ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart18b02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, com... 829 0.0
2gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, c... 809 0.0
3emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) 728 0.0
4emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin 694 0.0
5gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 553 e-154
6gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 553 e-154
7gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 553 e-154
8gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 553 e-154
9gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 553 e-154
10gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 553 e-154
11gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 553 e-154
12gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 545 e-152
13gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 545 e-152
14gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 545 e-152
15gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 545 e-152
16gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 545 e-152
17gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 545 e-152
18gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 545 e-152
19gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 545 e-152
20gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 537 e-149
21gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 537 e-149
22gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 537 e-149
23gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 537 e-149
24gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 537 e-149
25gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 537 e-149
26gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 535 e-149
27gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 523 e-145
28gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 521 e-145
29emb|X62476.1|TARAB15B T.aestivum rab15B mRNA 418 e-114
30gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, com... 410 e-111
31gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 404 e-110
32gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome... 121 2e-24
33dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
34emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible ... 121 2e-24
35gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds 121 2e-24
36gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 121 2e-24
37dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 5e-22
38emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene 103 5e-19
39dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 5e-19
40gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 ... 94 4e-16
41gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 ... 94 4e-16
42gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ... 94 4e-16
43gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ... 94 4e-16
44gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ... 94 4e-16
45gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ... 94 4e-16
46gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 94 4e-16
47gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ... 94 4e-16
48gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 94 4e-16
49gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 94 4e-16
50gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 94 4e-16
51gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 94 4e-16
52gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 94 4e-16
53gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ... 94 4e-16
54gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 94 4e-16
55gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 94 4e-16
56gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 94 4e-16
57gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 94 4e-16
58gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 94 4e-16
59gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 94 4e-16
60gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 94 4e-16
61gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 94 4e-16
62gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 94 4e-16
63gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 94 4e-16
64gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 94 4e-16
65gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group ... 94 4e-16
66emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 94 4e-16
67emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) 94 4e-16
68gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, com... 94 4e-16
69gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, com... 94 4e-16
70gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, c... 94 4e-16
71gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, c... 94 4e-16
72emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 88 3e-14
73emb|X15994.1|ZMRAB17G Maize RAB-17 gene 88 3e-14
74emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene 88 3e-14
75emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene... 88 3e-14
76dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
77gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB... 86 1e-13
78gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 86 1e-13
79gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, com... 86 1e-13
80gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
81gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
82gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
83gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
84gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
85gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
86gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
87gb|AY895924.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
88gb|AY895923.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
89gb|AY895922.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
90gb|AY895921.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
91gb|AY895920.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
92gb|AY895919.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
93gb|AY895918.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
94gb|AY895917.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
95gb|AY895916.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
96gb|AY895915.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
97gb|AY895914.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
98gb|AY895913.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
99gb|AY895912.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
100gb|AY895911.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
101gb|AY895910.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
102gb|AY895909.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
103gb|AY895908.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
104gb|AY895907.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
105gb|AY895906.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
106gb|AY895905.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 86 1e-13
107gb|AF043092.1|AF043092 Hordeum vulgare dehydrin 7 (dhn7) gene, c... 86 1e-13
108gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, parti... 86 1e-13
109gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein W... 84 4e-13
110gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group ... 84 4e-13
111gb|AF181460.1|AF181460 Hordeum vulgare dehydrin (Dhn10) gene, co... 84 4e-13
112gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, com... 84 4e-13
113gb|AF043095.1|AF043095 Hordeum vulgare dehydrin 10 (dhn10) gene,... 84 4e-13
114gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, com... 84 4e-13
115gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, c... 84 4e-13
116gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds 84 4e-13
117emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7 82 2e-12
118emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene) 82 2e-12
119emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8) 82 2e-12
120emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene 82 2e-12
121emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin 82 2e-12
122gb|AF181461.1|AF181461 Hordeum vulgare dehydrin (Dhn11) gene, co... 82 2e-12
123gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, com... 82 2e-12
124dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
125gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
126gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
127gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
128gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
129gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
130gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
131gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
132gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
133gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
134gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
135gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
136gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
137gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
138gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
139gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
140gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
141gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
142gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
143gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
144gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
145gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
146gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
147gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI... 82 2e-12
148gb|AY104757.1| Zea mays PCO142314 mRNA sequence 82 2e-12
149gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, c... 82 2e-12
150gb|AF043086.1|AF043086 Hordeum vulgare dehydrin 11 (dhn11) gene,... 82 2e-12
151emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 80 7e-12
152emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clon... 80 7e-12
153gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 ... 78 3e-11
154gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 ... 78 3e-11
155gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ... 78 3e-11
156gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ... 78 3e-11
157gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ... 78 3e-11
158gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ... 78 3e-11
159gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ... 78 3e-11
160gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 78 3e-11
161gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 78 3e-11
162gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 78 3e-11
163gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ... 78 3e-11
164gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 78 3e-11
165gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 78 3e-11
166gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 78 3e-11
167gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 78 3e-11
168gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, c... 78 3e-11
169gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, c... 78 3e-11
170gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, com... 76 1e-10
171gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, c... 76 1e-10
172gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein ... 76 1e-10
173emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9) 74 4e-10
174gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, com... 74 4e-10
175gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, c... 74 4e-10
176gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, com... 72 2e-09
177ref|NM_192219.1| Oryza sativa (japonica cultivar-group), predic... 72 2e-09
178gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 72 2e-09
179gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 72 2e-09
180gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 72 2e-09
181gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 72 2e-09
182gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 72 2e-09
183gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 72 2e-09
184gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-re... 72 2e-09
185dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
186dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
187emb|X57327.1|OSRAB25 Rice rab25 mRNA 72 2e-09
188dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
189gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, compl... 72 2e-09
190gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 70 6e-09
191gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 70 6e-09
192gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 70 6e-09
193gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 70 6e-09
194gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 70 6e-09
195gb|AF031249.1|AF031249 Lophopyrum elongatum dehydrin-/LEA group ... 70 6e-09
196gb|AF031250.1|AF031250 Lophopyrum elongatum dehydrin-/LEA group ... 70 6e-09
197dbj|AB049336.1| Nicotiana tabacum NtERD10B mRNA for dehydrin, co... 70 6e-09
198gb|U73213.1|TAU73213 Triticum aestivum cold acclimation protein ... 70 6e-09
199gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene,... 66 1e-07
200gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds 62 2e-06
201gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab... 62 2e-06
202gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-rel... 62 2e-06
203dbj|AB049335.1| Nicotiana tabacum NtERD10A mRNA for dehydrin, pa... 62 2e-06
204dbj|AB076807.1| Triticum aestivum Wdhn13 mRNA for LEA D-11 dehyd... 62 2e-06
205gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome... 60 6e-06
206emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene ... 60 6e-06
207gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-rel... 60 6e-06
208emb|X13204.1|GHLEA11 Cotton set 5B Lea gene for seed protein D-11 58 2e-05
209gb|M19379.1|COTSPE G.hirsutum (cotton) storage protein (late emb... 58 2e-05
210gb|M81791.1|COTLEA3C Gossypium hirsutum DNA fragment 58 2e-05
211gb|M81654.1|COTLEA3A Gossypium hirsutum dehydrin (Lea3-D11) gene... 58 2e-05
212gb|AY425975.1| Streptocarpus primulifolius microsatellite B22 se... 56 1e-04
213emb|AJ606474.1| Fagus sylvatica mRNA for dehydrin/response ABA (... 56 1e-04
214gb|AF044584.1|AF044584 Lavatera thuringiaca cold regulated LTCOR... 56 1e-04
215ref|NM_126038.2| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 1... 54 4e-04
216ref|NM_001037085.1| Arabidopsis thaliana RAB18 (RESPONSIVE TO AB... 54 4e-04
217gb|L04173.1|ATH18RAB Arabidopsis thaliana glycine rich protein (... 54 4e-04
218gb|AY093779.1| Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, comp... 54 4e-04
219gb|AF428458.1|AF428458 Arabidopsis thaliana AT5g66400/K1F13_5 mR... 54 4e-04
220gb|AY050416.1| Arabidopsis thaliana At1g11360/T23J18_35 mRNA, co... 54 4e-04
221gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-lik... 54 4e-04
222dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 4e-04
223emb|X68042.1|ATRAB18A A.thaliana rab18 gene 54 4e-04
224emb|X64327.1|LGNPR1 L.gibba gene NPR1 (negatively phytochrome re... 54 4e-04
225gb|BT002226.1| Arabidopsis thaliana At5g66400/K1F13_5 mRNA, comp... 54 4e-04
226gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydratio... 52 0.002
227gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type d... 52 0.002
228gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod6... 52 0.002
229dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
230gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence 52 0.002
231dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
232dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
233dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
234dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds 52 0.002
235gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, ... 50 0.006
