| ||||
Sbjct: 658 ggatggtcgccaggtgcacca 638



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||||||| || ||| |||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 276 tgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacgg 217

                                
Query: 448 ggatggtggccaggtggacca 468
           ||||||| |||||||| ||||
Sbjct: 216 ggatggtcgccaggtgcacca 196



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           |||||||||||| ||| ||||||| |||||| || |||||||||||||||||||||||||
Sbjct: 747 tgttgtagatgacggcggcgccgaagctcctggcggggttgatgccggtgccggtgatgg 688

                                
Query: 448 ggatggtggccaggtggacca 468
           |||||||||| ||||||||||
Sbjct: 687 ggatggtggcaaggtggacca 667



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                            
Query: 388      tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
                ||||||||| || ||| |||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 15324235 tgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacgg 15324176

                                     
Query: 448      ggatggtggccaggtggacca 468
                ||||||| |||||||| ||||
Sbjct: 15324175 ggatggtcgccaggtgcacca 15324155



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                            
Query: 388      tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
                ||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 15316355 tgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatcg 15316296

                                     
Query: 448      ggatggtggccaggtggacca 468
                |||| || |||||||| ||||
Sbjct: 15316295 ggatcgtcgccaggtgcacca 15316275



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 73/81 (90%)
 Strand = Plus / Minus

                                                                            
Query: 388      tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
                ||||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |
Sbjct: 15355593 tgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcg 15355534

                                     
Query: 448      ggatggtggccaggtggacca 468
                |||| || |||||||||||||
Sbjct: 15355533 ggatcgtcgccaggtggacca 15355513



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                            
Query: 406      cgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgga 465
                ||||||||||||| |||||||||||||||||||||||||| ||||| || |||||||| |
Sbjct: 15306286 cgccgaggctcctggccgggttgatgccggtgccggtgatcgggatcgtcgccaggtgca 15306227

                   
Query: 466      cca 468
                |||
Sbjct: 15306226 cca 15306224



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 330      gcggcgccgatgaaggggccgacccagaagatcca 364
                |||||||||| ||| ||||||||||||||||||||
Sbjct: 15355775 gcggcgccgacgaacgggccgacccagaagatcca 15355741



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 336      ccgatgaaggggccgacccagaagatcca 364
                |||||||| || |||||||||||||||||
Sbjct: 15316506 ccgatgaacggcccgacccagaagatcca 15316478



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 333      gcgccgatgaaggggccgacccagaagatcca 364
                ||||||||||| || || ||||||||||||||
Sbjct: 15306473 gcgccgatgaacggcccaacccagaagatcca 15306442



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||||||| || ||| ||||| |||||||| ||||||||||||||||||||||||| ||
Sbjct: 861 tgttgtagacgacggcggcgcccaggctcctggccgggttgatgccggtgccggtgacgg 802

                                
Query: 448 ggatggtggccaggtggacca 468
           |||||||||||||||||||||
Sbjct: 801 ggatggtggccaggtggacca 781



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score =  113 bits (57), Expect = 5e-22
 Identities = 135/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||| | |||||| |  ||||| |||||||| || || |||||||| ||||||||
Sbjct: 886 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 827

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| | |||  |||||||||| | ||| || |||| |||||||||||||||
Sbjct: 826 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 767

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||||||||||||| ||||| ||||||| ||| ||||
Sbjct: 766 gatgccggtgccggtgatcgggatagtggccaagtgcacca 726



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                         
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
             ||||||||| || ||| |||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 31234 tgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacgg 31175

                                  
Query: 448   ggatggtggccaggtggacca 468
             ||||||| |||||||| ||||
Sbjct: 31174 ggatggtcgccaggtgcacca 31154



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                         
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
             ||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 23354 tgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatcg 23295

                                  
Query: 448   ggatggtggccaggtggacca 468
             |||| || |||||||| ||||
Sbjct: 23294 ggatcgtcgccaggtgcacca 23274



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 73/81 (90%)
 Strand = Plus / Minus

                                                                         
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
             ||||| |||||| |||||| |||| |||||| |||||||||||||||||||||||||| |
Sbjct: 62592 tgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtgccggtgatcg 62533

                                  
Query: 448   ggatggtggccaggtggacca 468
             |||| || |||||||||||||
Sbjct: 62532 ggatcgtcgccaggtggacca 62512



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                         
Query: 406   cgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgga 465
             ||||||||||||| |||||||||||||||||||||||||| ||||| || |||||||| |
Sbjct: 13285 cgccgaggctcctggccgggttgatgccggtgccggtgatcgggatcgtcgccaggtgca 13226

                
Query: 466   cca 468
             |||
Sbjct: 13225 cca 13223



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 330   gcggcgccgatgaaggggccgacccagaagatcca 364
             |||||||||| ||| ||||||||||||||||||||
Sbjct: 62774 gcggcgccgacgaacgggccgacccagaagatcca 62740



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 336   ccgatgaaggggccgacccagaagatcca 364
             |||||||| || |||||||||||||||||
Sbjct: 23505 ccgatgaacggcccgacccagaagatcca 23477



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 333   gcgccgatgaaggggccgacccagaagatcca 364
             ||||||||||| || || ||||||||||||||
Sbjct: 13472 gcgccgatgaacggcccaacccagaagatcca 13441



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                          
Query: 388    tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
              ||||||||| || ||| |||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 110248 tgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacgg 110189

                                   
Query: 448    ggatggtggccaggtggacca 468
              ||||||| |||||||| ||||
Sbjct: 110188 ggatggtcgccaggtgcacca 110168



 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                          
Query: 388    tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
              ||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 102368 tgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatcg 102309

                                   
Query: 448    ggatggtggccaggtggacca 468
              |||| || |||||||| ||||
Sbjct: 102308 ggatcgtcgccaggtgcacca 102288



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                         
Query: 406   cgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgga 465
             ||||||||||||| |||||||||||||||||||||||||| ||||| || |||||||| |
Sbjct: 92299 cgccgaggctcctggccgggttgatgccggtgccggtgatcgggatcgtcgccaggtgca 92240

                
Query: 466   cca 468
             |||
Sbjct: 92239 cca 92237



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 336    ccgatgaaggggccgacccagaagatcca 364
              |||||||| || |||||||||||||||||
Sbjct: 102519 ccgatgaacggcccgacccagaagatcca 102491



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 333   gcgccgatgaaggggccgacccagaagatcca 364
             ||||||||||| || || ||||||||||||||
Sbjct: 92486 gcgccgatgaacggcccaacccagaagatcca 92455



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||||||| || ||| |||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 275 tgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacgg 216

                                
Query: 448 ggatggtggccaggtggacca 468
           ||||||| |||||||| ||||
Sbjct: 215 ggatggtcgccaggtgcacca 195



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  113 bits (57), Expect = 5e-22
 Identities = 135/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| | |||||| |||||||||||||| ||
Sbjct: 880 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatccattg 821

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| |||||||||| |  || |  || | |||||||||||||||
Sbjct: 820 gtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtt 761

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
            |||||||||||||||||||||||||||||||| |||||||
Sbjct: 760 aatgccggtgccggtgatggggatggtggccagatggacca 720



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score =  109 bits (55), Expect = 8e-21
 Identities = 154/187 (82%)
 Strand = Plus / Minus

                                                                       
Query: 282 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 341
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 936 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 877

                                                                       
Query: 342 aaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatg 401
           || || || |||||||| ||||| |||||   ||| |||||    |||||||||||||||
Sbjct: 876 aatggcccaacccagaatatccaatggtcattccatgcgtgggatctgttgtagatgatg 817

                                                                       
Query: 402 gccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccagg 461
           || || || |||||||| || ||||||||||||||||||||||| ||||| || |||| |
Sbjct: 816 gcagctcccaggctccttgcagggttgatgccggtgccggtgatcgggatcgtcgccaag 757

                  
Query: 462 tggacca 468
           || ||||
Sbjct: 756 tgcacca 750



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 101/118 (85%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           |||||||||||||| |||||   |||||| |  ||| ||||||||||||  || || || 
Sbjct: 865 acccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcggctccc 806

