Clone Information

BLAST Search Result

Clone Name	rbart18c07
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	dbj\|AB127977.1\| Buergeria buergeri mitochondrial DNA, complete g...	46	0.11
2	emb\|AL391221.15\| Human DNA sequence from clone RP11-771D21 on ch...	44	0.43
3	emb\|AL808136.9\| Mouse DNA sequence from clone RP23-75D13 on chro...	44	0.43
4	gb\|AC009844.7\| Drosophila melanogaster clone BACR01L16, complete...	42	1.7
5	gb\|AY124713.1\| Strumigenys orchidensis internal transcribed spac...	42	1.7
6	gb\|AC116593.4\| Mus musculus BAC clone RP24-91C7 from chromosome ...	42	1.7
7	gb\|AC118009.7\| Mus musculus chromosome 8, clone RP23-442H2, comp...	42	1.7
8	gb\|AC007091.3\| Homo sapiens BAC clone RP11-71F18 from 7, complet...	42	1.7
9	emb\|AL591492.11\| Zebrafish DNA sequence from clone BUSM1-261O22 ...	42	1.7
10	gb\|AC118754.6\| Homo sapiens, clone RP11-141J13, complete sequence	42	1.7
11	gb\|AY118402.1\| Drosophila melanogaster RE60936 full insert cDNA	42	1.7
12	ref\|NM_080153.3\| Drosophila melanogaster atypical protein kinase...	42	1.7
13	gb\|AC015820.10\| Homo sapiens chromosome 11, clone RP11-108G3, co...	42	1.7
14	gb\|AC080004.12\| Homo sapiens 3q BAC RP11-307O15 (Roswell Park Ca...	42	1.7
15	gb\|AC093553.1\| Leishmania donovani clone XX-BNI_Clos11.2, comple...	42	1.7
16	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.7
17	emb\|AL606597.4\|OSJN00042 Oryza sativa genomic DNA, chromosome 4,...	42	1.7
18	gb\|AF288482.1\|AF288482 Drosophila melanogaster atypical protein ...	42	1.7
19	gb\|AC005706.6\|AC005706 Drosophila melanogaster, chromosome 2R, r...	42	1.7
20	gb\|AE003812.4\| Drosophila melanogaster chromosome 2R, section 38...	42	1.7
21	emb\|AL807818.14\| Zebrafish DNA sequence from clone CH211-225H24,...	42	1.7
22	gb\|AY540995.1\| Achromobacter xylosoxidans subsp. denitrificans s...	40	6.8
23	gb\|AC115022.11\| Mus musculus chromosome 7, clone RP24-233J11, co...	40	6.8
24	gb\|AY124718.1\| Strumigenys sp. OK Sp5 internal transcribed space...	40	6.8
25	gb\|AY208390.1\| Chromis margaritifer isolate stri-10560 ATP synth...	40	6.8
26	gb\|AY208389.1\| Chromis margaritifer isolate stri-10559 ATP synth...	40	6.8
27	gb\|AY208388.1\| Chromis iomelas isolate stri-x-1833 ATP synthase ...	40	6.8
28	gb\|AY208387.1\| Chromis iomelas isolate stri-10558 ATP synthase 8...	40	6.8
29	gb\|AC130531.4\| Mus musculus BAC clone RP23-167P1 from chromosome...	40	6.8
30	ref\|XM_752039.1\| Ustilago maydis 521 hypothetical protein (UM009...	40	6.8
31	emb\|AL390295.10\| Human DNA sequence from clone RP11-254D22 on ch...	40	6.8
32	emb\|AL442647.18\| Human DNA sequence from clone RP11-72I18 on chr...	40	6.8
33	emb\|AL357129.11\| Human DNA sequence from clone RP11-114A21 on ch...	40	6.8
34	emb\|AL355576.14\| Human DNA sequence from clone RP11-305F4 on chr...	40	6.8
35	emb\|AL139136.17\| Human DNA sequence from clone RP11-53I24 on chr...	40	6.8
36	emb\|AL138879.10\| Human DNA sequence from clone RP11-397G17 on ch...	40	6.8
37	emb\|AL139277.7\| Human DNA sequence from clone RP11-465E19 on chr...	40	6.8
38	emb\|BX572097.1\| Prochlorococcus marinus MIT9313 complete genome;...	40	6.8
39	gb\|DQ088379.1\| Homo sapiens synuclein, alpha (non A4 component o...	40	6.8
40	gb\|AC181987.3\| Cavia porcellus clone CH234-261L8, complete sequence	40	6.8
41	gb\|AC092110.9\| Homo sapiens 12 BAC RP11-287J11 (Roswell Park Can...	40	6.8
42	gb\|AC097478.2\| Homo sapiens BAC clone RP11-115D19 from 4, comple...	40	6.8
43	gb\|AC092421.2\| Homo sapiens chromosome 3 clone RP11-476A24, comp...	40	6.8
44	emb\|CR383657.1\| Human chromosome 14 DNA sequence BAC R-491G9 of ...	40	6.8
45	emb\|CR383656.1\| Human chromosome 14 DNA sequence BAC R-536C10 of...	40	6.8
46	gb\|AC008863.8\| Homo sapiens chromosome 5 clone CTD-2192G22, comp...	40	6.8
47	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.8
48	gb\|AC027315.3\|AC027315 Homo sapiens chromosome 5 clone CTC-293G1...	40	6.8
49	gb\|AC021086.4\|AC021086 Homo sapiens chromosome 5 clone CTD-2001C...	40	6.8
50	gb\|AF163864.1\|AF163864 Homo sapiens SNCA isoform (SNCA) gene, co...	40	6.8
51	gb\|AC017080.8\| Homo sapiens BAC clone RP11-469G4 from 2, complet...	40	6.8
52	gb\|AC135168.8\| Homo sapiens, clone CTD-2025E19, complete sequence	40	6.8
53	ref\|XM_342288.2\| PREDICTED: Rattus norvegicus similar to express...	40	6.8
54	gb\|AC010382.4\|AC010382 Homo sapiens chromosome 5 clone CTD-2068C...	40	6.8
55	dbj\|AP004572.5\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.8
56	emb\|BX571672.10\| Human DNA sequence from clone RP11-782C8 on chr...	40	6.8
57	gb\|AC009716.22\| Homo sapiens chromosome 18, clone RP11-504I13, c...	40	6.8
58	dbj\|AP003740.2\| Oryza sativa (japonica cultivar-group) genomic D...	40	6.8
59	emb\|AL049838.3\|CNS0000C Human chromosome 14 DNA sequence BAC R-9...	40	6.8
60	dbj\|AP001892.4\| Homo sapiens genomic DNA, chromosome 11q, clone:...	40	6.8
61	gb\|AC153561.5\| Mus musculus 10 BAC RP23-426E11 (Roswell Park Can...	40	6.8
62	gb\|DQ065837.1\| Burkholderia cepacia strain 2a plasmid pIJB1, com...	40	6.8
63	emb\|AL929600.3\|CNS08CCF Human chromosome 14 DNA sequence BAC R-2...	40	6.8
64	emb\|AL355792.8\| Human DNA sequence from clone RP5-1123F10 on chr...	40	6.8
65	dbj\|AP000535.1\| Homo sapiens genomic DNA, chromosome 22q11.2, Ca...	40	6.8