                                                                     
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||| |||||||||||||||||||||||||||||||| |||||||| ||||||| ||||
Sbjct: 805 aggatcctcgccgggttgatgccggtgccggtgatgcggatggtgtccaggtgcacca 748



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 101/118 (85%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           |||||||| |||||||||||   |||||| |||  | |||||||||||||||| ||||||
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                                                                     
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           || ||||| || ||||||||||| || ||||||| |||||||||||||| ||| ||||
Sbjct: 814 agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcacca 757



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683

                                                                    
Query: 412 ggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
            |||||  || ||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 682 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcacca 626



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 73/81 (90%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||||||||||  || || || | ||| |||||||||||||||||||||||||||||||
Sbjct: 388 tgttgtagatgacagcagctcccaagcttctcgccgggttgatgccggtgccggtgatgg 329

                                
Query: 448 ggatggtggccaggtggacca 468
           |||||||||| ||||||||||
Sbjct: 328 ggatggtggctaggtggacca 308



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  || || |||||||||||||| ||
Sbjct: 942 ctggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccattg 883

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||  ||||||||||||  || || || | ||| ||||| |||||
Sbjct: 882 gtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcggggtt 823

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 822 gatgccggtgccggtgatggggatggtggccaagtggacca 782



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 134/161 (83%), Gaps = 1/161 (0%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  || || |||||||||||||| ||
Sbjct: 854 ctggtggtaggcggcggcgatggcggcgccgatcagcggccccacccagaagatccattg 795

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||  ||||||||||||  || || || | ||| |||||||||||
Sbjct: 794 gtcatcccaggccttgtctttgttgtagatgacagcagctcccaagcttctcgccgggtt 735

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 734 gatgccggtgccggtgatggggatggtgg-caggtggacca 695



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669

                                                                    
Query: 412 ggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
            |||||  || ||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 668 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcacca 612



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782

                                                                    
Query: 412 ggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
            |||||  || ||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 781 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcacca 725



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776

                                                                    
Query: 412 ggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
            |||||  || ||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 775 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcacca 719



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770

                                                                    
Query: 412 ggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
            |||||  || ||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 769 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcacca 713



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  || || |||||||||||||| ||
Sbjct: 862 ctggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccattg 803

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||  ||||||||||||  || || || | ||| ||||| |||||
Sbjct: 802 gtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcggggtt 743

                                                    
Query: 428 gatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 742 gatgccggtgccggtgatggggatggtggccaagtggacca 702



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                         
Query: 389   gttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
             ||||||||||| ||| ||||||| |||||  || ||||||||||| ||||||||||||||
Sbjct: 91227 gttgtagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggg 91286

                                 
Query: 449   gatggtggccaggtggacca 468
             ||||||||||||||| ||||
Sbjct: 91287 gatggtggccaggtgcacca 91306



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 54/56 (96%)
 Strand = Plus / Minus

                                                                     
Query: 413   gctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
             ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||
Sbjct: 84387 gctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggacca 84332



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 308   ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
             ||||||||||  |||||| |  ||||||||||| | |||||| ||||||||||||||
Sbjct: 85054 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 84998



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 116/139 (83%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    |||||| | |||  ||
Sbjct: 467 gcggcgccgacgaacgggccgacccagaagatccattggttgtgccaggccttctcgttg 408

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgggg 449
           ||| |||||| |||||  |||  | |||| |||||||||||||||||||||||||| |||
Sbjct: 407 ttgaagatgacggccggtccggtggtcctggccgggttgatgccggtgccggtgatcggg 348

                              
Query: 450 atggtggccaggtggacca 468
           || || ||||| |||||||
Sbjct: 347 atcgtcgccagttggacca 329



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                         
Query: 393   tagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatg 452
             |||| |||||| ||||||||||| |  || ||||||||||||||||||||||||||||||
Sbjct: 29605 tagacgatggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatg 29546

                           
Query: 453   gtggccaggtggac 466
             ||||| ||||||||
Sbjct: 29545 gtggcgaggtggac 29532



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                         
Query: 280   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
             ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 29951 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 29892

                                      
Query: 340   tgaaggggccgacccagaagatcca 364
             |||| || || |||||||| |||||
Sbjct: 29891 tgaacggaccaacccagaaaatcca 29867



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 100/118 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           |||||||| |||||||||||   |||||| |||| | |||||||||||||||| ||||| 
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819

                                                                     
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           || || || || ||||||||||| || ||||||| |||||||||||||| ||| ||||
Sbjct: 818 agacttcttgctgggttgatgccagttccggtgacggggatggtggccaagtgcacca 761



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                        
Query: 393  tagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatg 452
            |||| |||||| ||||||||||| |  || ||||||||||||||||||||||||||||||
Sbjct: 4559 tagacgatggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatg 4500

                          
Query: 453  gtggccaggtggac 466
            ||||| ||||||||
Sbjct: 4499 gtggcgaggtggac 4486



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 4906 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 4847

                                     
Query: 340  tgaaggggccgacccagaagatcca 364
            |||| || || |||||||| |||||
Sbjct: 4846 tgaacggaccaacccagaaaatcca 4822



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 100/118 (84%)
 Strand = Plus / Minus

                                                                        
Query: 351  acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
            |||||||| | |||||||||   |||||| |||| | |||||||||||||||| ||||| 
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956

                                                                      
Query: 411  aggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
            || ||||| || ||||||||||| || ||||||| |||||||||||||| ||| ||||
Sbjct: 955  agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcacca 898



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 gttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
           |||||||| || ||| ||||||| |||||||||||| |||||||| ||||||||||| ||
Sbjct: 588 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 529

                               
Query: 449 gatggtggccaggtggacca 468
           ||||||||| ||||| ||||
Sbjct: 528 gatggtggcgaggtgcacca 509



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| || || ||||||||||| | |||||||||||  ||||| || || || || |
Sbjct: 931 tcttgaaaggaatggctctgatgactatctggtggtagacagcggcaagagcagctccaa 872

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| ||||| ||||||||||||||||||||   ||| || || ||  ||||| ||||||
Sbjct: 871 tgaaagggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatga 812

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||| || || || ||||| |||||||| ||||| || || || ||||||||||| ||||
Sbjct: 811 tggcggctccaagactccttgccgggttaatgccagttccagttatggggatggtagcca 752



to top

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
             sequence
          Length = 178692

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 389   gttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
             |||||||| || ||| ||||||| |||||||||||| |||||||| ||||||||||| ||
Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712

                                 
Query: 449   gatggtggccaggtggacca 468
             ||||||||| ||||| ||||
Sbjct: 47713 gatggtggcgaggtgcacca 47732



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| |||||||| || | ||||||||| | ||| || || || || || ||
Sbjct: 911 cttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctccaat 852

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           |||||| || |||||||| |||||   |||   |||||| |||||  ||||||||| |||
Sbjct: 851 gaagggtccaacccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgat 792

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 460
           ||| || || || ||||| || |||||||||||||| || |||||||||||||| |||||
Sbjct: 791 ggcggcccccagactcctagcagggttgatgccggttccagtgatggggatggttgccag 732



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                            
Query: 389      gttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
                |||||||| || ||| ||||||| |||||||||||| |||||||| ||||||||||| ||
Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919

                                    
Query: 449      gatggtggccaggtggacca 468
                ||||||||| ||||| ||||
Sbjct: 17626918 gatggtggcgaggtgcacca 17626899



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 gttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
           |||||||| || ||| ||||||| |||||||||||| |||||||| ||||||||||| ||
Sbjct: 770 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 711

                               
Query: 449 gatggtggccaggtggacca 468
           ||||||||| ||||| ||||
Sbjct: 710 gatggtggcgaggtgcacca 691



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                            
Query: 389      gttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
                |||||||| || ||| ||||||| |||||||||||| |||||||| ||||||||||| ||
Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959

                                    
Query: 449      gatggtggccaggtggacca 468
                ||||||||| ||||| ||||
Sbjct: 17635958 gatggtggcgaggtgcacca 17635939



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 406 cgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgga 465
           ||||||||||||| |||||||||||||||||||||||||| ||||| || |||||||| |
Sbjct: 803 cgccgaggctcctggccgggttgatgccggtgccggtgatcgggatcgtcgccaggtgca 744