>dbj|AB127977.1| Buergeria buergeri mitochondrial DNA, complete genome
          Length = 19959

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 189   ttacacaatcacccccacaactcaact 215
             ||||||| |||||||||||||||||||
Sbjct: 10190 ttacacattcacccccacaactcaact 10216

to top

>emb|AL391221.15| Human DNA sequence from clone RP11-771D21 on chromosome 6 Contains the
             5' end of the PKHD1 gene for polycystic kidney and hepatic
             disease 1 (autosomal recessive) (TIG multiple domains-1,
             FCYT, ARPKD), a novel gene and the IL17 gene for
             interleukin 17 (cytotoxic T-lymphocyte-associated serine
             esterase 8) (CTLA8), complete sequence
          Length = 152546

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 233   ctgcaccagccaaacacctact 254
             ||||||||||||||||||||||
Sbjct: 97524 ctgcaccagccaaacacctact 97545

to top

>emb|AL808136.9| Mouse DNA sequence from clone RP23-75D13 on chromosome X, complete
             sequence
          Length = 183746

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 46    tcactgactcttcacatgatct 67
             ||||||||||||||||||||||
Sbjct: 78554 tcactgactcttcacatgatct 78533

to top

>gb|AC009844.7| Drosophila melanogaster clone BACR01L16, complete sequence
          Length = 168238

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 220   aggaaaacgatccctgcacca 240
             |||||||||||||||||||||
Sbjct: 87795 aggaaaacgatccctgcacca 87775

to top

>gb|AY124713.1| Strumigenys orchidensis internal transcribed spacer 2, partial
           sequence
          Length = 939

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 318 gtcttcgtcgtctgcctctcacacg 342
           ||||||||| |||||||||||||||
Sbjct: 664 gtcttcgtcctctgcctctcacacg 688

to top

>gb|AC116593.4| Mus musculus BAC clone RP24-91C7 from chromosome 8, complete sequence
          Length = 174603

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 80     taatgtatgtagtatcagttt 100
              |||||||||||||||||||||
Sbjct: 147363 taatgtatgtagtatcagttt 147383

to top

>gb|AC118009.7| Mus musculus chromosome 8, clone RP23-442H2, complete sequence
          Length = 208458

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 80     taatgtatgtagtatcagttt 100
              |||||||||||||||||||||
Sbjct: 181871 taatgtatgtagtatcagttt 181851

to top

>gb|AC007091.3| Homo sapiens BAC clone RP11-71F18 from 7, complete sequence
          Length = 174327

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 98    tttttgccttcctaacaatac 118
             |||||||||||||||||||||
Sbjct: 35921 tttttgccttcctaacaatac 35941

to top

>emb|AL591492.11| Zebrafish DNA sequence from clone BUSM1-261O22 in linkage group 20
             Contains a novel gene similar to FKBP3 (FK506 binding
             protein 3), a novel gene for a protein similar to pre-mRNA
             processing proteins, a novel retrotransposon and two CpG
             islands, complete sequence
          Length = 92083

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 41    gcagctcactgactcttcaca 61
             |||||||||||||||||||||
Sbjct: 28809 gcagctcactgactcttcaca 28789

to top

>gb|AC118754.6| Homo sapiens, clone RP11-141J13, complete sequence
          Length = 185378

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 412    ccagggcctccagctcctttgcttg 436
              ||||||| |||||||||||||||||
Sbjct: 135860 ccagggcttccagctcctttgcttg 135836

to top

>gb|AY118402.1| Drosophila melanogaster RE60936 full insert cDNA
          Length = 3234

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 220 aggaaaacgatccctgcacca 240
           |||||||||||||||||||||
Sbjct: 552 aggaaaacgatccctgcacca 572

to top

>ref|NM_080153.3| Drosophila melanogaster atypical protein kinase C CG10261-RA
           (aPKC), mRNA
          Length = 3220

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 220 aggaaaacgatccctgcacca 240
           |||||||||||||||||||||
Sbjct: 552 aggaaaacgatccctgcacca 572

to top

>gb|AC015820.10| Homo sapiens chromosome 11, clone RP11-108G3, complete sequence
          Length = 165149

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 467    ttgcatttgcgtttggtttcttgggcgtg 495
              |||||||||| ||||||||||||| ||||
Sbjct: 145673 ttgcatttgcttttggtttcttggtcgtg 145701

to top

>gb|AC080004.12| Homo sapiens 3q BAC RP11-307O15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 206162

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 467   ttgcatttgcgtttggtttcttgggcgtg 495
             |||||||||| ||||||||||||| ||||
Sbjct: 51075 ttgcatttgcttttggtttcttggtcgtg 51047

to top

>gb|AC093553.1| Leishmania donovani clone XX-BNI_Clos11.2, complete sequence
          Length = 36123

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 413   cagggcctccagctcctttgcttgg 437
             ||||||||| |||||||||||||||
Sbjct: 32309 cagggcctcgagctcctttgcttgg 32333

to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 478     tttggtttcttgggcgtgctg 498
               |||||||||||||||||||||
Sbjct: 8169267 tttggtttcttgggcgtgctg 8169287

to top

>emb|AL606597.4|OSJN00042 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0045P24,
              complete sequence
          Length = 124420

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 478    tttggtttcttgggcgtgctg 498
              |||||||||||||||||||||
Sbjct: 102799 tttggtttcttgggcgtgctg 102819

to top

>gb|AF288482.1|AF288482 Drosophila melanogaster atypical protein kinase C mRNA, complete
           cds
          Length = 2476

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 220 aggaaaacgatccctgcacca 240
           |||||||||||||||||||||
Sbjct: 533 aggaaaacgatccctgcacca 553

to top

>gb|AC005706.6|AC005706 Drosophila melanogaster, chromosome 2R, region 51D1-51D2, P1 clone
             DS04940, complete sequence
          Length = 72808