              
Query: 466 cca 468
           |||
Sbjct: 743 cca 741



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 333
           ||||| ||||||||||||| |||||||| ||||||   ||||| |  || ||||  || |
Sbjct: 847 acttgttcttgaatgggatagctctgatcaccaccacatggtacagagctgccaatgctg 788

                                                                       
Query: 334 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 393
           |||| ||||| || || ||||||||||||||||||||   ||||||||| ||||||||||
Sbjct: 787 cgccaatgaatggtccaacccagaagatccagtggtcatcccaggcgtggtccctgttgt 728

                  
Query: 394 agatgat 400
           |||||||
Sbjct: 727 agatgat 721



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 406 cgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgga 465
           ||||||||||||| |||||||||||||||||||||||||| ||||| || |||||||| |
Sbjct: 803 cgccgaggctcctggccgggttgatgccggtgccggtgatcgggatcgtcgccaggtgca 744

              
Query: 466 cca 468
           |||
Sbjct: 743 cca 741



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 156/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 788

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
           ||||||||| || ||||| ||||| |||||||| ||||| || || || || ||||||||
Sbjct: 787 gatgatggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggt 728

                         
Query: 455 ggccaggtggacca 468
            |||| ||| ||||
Sbjct: 727 agccaagtgcacca 714



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 156/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 858 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 799

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 798 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 739

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
           ||||||||| || ||||| ||||| |||||||| ||||| || || || || ||||||||
Sbjct: 738 gatgatggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggt 679

                         
Query: 455 ggccaggtggacca 468
            |||| ||| ||||
Sbjct: 678 agccaagtgcacca 665



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 156/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 788

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
           ||||||||| || ||||| ||||| |||||||| ||||| || || || || ||||||||
Sbjct: 787 gatgatggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggt 728

                         
Query: 455 ggccaggtggacca 468
            |||| ||| ||||
Sbjct: 727 agccaagtgcacca 714



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 113/134 (84%), Gaps = 2/134 (1%)
 Strand = Plus / Minus

                                                                       
Query: 336 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgt-gctccctgttgta 394
           |||||||| ||||| |||||||||||||| |||||   |||||| | |||   |||||||
Sbjct: 872 ccgatgaacgggcccacccagaagatccactggtcgctccaggctttgctgt-tgttgta 814

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
            | || ||| |||||||||||||||||||||||||| |||||||| ||||| ||||| ||
Sbjct: 813 cacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtgatcgggatcgt 754

                         
Query: 455 ggccaggtggacca 468
            |||||||| ||||
Sbjct: 753 cgccaggtgcacca 740



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 156/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 231 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 172

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 171 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 112

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
           ||||||||| || ||||| ||||| |||||||| ||||| || || || || ||||||||
Sbjct: 111 gatgatggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggt 52

                         
Query: 455 ggccaggtggacca 468
            |||| ||| ||||
Sbjct: 51  agccaagtgcacca 38



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 156/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 490 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 431

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 430 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 371

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
           ||||||||| || ||||| ||||| |||||||| ||||| || || || || ||||||||
Sbjct: 370 gatgatggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggt 311

                         
Query: 455 ggccaggtggacca 468
            |||| ||| ||||
Sbjct: 310 agccaagtgcacca 297



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 156/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 871 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 812

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 811 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 752

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
           ||||||||| || ||||| ||||| |||||||| ||||| || || || || ||||||||
Sbjct: 751 gatgatggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggt 692

                         
Query: 455 ggccaggtggacca 468
            |||| ||| ||||
Sbjct: 691 agccaagtgcacca 678



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 156/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 905 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 846

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 845 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 786

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
           ||||||||| || ||||| ||||| |||||||| ||||| || || || || ||||||||
Sbjct: 785 gatgatggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggt 726

                         
Query: 455 ggccaggtggacca 468
            |||| ||| ||||
Sbjct: 725 agccaagtgcacca 712



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 54/58 (93%)
 Strand = Plus / Minus

                                                                     
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||| |||||||||||||| |||||||||| |||||||||||||||||| ||||
Sbjct: 128 aggctccttgccgggttgatgcccgtgccggtgacggggatggtggccaggtgcacca 71



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtg 367
           |||||||||||||  |||||||||||||| ||||||||
Sbjct: 209 gcggcgccgatgagtgggccgacccagaatatccagtg 172



to top

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 92/109 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||||||||||||||||||   ||| || |||||   |||||||||||| || || || 
Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 795

                                                            
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           || ||||| || ||||||||||| || ||||||||||||||||||||||
Sbjct: 794 agactcctggcggggttgatgccagttccggtgatggggatggtggcca 746



to top

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 92/109 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||||||||||||||||||   ||| || |||||   |||||||||||| || || || 
Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 735

                                                            
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           || ||||| || ||||||||||| || ||||||||||||||||||||||
Sbjct: 734 agactcctggcggggttgatgccagttccggtgatggggatggtggcca 686



to top

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 92/109 (84%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||||||||||||||||||   ||| || |||||   |||||||||||| || || || 
Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 546

                                                            
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           || ||||| || ||||||||||| || ||||||||||||||||||||||
Sbjct: 545 agactcctggcggggttgatgccagttccggtgatggggatggtggcca 497



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 395
           ||||||||||| || |||||||| ||||| || ||   |||||| || ||| ||||||||
Sbjct: 473 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 414

                                                                       
Query: 396 atgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtg 455
           ||||| || || || |||||||| || |||||||| ||||| || ||||| |||||||||
Sbjct: 413 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattgggatggtg 354

               
Query: 456 gcca 459
           ||||
Sbjct: 353 gcca 350



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 395
           ||||||||||| || |||||||| ||||| || ||   |||||| || ||| ||||||||
Sbjct: 803 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 744

                                                                       
Query: 396 atgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtg 455
           ||||| || || || |||||||| || |||||||| ||||| || ||||| |||||||||
Sbjct: 743 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattgggatggtg 684

               
Query: 456 gcca 459
           ||||
Sbjct: 683 gcca 680



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 129/159 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 163 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 104

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 103 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 44

                                                  
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgcc 433
           ||||||||| || ||||| ||||| |||||||| |||||
Sbjct: 43  gatgatggcagctccgagactcctggccgggttaatgcc 5



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                           
Query: 405      gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtg 463
                ||||||||||||||||||||||||||||| ||||||||||| || || || ||||||||
Sbjct: 21009482 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 21009424



to top

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                         
Query: 405    gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtg 463
              ||||||||||||||||||||||||||||| ||||||||||| || || || ||||||||
Sbjct: 101571 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 101513



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 405 gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtg 463
           ||||||||||||||||||||||||||||| ||||||||||| || || || ||||||||
Sbjct: 744 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 686



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 351 acccagaagatccagtggtct 371
           |||||||||||||||||||||
Sbjct: 798 acccagaagatccagtggtct 778



to top

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 405 gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtg 463
           ||||||||||||||||||||||||||||| ||||||||||| || || || ||||||||
Sbjct: 642 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 584



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 405 gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtg 463
           ||||||||||||||||||||||||||||| ||||||||||| || || || ||||||||
Sbjct: 742 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 684



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 351 acccagaagatccagtggtct 371
           |||||||||||||||||||||
Sbjct: 796 acccagaagatccagtggtct 776



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 405 gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtg 463
           ||||||||||||||||||||||||||||| ||||||||||| || || || ||||||||
Sbjct: 737 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 679



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 351 acccagaagatccagtggtct 371
           |||||||||||||||||||||
Sbjct: 791 acccagaagatccagtggtct 771



to top

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                        
Query: 405   gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtg 463
             ||||||||||||||||||||||||||||| ||||||||||| || || || ||||||||
Sbjct: 30782 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 30724



to top

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaacca 733



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||||||
Sbjct: 832 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 773

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           ||||| || ||||| ||||| |||||||| ||||| || || || || |||||||| |||
Sbjct: 772 atggcagctccgagactcctggccgggttaatgccagttccagtaattgggatggtagcc 713

                     
Query: 459 aggtggacca 468
           | ||| ||||
Sbjct: 712 aagtgcacca 703



to top

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaacca 733



to top

>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3
           (PIP1-3) mRNA, complete cds
          Length = 1159

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 151/189 (79%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 909 tcttgaatggaatggctctgatgactatctgatggtacatggcagcaagagcagctccaa 850

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || ||||||||||||||   |||   ||| || ||||| |||||| ||||||
Sbjct: 849 tgaaaggtcccacccagaagatccacatgtcatcccatgcatgctctctgttgaagatga 790

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           | || || || || ||||| || ||||| ||||| || || |||||||||||||||||||
Sbjct: 789 tagcagctccaagactcctggctgggttaatgccagttcctgtgatggggatggtggcca 730

                    
Query: 460 ggtggacca 468
            ||| ||||
Sbjct: 729 agtgaacca 721



to top

>gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1b) mRNA, complete cds
          Length = 1119

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 151/189 (79%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 910 tcttgaatggaatggctctgatgactatctgctggtacatggcagcaagagcagctccaa 851

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || ||||||||||||||   |||   ||| || ||||| |||||| ||||||
Sbjct: 850 tgaacggtcccacccagaagatccacatgtcatcccatgcatgctctctgttgaagatga 791

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           | || || || || ||||| || ||||| ||||| || || |||||||||||||||||||
Sbjct: 790 tagcagctccaagactcctggctgggttaatgccagttcctgtgatggggatggtggcca 731

                    
Query: 460 ggtggacca 468
            ||| ||||
Sbjct: 730 agtgaacca 722



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                       
Query: 408 ccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacc 467
           ||||| ||||| |||||||||||||||||||||||||  ||||||||||||| ||| |||
Sbjct: 757 ccgagactcctggccgggttgatgccggtgccggtgactgggatggtggccaagtgaacc 698

            
Query: 468 a 468
           |
Sbjct: 697 a 697



to top

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||| |||||||||| || ||||| || |  || |||||||||||||| ||||||||||
Sbjct: 809 tgttgaagatgatggcggctccgagacttcgagctgggttgatgccggttccggtgatgg 750

                                
Query: 448 ggatggtggccaggtggacca 468
           |||||||||||| ||| ||||
Sbjct: 749 ggatggtggccaagtgaacca 729



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 109/133 (81%)
 Strand = Plus / Minus

                                                                       
Query: 336 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 395
           ||||||||||| || |||||||| |||||||| ||   ||| |||||  || ||||| ||
Sbjct: 820 ccgatgaagggtccaacccagaaaatccagtgatcatcccaagcgtggcccttgttgaag 761

                                                                       
Query: 396 atgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtg 455
           ||||| || || ||||| ||||| || |||||||||||||| || ||||| |||||||| 
Sbjct: 760 atgatagcagcaccgagactccttgctgggttgatgccggttccagtgattgggatggtt 701

                        
Query: 456 gccaggtggacca 468
           |||| ||| ||||
Sbjct: 700 gccaagtgaacca 688



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 413 gctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||| |||||||||||||||||||||||||| ||||| ||||||| ||| ||||
Sbjct: 711 gctccttgccgggttgatgccggtgccggtgatcgggatcgtggccaagtgaacca 656



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||||| ||| || |||||||||||||||||
Sbjct: 816 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatccagtg 757

              
Query: 368 gtc 370
           |||
Sbjct: 756 gtc 754



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 138/172 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 881 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 822

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 821 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 762

                                                               
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatg 452
            || || || || ||||| || |||||||| || || |||||||| ||||||
Sbjct: 761 tgcagctccaagactcctagctgggttgattcctgttccggtgattgggatg 710



to top

>emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major intrinsic protein PIPa2
          Length = 1189

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 120/148 (81%)
 Strand = Plus / Minus

                                                                       
Query: 321 gcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcg 380
           ||||| ||||| ||||||||||| || |||||||| || | |||||||||   ||| |||
Sbjct: 880 gcggcgagcgctgcgccgatgaatggtccgacccaaaatacccagtggtcgtgccacgcg 821

                                                                       
Query: 381 tgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccg 440
            | ||   |||||| |||||||| ||||||||||||||||||||||| || || || || 
Sbjct: 820 cggtcgtggttgtatatgatggcggcgccgaggctcctcgccgggttaatcccagtccct 761

                                       
Query: 441 gtgatggggatggtggccaggtggacca 468
           ||||| || || ||||||| ||| ||||
Sbjct: 760 gtgattggaatcgtggccaagtgcacca 733



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 413    gctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
              |||||| |||||||||||||||||||||||||| ||||| ||||||| ||| ||||
Sbjct: 108521 gctccttgccgggttgatgccggtgccggtgatcgggatcgtggccaagtgaacca 108466



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                       
Query: 308    ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
              ||||||||||  |||||| |  ||||||||||||| ||| || ||||||||||||||
Sbjct: 109135 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 109079



to top

>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 282 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 341
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 176 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 117

                                                                       
Query: 342 aaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatg 401
           || || || |||||||| ||||| |||||   ||| || ||    |||||||||||||| 
Sbjct: 116 aatggcccaacccagaaaatccaatggtcatcccatgcatgacttctgttgtagatgata 57

                                              
Query: 402 gccgcgccgaggctcctcgccgggttgatgccggt 436
           || || ||||||||||  || ||||||||||||||
Sbjct: 56  gcagctccgaggctccgagcagggttgatgccggt 22



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 151/189 (79%), Gaps = 3/189 (1%)
 Strand = Plus / Minus

                                                                       
Query: 278 ggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgcc 337
           |||||||||||| || ||||||||||| | |||||||||||| || || || || || ||
Sbjct: 874 ggtcttgaatggaattgctctgatgactatctggtggtagattgcagcaagggcagctcc 815

                                                                       
Query: 338 gatgaaggggccgacccagaagatcca---gtggtctgaccaggcgtgctccctgttgta 394
            |||||||| || |||||||||| |||    |||||   ||| || |||| | |||||||
Sbjct: 814 aatgaagggaccaacccagaagacccaatgatggtcatcccaagcatgctgcttgttgta 755

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
            |||| ||| || || |  || || || ||||||||||| ||||| ||||||||||||||
Sbjct: 754 aatgacggcagctccaaaacttctggctgggttgatgccagtgccagtgatggggatggt 695

                    
Query: 455 ggccaggtg 463
           ||| |||||
Sbjct: 694 ggcaaggtg 686



to top

>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA,
           complete cds
          Length = 1179

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| || ||||||||||||||||| |||||||||||||||||||
Sbjct: 808 ctcctagcagggttgatgccggtgccagtgatggggatggtggcca 763



to top

>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipE) mRNA, partial cds
          Length = 963

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| || ||||||||||||||||| |||||||||||||||||||
Sbjct: 592 ctcctagcagggttgatgccggtgccagtgatggggatggtggcca 547



to top

>ref|XM_470514.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 843

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtg 463
           ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 656 gggttgatgccagtgccggtgatggggatggtggcaaggtg 616



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
           |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 755 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 706



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                         
Query: 423      gggttgatgccggtgccggtgatggggatggtggccaggtg 463
                ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 36057500 gggttgatgccagtgccggtgatggggatggtggcaaggtg 36057460



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                  
Query: 330      gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
                |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 36057599 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 36057550



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 433      cggtgccggtgatggggatgg 453
                |||||||||||||||||||||
Sbjct: 31953543 cggtgccggtgatggggatgg 31953523



to top

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||||||||||| || |  || || ||||| || |||||||| ||||||||||| ||||
Sbjct: 784 tgttgtagatgatagcggtaccaagactcctagcagggttgataccggtgccggtaatgg 725

                                
Query: 448 ggatggtggccaggtggacca 468
           |||||||||||| ||| ||||
Sbjct: 724 ggatggtggccaagtgaacca 704



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 351 acccagaagatccagtggtc 370
           ||||||||||||||||||||
Sbjct: 824 acccagaagatccagtggtc 805



to top

>emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1
          Length = 1204

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 90/109 (82%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||| ||||||||||||||   ||| || || ||  ||||||||||||| || || || 
Sbjct: 854 acccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatgatcgcagctcca 795

                                                            
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           || ||||| || ||||||||||| || ||||||||||| ||||||||||
Sbjct: 794 agactcctagcggggttgatgccagttccggtgatgggaatggtggcca 746



to top

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 90/109 (82%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||| ||||||||||||||   |||||| || || |  ||||| || ||||| || || 
Sbjct: 440 acccaaaagatccagtggtcatcccaggcatggtctcgattgtaaataatggctgctcca 381