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 220   aggaaaacgatccctgcacca 240
             |||||||||||||||||||||
Sbjct: 12108 aggaaaacgatccctgcacca 12088

to top

>gb|AE003812.4| Drosophila melanogaster chromosome 2R, section 38 of 73 of the complete
             sequence
          Length = 255772

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 220   aggaaaacgatccctgcacca 240
             |||||||||||||||||||||
Sbjct: 63638 aggaaaacgatccctgcacca 63618

to top

>emb|AL807818.14| Zebrafish DNA sequence from clone CH211-225H24, complete sequence
          Length = 194425

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 462   gggatttgcatttgcgtttggtttc 486
             |||||||||| ||||||||||||||
Sbjct: 29829 gggatttgcacttgcgtttggtttc 29805

to top

>gb|AY540995.1| Achromobacter xylosoxidans subsp. denitrificans strain EST4002 plasmid
             pEST4011, complete sequence
          Length = 76958

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 408   agcgccagggcctccagctc 427
             ||||||||||||||||||||
Sbjct: 75956 agcgccagggcctccagctc 75937

to top

>gb|AC115022.11| Mus musculus chromosome 7, clone RP24-233J11, complete sequence
          Length = 150060

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 414   agggcctccagctcctttgc 433
             ||||||||||||||||||||
Sbjct: 29960 agggcctccagctcctttgc 29941

to top

>gb|AY124718.1| Strumigenys sp. OK Sp5 internal transcribed spacer 2, partial
           sequence
          Length = 947

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 318 gtcttcgtcgtctgcctctcacac 341
           ||||||||| ||||||||||||||
Sbjct: 678 gtcttcgtcctctgcctctcacac 701

to top

>gb|AY208390.1| Chromis margaritifer isolate stri-10560 ATP synthase 8 and ATP
           synthase 6 genes, complete cds; mitochondrial genes for
           mitochondrial products
          Length = 842

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 197 tcacccccacaactcaactc 216
           ||||||||||||||||||||
Sbjct: 436 tcacccccacaactcaactc 455

to top

>gb|AY208389.1| Chromis margaritifer isolate stri-10559 ATP synthase 8 and ATP
           synthase 6 genes, complete cds; mitochondrial genes for
           mitochondrial products
          Length = 842

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 197 tcacccccacaactcaactc 216
           ||||||||||||||||||||
Sbjct: 436 tcacccccacaactcaactc 455

to top

>gb|AY208388.1| Chromis iomelas isolate stri-x-1833 ATP synthase 8 and ATP synthase
           6 genes, complete cds; mitochondrial genes for
           mitochondrial products
          Length = 842

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 197 tcacccccacaactcaactc 216
           ||||||||||||||||||||
Sbjct: 436 tcacccccacaactcaactc 455

to top

>gb|AY208387.1| Chromis iomelas isolate stri-10558 ATP synthase 8 and ATP synthase
           6 genes, complete cds; mitochondrial genes for
           mitochondrial products
          Length = 842

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 197 tcacccccacaactcaactc 216
           ||||||||||||||||||||
Sbjct: 436 tcacccccacaactcaactc 455

to top

>gb|AC130531.4| Mus musculus BAC clone RP23-167P1 from chromosome 19, complete sequence
          Length = 202186

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 106    ttcctaacaataccctcatgtaca 129
              |||||||||||||||| |||||||
Sbjct: 114384 ttcctaacaataccctgatgtaca 114407

to top

>ref|XM_752039.1| Ustilago maydis 521 hypothetical protein (UM00985.1) partial mRNA
          Length = 1275

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 317 tgtcttcgtcgtctgcctct 336
           ||||||||||||||||||||
Sbjct: 2   tgtcttcgtcgtctgcctct 21

to top

>emb|AL390295.10| Human DNA sequence from clone RP11-254D22 on chromosome 13, complete
             sequence
          Length = 98339

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||||||||| |||||||
Sbjct: 55589 ttgcatttgcgtttgggttcttgg 55612

to top

>emb|AL442647.18| Human DNA sequence from clone RP11-72I18 on chromosome X Contains the
            5' end of a RuvB-like 2 (E. coli) (RUVBL2) pseudogene and
            part of a novel gene, complete sequence
          Length = 60994