                                                            
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||||||| || ||||||||||| ||||||||||| || ||||||||||
Sbjct: 380 aggctcctggcagggttgatgccagtgccggtgataggtatggtggcca 332



to top

>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete
              sequence
          Length = 164179

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                       
Query: 423    gggttgatgccggtgccggtgatggggatggtggccaggtg 463
              ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 119011 gggttgatgccagtgccggtgatggggatggtggcaaggtg 118971



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 330    gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
              |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 119110 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 119061



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                         
Query: 423      gggttgatgccggtgccggtgatggggatggtggccaggtg 463
                ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 36147574 gggttgatgccagtgccggtgatggggatggtggcaaggtg 36147534



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                  
Query: 330      gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
                |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 36147673 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 36147624



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 433      cggtgccggtgatggggatgg 453
                |||||||||||||||||||||
Sbjct: 32044055 cggtgccggtgatggggatgg 32044035



to top

>dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-B04, full
           insert sequence
          Length = 1099

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtg 463
           ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 744 gggttgatgccagtgccggtgatggggatggtggcaaggtg 704



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
           |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 843 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 794



to top

>gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, complete cds
          Length = 1158

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 90/109 (82%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||| ||||||||||||||   ||| || || ||  ||||||||||||| || || || 
Sbjct: 854 acccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatgatcgcagctcca 795

                                                            
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           || ||||| || ||||||||||| || ||||||||||| ||||||||||
Sbjct: 794 agactcctagcggggttgatgccagttccggtgatgggaatggtggcca 746



to top

>gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, complete cds
          Length = 1278

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 108/133 (81%)
 Strand = Plus / Minus

                                                                        
Query: 336  ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 395
            ||||||||||| || |||||||| ||||| ||||| | ||| || ||   ||||||||| 
Sbjct: 1012 ccgatgaagggtcccacccagaaaatccaatggtcagcccaagcatggggcctgttgtaa 953

                                                                        
Query: 396  atgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtg 455
            ||||| || || || || ||||| || ||||||||||| ||||| || | ||||||||||
Sbjct: 952  atgatagcagcaccaagactcctggctgggttgatgccagtgccagtaacggggatggtg 893

                         
Query: 456  gccaggtggacca 468
            |||| ||| ||||
Sbjct: 892  gccaagtgaacca 880



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 413 gctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||| || ||||||||||| || |||||||||||||||||||| ||||| ||||
Sbjct: 781 gctcctagcagggttgatgccagttccggtgatggggatggtggcaaggtgaacca 726



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 149/188 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| ||||||||||| | |  |||||| |  || || ||||| || |||||
Sbjct: 867 cttgaatgggatggctctgatgactatcacgtggtaaagagcagcaagcgcagcaccgat 808

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || |||||||| |||| ||| |||||   ||| ||||  ||| ||||| |||||||
Sbjct: 807 gaatggtccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgat 748

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 460
           ||| || || || ||||| || |||||||| || || || || ||||||||||| || | 
Sbjct: 747 ggcagctccaagactccttgctgggttgattccagttccagtaatggggatggttgctaa 688

                   
Query: 461 gtggacca 468
           ||||||||
Sbjct: 687 gtggacca 680



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 149/188 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| ||||||||||| | |  |||||| |  || || || || || |||||
Sbjct: 885 cttgaatgggatggctctgatgacgatcacgtggtacagagcagcaagtgcagcaccgat 826

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || || |||||||||| ||| |||||   ||| ||||  ||| ||||| |||||||
Sbjct: 825 gaatggtccaacccagaagacccaatggtcatcccaagcgttgtccttgttgaagatgat 766

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 460
           ||| || || || || || || |||||||| || || || |||||||||||||| |||| 
Sbjct: 765 ggcagcaccaagacttcttgctgggttgattccagttccagtgatggggatggttgccaa 706

                   
Query: 461 gtggacca 468
           ||||||||
Sbjct: 705 gtggacca 698



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 149/188 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| |||||||| || ||||||||||| |  || ||||| || || || | 
Sbjct: 937 cttgaatgggatggctctgatcacaacctggtggtacagtgcagccagtgctgccccaac 878

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
            || || || |||||||||||||| || ||   ||| ||||| ||  |||||||||||||
Sbjct: 877 aaatggtccaacccagaagatccaatgatcattccatgcgtgttcattgttgtagatgat 818

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 460
           ||| || ||||| || |  |||||||| || || ||||||||||| || ||||| |||| 
Sbjct: 817 ggctgcaccgagacttcgggccgggttaatacccgtgccggtgatcggaatggtagccaa 758

                   
Query: 461 gtggacca 468
           ||| ||||
Sbjct: 757 gtgcacca 750



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 146/184 (79%)
 Strand = Plus / Minus

                                                                       
Query: 276 ttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcg 335
           |||||||||||||| || ||||||||||  | ||||||||| |  || || || || || 
Sbjct: 890 ttggtcttgaatggaatggctctgatgattatctggtggtaaactgcagcgagagcagct 831

                                                                       
Query: 336 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 395
           || ||||| || || ||||||||||||||||| ||   ||| || || ||   |||| ||
Sbjct: 830 ccaatgaatggtccaacccagaagatccagtgatcatcccatgcctggtcgtggttgaag 771

                                                                       
Query: 396 atgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtg 455
           ||||| || || || |||||||  || |||||||||||||| || ||||| |||||||||
Sbjct: 770 atgatagcagctccaaggctccgggcggggttgatgccggttccagtgatagggatggtg 711

               
Query: 456 gcca 459
           ||||
Sbjct: 710 gcca 707



to top

>dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane intrinsic protein,
           complete cds
          Length = 1145

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           |||||||||||||||| || || ||||| || || ||||||||||| ||||| || ||||
Sbjct: 844 tgttgtagatgatggcagccccaaggcttctagcagggttgatgccagtgcctgtaatgg 785

                              
Query: 448 ggatggtggccaggtggac 466
           | |||||||| || |||||
Sbjct: 784 gaatggtggcaagatggac 766



to top

>dbj|AB002148.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1116

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 389 gttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
           |||||||||||| || || || || ||||| || ||||||||||| || |||||||||||
Sbjct: 809 gttgtagatgatcgcagctccaagactcctagcggggttgatgccagttccggtgatggg 750

                      
Query: 449 gatggtggcca 459
            ||||||||||
Sbjct: 749 aatggtggcca 739



to top

>ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G61430 (PIP1A) mRNA,
           complete cds
          Length = 1254

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 974 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 915

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||
Sbjct: 914 attgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcc 855

                     
Query: 459 aggtggacca 468
           | ||| ||||
Sbjct: 854 aagtgaacca 845



to top

>gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA
          Length = 1082

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| || ||||||||||| || ||||||||||||||||||||||
Sbjct: 775 ctcctggcggggttgatgccagttccggtgatggggatggtggcca 730



to top

>gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrinsic protein (PIP1)
           mRNA, complete cds
          Length = 1268

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatg 446
           ||||||||||||||||| |  || || ||||| || |||||||| |||||||| || | |
Sbjct: 825 ctgttgtagatgatggcagtaccaagactcctagcagggttgataccggtgccagtaacg 766

                                 
Query: 447 gggatggtggccaggtggacca 468
           ||||||||||||| ||| ||||
Sbjct: 765 gggatggtggccaagtgaacca 744



to top

>emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)
          Length = 995

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 878 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 819

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||
Sbjct: 818 attgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcc 759

                     
Query: 459 aggtggacca 468
           | ||| ||||
Sbjct: 758 aagtgaacca 749



to top

>emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial
          Length = 1051

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||| ||||| |||||||||||||||||||||| ||| ||||
Sbjct: 714 gggttgataccggttccggtgatggggatggtggccaagtgtacca 669



to top

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgat 445
           ||||| |||| | ||| ||||||| ||||||||||||||| || ||||||||||||||
Sbjct: 464 tgttgaagatcacggcggcgccgaagctcctcgccgggttaatcccggtgccggtgat 407



to top

>gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 861

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 791 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 732

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||
Sbjct: 731 attgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcc 672

                     
Query: 459 aggtggacca 468
           | ||| ||||
Sbjct: 671 aagtgaacca 662



to top

>gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 1092

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 858 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 799

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||
Sbjct: 798 attgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcc 739

                     
Query: 459 aggtggacca 468
           | ||| ||||
Sbjct: 738 aagtgaacca 729



to top

>emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1059

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 837 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 778

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||
Sbjct: 777 attgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcc 718

                     
Query: 459 aggtggacca 468
           | ||| ||||
Sbjct: 717 aagtgaacca 708



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||| || ||||||||||| ||||| |||||   |||||| |  ||  |||| ||||||
Sbjct: 780 atgaatggtccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatg 721

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           |  || || |||| ||| || ||||||||||| ||||||||||||||||| || || |||
Sbjct: 720 acagcagctccgaagcttctagccgggttgataccggtgccggtgatgggaattgttgcc 661

                     
Query: 459 aggtggacca 468
           ||||| ||||
Sbjct: 660 aggtgaacca 651



to top

>gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mRNA, complete cds
          Length = 1136

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 93/114 (81%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           |||||||| ||||| |||||   ||| || || |||||||||||||| ||||| || || 
Sbjct: 844 acccagaaaatccattggtcatcccatgcatggtccctgttgtagataatggcagctcca 785

                                                                 
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgg 464
           || ||||| || ||||| ||||| || || |||||||| |||||||||| ||||
Sbjct: 784 agactcctagcagggttaatgccagttcctgtgatgggaatggtggccaagtgg 731



to top

>gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete sequence
          Length = 1234

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 974 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 915

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||
Sbjct: 914 attgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcc 855

                     
Query: 459 aggtggacca 468
           | ||| ||||
Sbjct: 854 aagtgaacca 845



to top

>gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA, complete cds
          Length = 920

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 837 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 778

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||
Sbjct: 777 attgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcc 718

                     
Query: 459 aggtggacca 468
           | ||| ||||
Sbjct: 717 aagtgaacca 708



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||||| |||||||| ||||| ||||||||||||||||| ||||
Sbjct: 741 gggttgattccggtgcctgtgattgggatggtggccaggtgaacca 696



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||||||||||| ||||||||||| ||||||||||||| ||| ||||
Sbjct: 766 gggttgatgccagtgccggtgattgggatggtggccaagtgaacca 721



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||||||||||| ||||||||||| ||||||||||||| ||| ||||
Sbjct: 282 gggttgatgccagtgccggtgattgggatggtggccaagtgaacca 237



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 131/165 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 975 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 916

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 915 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 856

                                                        
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgat 445
            || || || || ||||| || ||||| || || || ||||||||
Sbjct: 855 tgcagctccaagactcctagctgggttaattcctgttccggtgat 811



to top

>emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protein (pm28b gene)
          Length = 913

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggaccagg 470
           ||||| || |||||||| ||||| || ||||||||||||||||||| ||| ||||||
Sbjct: 746 ctcctggctgggttgattccggtacctgtgatggggatggtggccaagtgaaccagg 690



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 131/165 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 862 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 803

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 802 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 743

                                                        
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgat 445
            || || || || ||||| || ||||| || || || ||||||||
Sbjct: 742 tgcagctccaagactcctagctgggttaattcctgttccggtgat 698



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                         
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
             |||||||||||||||| || ||||| ||||| |||||||| ||||| || || || || |
Sbjct: 75485 tgttgtagatgatggcagctccgagactcctggccgggttaatgccagttccagtaattg 75426

                                  
Query: 448   ggatggtggccaggtggacca 468
             ||||||| |||| ||| ||||
Sbjct: 75425 ggatggtagccaagtgcacca 75405



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                         
Query: 275   cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
             ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 75731 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 75672

                                           
Query: 335   gccgatgaaggggccgacccagaagatcca 364
              || ||||| || |||||||||||||||||
Sbjct: 75671 accaatgaatggaccgacccagaagatcca 75642



to top

>emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BAC clone F2A19
          Length = 95993

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                         
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
             ||||||||||||| || || || ||||| || || ||||||||||| ||||| ||||| |
Sbjct: 29041 tgttgtagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattg 28982

                                  
Query: 448   ggatggtggccaggtggacca 468
             ||||||| |||| ||| ||||
Sbjct: 28981 ggatggttgccaagtgaacca 28961



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                         
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
             |||||||||||||||| || ||||| ||||| |||||||| ||||| || || || || |
Sbjct: 33953 tgttgtagatgatggcagctccgagactcctggccgggttaatgccagttccagtaattg 33894

                                  
Query: 448   ggatggtggccaggtggacca 468
             ||||||| |||| ||| ||||
Sbjct: 33893 ggatggtagccaagtgcacca 33873



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                         
Query: 275   cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
             ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 34199 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 34140

                                           
Query: 335   gccgatgaaggggccgacccagaagatcca 364
              || ||||| || |||||||||||||||||
Sbjct: 34139 accaatgaatggaccgacccagaagatcca 34110



to top

>emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for putative aquaporin, exon 1
          Length = 880

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtg 463
           ||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 704 gggttgatgccagtgccagtgatggggatggtggcaaggtg 664



to top

>gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRNA, complete cds
          Length = 1108

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 405 gcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggc 457
           ||||| || ||||| ||||||||||| |||||||||||||| || ||||||||
Sbjct: 726 gcgccaagactcctagccgggttgattccggtgccggtgatcggaatggtggc 674



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 131/165 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 903 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 844

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 843 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 784

                                                        
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgat 445
            || || || || ||||| || ||||| || || || ||||||||
Sbjct: 783 tgcagctccaagactcctagctgggttaattcctgttccggtgat 739



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 131/165 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 730

                                                        
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgat 445
            || || || || ||||| || ||||| || || || ||||||||
Sbjct: 729 tgcagctccaagactcctagctgggttaattcctgttccggtgat 685



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 131/165 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 893 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 834

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 833 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 774

                                                        
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgat 445
            || || || || ||||| || ||||| || || || ||||||||
Sbjct: 773 tgcagctccaagactcctagctgggttaattcctgttccggtgat 729



to top

>emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH79ZH01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 98/121 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 729 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 670

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||
Sbjct: 669 attgcagctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgcc 610

            
Query: 459 a 459
           |
Sbjct: 609 a 609



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 131/165 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 730

                                                        
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgat 445
            || || || || ||||| || ||||| || || || ||||||||
Sbjct: 729 tgcagctccaagactcctagctgggttaattcctgttccggtgat 685



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 89/109 (81%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||||||||||||||||||   ||| || |  ||  ||||||||||||| || || || 
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766

                                                            
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           || ||||| || |||||||| || || |||||||| |||||||||||||
Sbjct: 765 agactcctggcagggttgataccagttccggtgattgggatggtggcca 717



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 792 gcggcgccgatgaacgggccaacccagaagatccactggtc 752



to top

>dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT06I17, TM0017,
             complete sequence
          Length = 121127

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                         
Query: 408   ccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacc 467
             |||| |||||| || ||||| |||||||| || |||||||| |||||||||||||| |||
Sbjct: 35085 ccgaagctccttgcagggttaatgccggtaccagtgatgggtatggtggccaggtgaacc 35026

              
Query: 468   a 468
             |
Sbjct: 35025 a 35025



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 460
           |||||| ||||  ||||||||||||||||| ||||| |||||||| || || ||||| ||
Sbjct: 775 ggccgccccgaaactcctcgccgggttgattccggtaccggtgatcggaatagtggcaag 716

                   
Query: 461 gtggacca 468
           ||| ||||
Sbjct: 715 gtgaacca 708



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||||||||||| || || || || ||||| || |||||||| || || |||||||| |
Sbjct: 778 tgttgtagatgatagcagctccaagactcctggcagggttgataccagttccggtgattg 719

                       
Query: 448 ggatggtggcca 459
           ||||||||||||
Sbjct: 718 ggatggtggcca 707



to top

>gb|DQ018114.1| Physcomitrella patens plasma membrane aquaporin (PIP1;1) gene,
           complete cds
          Length = 1151