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 467  ttgcatttgcgtttggtttcttgg 490
            |||||||||| |||||||||||||
Sbjct: 6896 ttgcatttgcttttggtttcttgg 6873

to top

>emb|AL357129.11| Human DNA sequence from clone RP11-114A21 on chromosome Xq21.31-22.1,
              complete sequence
          Length = 145380

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||| |||||||||||||
Sbjct: 104737 ttgcatttgcttttggtttcttgg 104760

to top

>emb|AL355576.14| Human DNA sequence from clone RP11-305F4 on chromosome 13, complete
             sequence
          Length = 148744

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 50227 ttgcatttgcttttggtttcttgg 50250

to top

>emb|AL139136.17| Human DNA sequence from clone RP11-53I24 on chromosome 1 Contains the 3'
              end of the CRB1 gene for crumbs homolog 1 (Drosophila) and
              the 3' end of  a novel gene, complete sequence
          Length = 181596

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||| |||||||||||||
Sbjct: 177587 ttgcatttgcttttggtttcttgg 177564

to top

>emb|AL138879.10| Human DNA sequence from clone RP11-397G17 on chromosome 6p11.2-21
             Contains the 3' end of a novel gene, complete sequence
          Length = 164064

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 53345 ttgcatttgcttttggtttcttgg 53322

to top

>emb|AL139277.7| Human DNA sequence from clone RP11-465E19 on chromosome Xp11.1-11.23
             Contains the 3' end of the RRAGB for Ras-related GTP
             binding B, complete sequence
          Length = 158591

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||||||||| |||||||
Sbjct: 43500 ttgcatttgcgtttgggttcttgg 43477

to top

>emb|BX572097.1| Prochlorococcus marinus MIT9313 complete genome; segment 3/7
          Length = 349823

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 421    ccagctcctttgcttggttg 440
              ||||||||||||||||||||
Sbjct: 221203 ccagctcctttgcttggttg 221184

to top

>gb|DQ088379.1| Homo sapiens synuclein, alpha (non A4 component of amyloid precursor)
             (SNCA) gene, complete cds
          Length = 113681

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 57389 ttgcatttgcttttggtttcttgg 57412

to top

>gb|AC181987.3| Cavia porcellus clone CH234-261L8, complete sequence
          Length = 125192

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 415   gggcctccagctcctttgct 434
             ||||||||||||||||||||
Sbjct: 24887 gggcctccagctcctttgct 24868

to top

>gb|AC092110.9| Homo sapiens 12 BAC RP11-287J11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 181207

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||| |||||||||||||
Sbjct: 160597 ttgcatttgcttttggtttcttgg 160574

to top

>gb|AC097478.2| Homo sapiens BAC clone RP11-115D19 from 4, complete sequence
          Length = 169484

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||| |||||||||||||
Sbjct: 164922 ttgcatttgcttttggtttcttgg 164899

to top

>gb|AC092421.2| Homo sapiens chromosome 3 clone RP11-476A24, complete sequence
          Length = 160726

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||| |||||||||||||
Sbjct: 110142 ttgcatttgcttttggtttcttgg 110119

to top

>emb|CR383657.1| Human chromosome 14 DNA sequence BAC R-491G9 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 176745

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 40590 ttgcatttgcatttggtttcttgg 40567



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 31597 ttgcatttgcatttggtttcttgg 31620

to top

>emb|CR383656.1| Human chromosome 14 DNA sequence BAC R-536C10 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 184906

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 54435 ttgcatttgcatttggtttcttgg 54412



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 45442 ttgcatttgcatttggtttcttgg 45465

to top

>gb|AC008863.8| Homo sapiens chromosome 5 clone CTD-2192G22, complete sequence
          Length = 152529

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||| |||||||||||||
Sbjct: 105994 ttgcatttgcttttggtttcttgg 106017

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 13      ttcatgttcatgttcatgaa 32
               ||||||||||||||||||||
Sbjct: 6947442 ttcatgttcatgttcatgaa 6947461

to top

>gb|AC027315.3|AC027315 Homo sapiens chromosome 5 clone CTC-293G12, complete sequence
          Length = 171390

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||| |||||||||||||
Sbjct: 165075 ttgcatttgcctttggtttcttgg 165098

to top

>gb|AC021086.4|AC021086 Homo sapiens chromosome 5 clone CTD-2001C12, complete sequence
          Length = 137063