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtggaccagg 470
           ||||||||||| || ||||||||||| |||||||||| ||| ||||||
Sbjct: 837 gggttgatgccagttccggtgatgggaatggtggccaagtgcaccagg 790



to top

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 460
           |||||| ||||  ||||||||||||||||| ||||| |||||||| || || ||||| ||
Sbjct: 741 ggccgccccgaaactcctcgccgggttgattccggtaccggtgattggaatagtggcaag 682

                   
Query: 461 gtggacca 468
           ||| ||||
Sbjct: 681 gtgaacca 674



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 148/188 (78%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| ||||||||||| | |  |||||| |  || || || || || |||||
Sbjct: 886 cttgaatgggatggctctgatgacgatcacgtggtacagagcagcaagtgcagcaccgat 827

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || || |||||||||| ||| |||||   ||| ||||  ||| ||||  |||||||
Sbjct: 826 gaatggtccaacccagaagacccaatggtcatcccaagcgttgtccttgttcaagatgat 767

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 460
           ||| || || || || || || |||||||| || || || |||||||||||||| |||| 
Sbjct: 766 ggcagcaccaagacttcttgctgggttgattccagttccagtgatggggatggttgccaa 707

                   
Query: 461 gtggacca 468
           ||||||||
Sbjct: 706 gtggacca 699



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 413 gctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           |||||| ||||||||||| || || |||||||| ||||| ||||||||||| ||||
Sbjct: 744 gctcctagccgggttgataccagttccggtgattgggatagtggccaggtgaacca 689



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           ||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 827 gcggccccaatgaaaggcccgacccagaagatccaatggtc 787



to top

>gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (PIP1;1) mRNA, complete cds
          Length = 1160

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           |||||||||||||||| || || || ||||| || ||||| ||||| || || |||||||
Sbjct: 829 tgttgtagatgatggcagctccaagactcctggctgggttaatgccagttccagtgatgg 770

                       
Query: 448 ggatggtggcca 459
           | ||||||||||
Sbjct: 769 gaatggtggcca 758



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 148/188 (78%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| ||||||||||| | |  |||||| |  || || ||||| || |||||
Sbjct: 868 cttgaatgggatggctctgatgactatcacgtggtaaagagcagcaagcgcagcaccgat 809

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || || ||||| |||| ||| |||||   ||| ||||  ||| ||||| |||||||
Sbjct: 808 gaatggtccaacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgat 749

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 460
           ||| || || || ||||| || |||||||| || || || || ||||||||||| || | 
Sbjct: 748 ggcagctccaagactccttgctgggttgattccagttccagtaatggggatggttgctaa 689

                   
Query: 461 gtggacca 468
           ||||||||
Sbjct: 688 gtggacca 681



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 423 gggttgatgccggtgccggtgatggggatggtggccaggtggac 466
           ||||||||||| ||||| ||||| ||||||||||||| ||||||
Sbjct: 760 gggttgatgccagtgccagtgattgggatggtggccaagtggac 717



to top

>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence
          Length = 1260

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||||||||||||||||| ||||| |||||||| || || ||||| ||||| ||||
Sbjct: 791 ctcctcgccgggttgattccggtaccggtgatcggaatagtggcaaggtgaacca 737



to top

>gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partial cds
          Length = 859

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||||| || |||||||||||||| || |||||||| |||||||||| ||| ||||
Sbjct: 404 ctccttgcagggttgatgccggtcccagtgatgggaatggtggccaagtgcacca 350



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||||| || ||||||||||| || || ||||||||||||||||||| ||| ||||
Sbjct: 708 ctcctagcagggttgatgccagttccagtgatggggatggtggccaagtgaacca 654



to top

>gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete
           cds
          Length = 1123

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 138/175 (78%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 333
           |||||| ||||||||| || |||||||| || || |||||||| |  || || || || |
Sbjct: 907 acttggacttgaatggaattgctctgatcacaacttggtggtatagagctgctagagctg 848

                                                                       
Query: 334 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 393
           | || ||||| || || |||||||| |||||||||||   ||| ||||| |||  |||||
Sbjct: 847 ccccaatgaatggtccaacccagaatatccagtggtcattccatgcgtgttcctggttgt 788

                                                                  
Query: 394 agatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
           |||||||||| || || || ||||| || ||||| || || || || ||||||||
Sbjct: 787 agatgatggctgcaccaagactcctagcagggttaataccagttccagtgatggg 733



to top

>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein
           2;3, complete cds
          Length = 1218

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||||| |||||||| |||||||| |||||||  ||||||||||||| ||| ||||
Sbjct: 790 ctcctggccgggttaatgccggtaccggtgactgggatggtggccaagtgaacca 736



to top

>gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1135

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           |||||||||||||||| || || || ||||| || ||||| ||||| ||||||||||| |
Sbjct: 785 tgttgtagatgatggcagcaccaagactcctagctgggttaatgcctgtgccggtgattg 726

                  
Query: 448 ggatggt 454
           | |||||
Sbjct: 725 gaatggt 719



to top

>dbj|AB002147.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1112

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 153/195 (78%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 333
           |||||| ||| |||||||| || ||||| |||||||| ||||| |  || || || || |
Sbjct: 901 acttggacttaaatgggattgccctgatcaccacctgttggtacagagctgctagtgctg 842

                                                                       
Query: 334 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 393
           | || ||||| || || |||||||| |||||||||||   ||| ||||| ||   |||||
Sbjct: 841 ctccaatgaaaggtccaacccagaaaatccagtggtcatcccatgcgtggtcttggttgt 782

                                                                       
Query: 394 agatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatgg 453
           |||||||||| ||||| || ||||| || ||||| || || || || ||||| || || |
Sbjct: 781 agatgatggctgcgccaagactcctagctgggttaataccagttccagtgattggaattg 722

                          
Query: 454 tggccaggtggacca 468
           |||||| ||| ||||
Sbjct: 721 tggccaagtgtacca 707



to top

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 752 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 707



to top

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 420 gccgggttgatgccggtgccggtgatggggatggtggc 457
           ||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 739 gccgggttgataccggttccggtgatgggaatggtggc 702



to top

>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA,
           partial cds
          Length = 380

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 152/194 (78%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           |||| ||||||| || || ||||||||||| | |||||| ||||  ||||| |  || ||
Sbjct: 292 cttgctcttgaaaggaatggctctgatgacaatctggtgatagagtgcggctaaagctgc 233

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||| ||||| |||||   ||| | ||| ||| |||||||
Sbjct: 232 tccaatgaatggtccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgta 173

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
           ||| ||||| || || ||||| || || |||||||| || || ||||| || || || ||
Sbjct: 172 gataatggcggctccaaggcttctagctgggttgattccagttccggttatcggaattgt 113

                         
Query: 455 ggccaggtggacca 468
            |||||||| ||||
Sbjct: 112 cgccaggtgtacca 99



to top

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 704 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 659



to top

>emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrinsic protein 1a
          Length = 1107

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 104/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 842 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 783

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||| | ||||| |||||||| |||
Sbjct: 782 attgcagctccaaggcttctagctgggttgatgcctgtggcagtgattgggatggttgcc 723

                     
Query: 459 aggtggacca 468
           | ||| ||||
Sbjct: 722 aagtgaacca 713



to top

>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete
             sequence
          Length = 80736

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                           
Query: 414   ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
             ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 25068 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 25023



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 414   ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
             ||||| ||||||||||| ||||| |||||||| || || |||||||
Sbjct: 20280 ctcctagccgggttgataccggttccggtgatcggaatagtggcca 20325



to top

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 737 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 692



to top

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 737 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 692



to top

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 728 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 683



to top

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 737 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 692



to top

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 737 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 692



to top

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 429 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 384



to top

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 738 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 693



to top

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 420 gccgggttgatgccggtgccggtgatggggatggtggc 457
           ||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 739 gccgggttgataccggttccggtgatgggaatggtggc 702



to top

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           ||||| ||||||||||||||||| |||||||| || || |||||||
Sbjct: 753 ctcctagccgggttgatgccggttccggtgatcggaatagtggcca 708



to top

>dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24
          Length = 77999

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 420   gccgggttgatgccggtgccggtgatggggatggtggc 457
             ||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 19157 gccgggttgataccggttccggtgatgggaatggtggc 19194



to top

>emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1 gene)
          Length = 1163

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 152/194 (78%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||||||||| |||||||| || | ||||||||| |  || || || || ||
Sbjct: 969 cttggacttgaatgggatggctctgataacaatctggtggtacacagcagcaagagctgc 910

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || |||||||| || |||||||| ||||| || ||   ||| |   | ||| |||||||
Sbjct: 909 tccaatgaagggtcccacccagaatatccaatgatcattccaagatcgttccttgttgta 850

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggt 454
           |||||| || || || |  ||||| |||||||||||||| || || ||||| ||||||||
Sbjct: 849 gatgattgcagctcctaaactcctagccgggttgatgccagttccagtgattgggatggt 790

                         
Query: 455 ggccaggtggacca 468
            |||| ||| ||||
Sbjct: 789 tgccaagtgaacca 776



to top

>emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZB01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1026

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 97/121 (80%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||||||||| ||||| || | |||||||||   |||||  || ||  |||||||||||
Sbjct: 816 atgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatg 757

                                                                       
Query: 399 atggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggggatggtggcc 458
           || || || || ||||| || || ||||||||||| ||||| || || |||||||| |||
Sbjct: 756 attgcagctccaaggcttctagctgggttgatgcctgtgccagttattgggatggttgcc 697

            
Query: 459 a 459
           |
Sbjct: 696 a 696



to top

>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||| ||||||| || || || || ||||| || ||||||||||| || || |||||||
Sbjct: 763 tgttgaagatgattgcagctccaagactccttgctgggttgatgccagtaccagtgatgg 704

                                
Query: 448 ggatggtggccaggtggacca 468
           ||||||| || | ||||||||
Sbjct: 703 ggatggttgctaagtggacca 683



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggt 369
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 683 gcggcgccgacgaaggggccgagccagtagacccagtggt 644



to top

>gb|AY019116.1| Oryza sativa microsatellite MRG1441 containing (AT)X27, closest to
           marker S733, genomic sequence
          Length = 254

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 374 ccaggcgtgctccctgttgtagatgatggccgcgcc 409
           |||||| || |||||||||||||||||||| |||||
Sbjct: 39  ccaggcatggtccctgttgtagatgatggcagcgcc 4



to top

>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete
           cds
          Length = 1279

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggc 457
           ||||| || |||||||||||||||||||| || || ||||||||
Sbjct: 734 ctccttgctgggttgatgccggtgccggtaatcggaatggtggc 691



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                        
Query: 330      gcggcgccgatgaaggggccgacccagaagatccagtggt 369
                |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 43108744 gcggcgccgacgaaggggccgagccagtagacccagtggt 43108783



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 413 gctcctcgccgggttgatgccggtgccggtgatggggatggtgg 456
           |||||| ||||||||||| || ||||| |||||||| |||||||
Sbjct: 733 gctcctggccgggttgataccagtgccagtgatgggaatggtgg 690



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 330    gcggcgccgatgaaggggccgacccagaagatccagtggt 369
              |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 105773 gcggcgccgacgaaggggccgagccagtagacccagtggt 105812



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggt 369
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 707 gcggcgccgacgaaggggccgagccagtagacccagtggt 668



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggt 369
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 756 gcggcgccgacgaaggggccgagccagtagacccagtggt 717



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggt 369
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 693 gcggcgccgacgaaggggccgagccagtagacccagtggt 654



to top

>gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrinsic protein 3 mRNA,
           complete cds
          Length = 1292

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||||||||||||
Sbjct: 878 atgaagggtcccacccagaagatccagtggtc 847



to top

>ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA
          Length = 823

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1), mRNA, complete
           cds
          Length = 2695

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 704 ccgatgaacggccccacccagaagatccagtggtc 670



to top

>ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood group) (AQP1), mRNA
          Length = 945

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1), mRNA
          Length = 945

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 317    gatggcggccagcgcggcgccga 339
              |||||||||||||||||||||||
Sbjct: 310343 gatggcggccagcgcggcgccga 310365



to top

>emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1
          Length = 1240

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           |||||||| |||||||| ||   |||||||||   | |||||||||| ||||| || || 
Sbjct: 859 acccagaaaatccagtgatcgtcccaggcgtgagacttgttgtagataatggcagctcct 800

                                                                      
Query: 411 aggctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggaccag 469
           || || |  |||||||||||||| || ||||||||||| || || || ||||| |||||
Sbjct: 799 agacttcgggccgggttgatgccagttccggtgatgggaatagtcgcaaggtgaaccag 741



to top

>ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA
          Length = 2703

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, complete cds
          Length = 823

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:129064 IMAGE:8121557),
           complete cds
          Length = 2703

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocular ciliary epithelium,
           mRNA, 1211 nt, segment 1 of 2]
          Length = 1211

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 694 ccgatgaacggccccacccagaagatccagtggtc 660



to top

>gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-1 mRNA, partial cds
          Length = 477

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||| |||||||||||
Sbjct: 341 ccgatgaacggcccgacccagaaaatccagtggtc 307



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 414 ctcctcgccgggttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||||| || |||||||| ||||||||||| || ||||| ||||||| ||| ||||
Sbjct: 683 ctcctggctgggttgataccggtgccggtaattgggatagtggccaagtgaacca 629



to top

>gb|AF051202.1|AF051202 Picea mariana probable aquaporin (Sb01) mRNA, complete cds
          Length = 1156

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 413 gctcctcgccgggttgatgccggtgccggtgatggggatggtggcca 459
           |||||| || ||||||||||| ||||| || ||||||||||| ||||
Sbjct: 752 gctcctggcagggttgatgcccgtgccagtaatggggatggtcgcca 706



to top

>gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 mRNA, complete cds
          Length = 826

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 672 ccgatgaacggccccacccagaagatccagtggtc 638



to top

>gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mip-1) mRNA, complete cds
          Length = 1213

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 128/163 (78%)
 Strand = Plus / Minus

                                                                       
Query: 306 acctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccag 365
           |||||||||||||  || || || || || |||||||| || || |||||||||||||||
Sbjct: 867 acctggtggtagagtgcagcgagagccgcaccgatgaatggtcccacccagaagatccag 808

                                                                       
Query: 366 tggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccggg 425
           || ||   |||| |  | ||  ||||| |||||||||| || ||||| || |  || || 
Sbjct: 807 tgatcgtcccagccaaggtctttgttgaagatgatggcggcaccgagactacgagcagga 748

                                                      
Query: 426 ttgatgccggtgccggtgatggggatggtggccaggtggacca 468
           ||||| || |  |||||||||||||||||||||| ||| ||||
Sbjct: 747 ttgataccagctccggtgatggggatggtggccaagtgaacca 705



to top

>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds
          Length = 1049

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 389 gttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatggg 448
           |||| ||||||| || || || |||||||  || ||| |||| ||||| |||||||| ||
Sbjct: 759 gttgaagatgatagcagctccaaggctccgggcgggggtgataccggttccggtgattgg 700

                      
Query: 449 gatggtggcca 459
           |||||||||||
Sbjct: 699 gatggtggcca 689



to top

>emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chromosome 4, complete
              sequence
          Length = 249534

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 84     tctgtctgggttcaggtgaatacagag 110
              ||||||||||| |||||||||||||||
Sbjct: 225070 tctgtctgggtacaggtgaatacagag 225044



to top

>dbj|AB012044.1| Raphanus sativus mRNA for plasma membrane aquaporin (PAQ1),
           complete cds
          Length = 1113

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 447
           ||||||||||||| || || || || || || || ||||||||||| ||||| ||||| |
Sbjct: 804 tgttgtagatgattgcagctccaagacttctagctgggttgatgcctgtgccagtgattg 745

                  
Query: 448 ggatggt 454
           |||||||
Sbjct: 744 ggatggt 738


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,472,299
Number of Sequences: 3902068
Number of extensions: 4472299
Number of successful extensions: 90701
Number of sequences better than 10.0: 367
Number of HSP's better than 10.0 without gapping: 370
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 89081
Number of HSP's gapped (non-prelim): 1568
length of query: 470
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 448
effective length of database: 17,147,199,772
effective search space: 7681945497856
effective search space used: 7681945497856
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top