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 79518 ttgcatttgcctttggtttcttgg 79541

to top

>gb|AF163864.1|AF163864 Homo sapiens SNCA isoform (SNCA) gene, complete cds, alternatively
             spliced
          Length = 145606

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 85645 ttgcatttgcttttggtttcttgg 85668

to top

>gb|AC017080.8| Homo sapiens BAC clone RP11-469G4 from 2, complete sequence
          Length = 184012

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||||||||| |||||||
Sbjct: 33876 ttgcatttgcgtttgggttcttgg 33853

to top

>gb|AC135168.8| Homo sapiens, clone CTD-2025E19, complete sequence
          Length = 125231

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 72797 ttgcatttgcttttggtttcttgg 72820

to top

>ref|XM_342288.2| PREDICTED: Rattus norvegicus similar to expressed sequence C77668
            (predicted) (LOC361988), mRNA
          Length = 4462

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 412  ccagggcctccagctccttt 431
            ||||||||||||||||||||
Sbjct: 3874 ccagggcctccagctccttt 3893

to top

>gb|AC010382.4|AC010382 Homo sapiens chromosome 5 clone CTD-2068C11, complete sequence
          Length = 151365

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||| |||||||||||||
Sbjct: 113124 ttgcatttgcctttggtttcttgg 113147

to top

>dbj|AP004572.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0668C05
          Length = 142081

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    ttcatgttcatgttcatgaa 32
             ||||||||||||||||||||
Sbjct: 71257 ttcatgttcatgttcatgaa 71276

to top

>emb|BX571672.10| Human DNA sequence from clone RP11-782C8 on chromosome 1, complete
              sequence
          Length = 175055

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||||||||| |||||||
Sbjct: 156187 ttgcatttgcgtttgggttcttgg 156164

to top

>gb|AC009716.22| Homo sapiens chromosome 18, clone RP11-504I13, complete sequence
          Length = 211981

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    aactcaactcagtaggaaaa 226
              ||||||||||||||||||||
Sbjct: 112622 aactcaactcagtaggaaaa 112603

to top

>dbj|AP003740.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1118_B03
          Length = 108992

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 13     ttcatgttcatgttcatgaa 32
              ||||||||||||||||||||
Sbjct: 103697 ttcatgttcatgttcatgaa 103716

to top

>emb|AL049838.3|CNS0000C Human chromosome 14 DNA sequence BAC R-999E24 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 211723

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 92957 ttgcatttgcttttggtttcttgg 92980

to top

>dbj|AP001892.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-49M9, complete
             sequences
          Length = 144308

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 96688 ttgcatttgcttttggtttcttgg 96665

to top

>gb|AC153561.5| Mus musculus 10 BAC RP23-426E11 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 228734

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 40    tgcagctcactgactcttca 59
             ||||||||||||||||||||
Sbjct: 34195 tgcagctcactgactcttca 34176

to top

>gb|DQ065837.1| Burkholderia cepacia strain 2a plasmid pIJB1, complete sequence
          Length = 99448

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 408   agcgccagggcctccagctc 427
             ||||||||||||||||||||
Sbjct: 47800 agcgccagggcctccagctc 47781

to top

>emb|AL929600.3|CNS08CCF Human chromosome 14 DNA sequence BAC R-254P21 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 148065

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 467    ttgcatttgcgtttggtttcttgg 490
              |||||||||| |||||||||||||
Sbjct: 113787 ttgcatttgcatttggtttcttgg 113810

to top

>emb|AL355792.8| Human DNA sequence from clone RP5-1123F10 on chromosome 11 Contains
             STSs and GSSs, complete sequence
          Length = 130116

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 59895 ttgcatttgcttttggtttcttgg 59872

to top

>dbj|AP000535.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye Syndrome region,
             clone:c58F10
          Length = 39151

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 467   ttgcatttgcgtttggtttcttgg 490
             |||||||||| |||||||||||||
Sbjct: 19447 ttgcatttgcatttggtttcttgg 19470


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,833,292
Number of Sequences: 3902068
Number of extensions: 3833292
Number of successful extensions: 75433
Number of sequences better than 10.0: 65
Number of HSP's better than 10.0 without gapping: 65
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75301
Number of HSP's gapped (non-prelim): 132
length of query: 499
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 477
effective length of database: 17,147,199,772
effective search space: 8179214291244
effective search space used: 8179214291244
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result