236gb|AY266052.1| Deschampsia antarctica dehydrin-like protein pseu... 50 0.006
237emb|X83597.1|STDHN1 S.tuberosum dhn1 gene 50 0.006
238emb|X83596.1|SCDHN1 S.commersonii dhn1 gene 50 0.006
239gb|AY160772.1| Citrus x paradisi dehydrin mRNA, complete cds 50 0.006
240gb|AY105067.1| Zea mays PCO081051 mRNA sequence 50 0.006
241dbj|AP006422.1| Lotus japonicus genomic DNA, chromosome 2, clone... 50 0.006
242gb|M94012.1|SOYMATSGB Glycine max maturation-associated protein ... 50 0.006
243gb|M81655.1|COTLEA3B Gossypium hirsutum dehydrin (Lea3-D147) gen... 50 0.006
244gb|U10111.1|GMU10111 Glycine max Essex dehydrin-like protein mRN... 50 0.006
245dbj|AB010898.1| Daucus carota mRNA for ecpp44, complete cds 50 0.006
246gb|AY607706.1| Quercus robur dehydrin 2 (Dhn2) mRNA, partial cds 48 0.024
247emb|AJ704825.1| Glycine max partial lea8 gene for putative dehydrin 48 0.024
248emb|AJ844016.1| Plantago major partial mRNA for hypothetical pro... 48 0.024
249gb|U91970.1|PSU91970 Pisum sativum dehydrin 3 (Dhn3) mRNA, compl... 48 0.024
250gb|U91969.1|PSU91969 Pisum sativum dehydrin 2 (Dhn2) mRNA, compl... 48 0.024
251emb|AJ622891.1| Triticum durum partial mRNA for DRP4 protein (dr... 48 0.024
252emb|X63062.1|PSDHN2 P.sativum mRNA for dehydrin DHN2 48 0.024
253gb|AY303803.1| Brassica napus cultivar Q2 dehydrin (DHN1) mRNA, ... 46 0.094
254emb|Y07600.2|PVIBP32 Pistacia vera mRNA for dehydrin (COR gene) 46 0.094
255emb|Y15813.1|SCRNADHN1 Solanum commersonii mRNA for DHN1 protein 46 0.094
256emb|X56280.1|RSLEAPR R.sativus mRNA for late embryogenesis abund... 46 0.094
257gb|AY130999.1| Brassica juncea dehydrin (DHN1) gene, complete cds 46 0.094
258gb|AY130998.1| Brassica juncea dehydrin (DHN1) mRNA, complete cds 46 0.094
259ref|NM_180616.2| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) tr... 44 0.37
260ref|NM_101895.3| Arabidopsis thaliana ERD10 AT1G20450 (ERD10) tr... 44 0.37
261gb|BT019045.1| Zea mays clone Contig566.F mRNA sequence 44 0.37
262gb|DQ487110.1| Panax ginseng dehydrin 5 (Dhn5) mRNA, complete cds 44 0.37
263gb|AY574032.1| Triticum aestivum dehydrin-like gene, partial seq... 44 0.37
264emb|AJ890140.1| Triticum turgidum subsp. durum mRNA for dehydrin... 44 0.37
265gb|AY142491.1| Arabidopsis thaliana unknown protein (At1g20450) ... 44 0.37
266gb|AF360351.1| Arabidopsis thaliana unknown protein (At1g20450) ... 44 0.37
267gb|AY136407.1| Arabidopsis thaliana unknown protein mRNA, comple... 44 0.37
268gb|AY048208.1| Arabidopsis thaliana At1g20450/F5M15_20 mRNA, com... 44 0.37
269gb|L35913.1|MZELIPASE Zea mays dehydrin (dhn-2) mRNA, complete cds 44 0.37
270gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana... 44 0.37
271emb|AJ300525.4|PEU300525 Populus euramericana mRNA for putative ... 44 0.37
272dbj|D17714.1|ATHERD10 Arabidopsis thaliana mRNA for ERD10 protei... 44 0.37
273emb|X94979.1|BOPC34 B.oleracea mRNA for pollen coat protein (clo... 44 0.37
274emb|X90958.1|ATDLTI29G A.thaliana lti29 gene 44 0.37
275emb|X84056.1|HVPAF93 H.vulgare paf93 gene 44 0.37
276emb|X77614.1|ATLTI45 A.thaliana (Landsberg Erecta) lti45 mRNA 44 0.37
277gb|BT002131.1| Arabidopsis thaliana unknown protein mRNA, comple... 44 0.37
278gb|AY111114.1| Zea mays CL2452_1 mRNA sequence 44 0.37
279gb|AF043093.1|AF043093 Hordeum vulgare dehydrin 8 (dhn8) gene, c... 44 0.37
280gb|AC005685.1|AC005685 Homo sapiens clone UWGC:g1397a149 from 7p... 44 0.37
281gb|U73211.1|TAU73211 Triticum aestivum cold acclimation protein ... 44 0.37
282gb|U73210.1|TAU73210 Triticum aestivum cold acclimation protein ... 44 0.37
283gb|L29152.1|WHTWCOR Triticum aestivum cold acclimation protein (... 44 0.37
284ref|NM_101894.3| Arabidopsis thaliana COR47 AT1G20440 (COR47) mR... 42 1.5
285ref|XM_515281.1| PREDICTED: Pan troglodytes similar to Transcrip... 42 1.5
286gb|AY737725.1| Salvia miltiorrhiza dehydrin mRNA, partial cds 42 1.5
287gb|AY695932.1| Salvia miltiorrhiza dehydration protein (bdn1) mR... 42 1.5
288gb|DQ226960.1| Boechera divaricarpa isolate AD-B10 mRNA sequence 42 1.5
289gb|AY706990.1| Vitis vinifera dehydrin 1b (DHN1b) gene, complete... 42 1.5
290gb|AY706989.1| Vitis vinifera dehydrin 1a (DHN1a) gene, complete... 42 1.5
291gb|AY706988.1| Vitis riparia dehydrin 1b (DHN1b) gene, partial s... 42 1.5
292gb|AY706987.1| Vitis riparia dehydrin 1a (DHN1a) gene, complete ... 42 1.5
293gb|AC146272.3| Pan troglodytes BAC clone RP43-29H6 from 7, compl... 42 1.5
294gb|AC142352.1| Pan troglodytes BAC clone RP43-21K18 from 7, comp... 42 1.5
295gb|AY114699.1| Arabidopsis thaliana unknown protein (At1g20440) ... 42 1.5
296gb|AY072392.1| Arabidopsis thaliana unknown protein (At1g20440) ... 42 1.5
297gb|AY351918.1| Glycine max lea protein (ZLDE-2) mRNA, complete cds 42 1.5
298gb|AY634281.1| Vitis vinifera dehydrin mRNA, complete cds 42 1.5
299gb|AY297793.1| Citrus sinensis dehydrin (DHN) mRNA, complete cds 42 1.5
300emb|AJ583802.1| Glycine max lea-D-11 gene for dehydrin, cultivar... 42 1.5
301emb|AJ583800.1| Glycine max lea-D-11 gene for dehydrin, cultivar... 42 1.5
302emb|AJ583799.1| Glycine max lea-D-11 gene for dehydrin, cultivar... 42 1.5
303dbj|AB004872.1| Arabidopsis thaliana DNA for COR47, complete cds 42 1.5
304emb|X90959.1|ATCOR47G A.thaliana cor47 gene 42 1.5
305gb|AF220407.1|AF220407 Vitis riparia dehydrin-like protein (Dhn)... 42 1.5
306emb|X59814.1|ATCOR47 A.thaliana cor47 mRNA 42 1.5
307gb|L13415.1|ALFCOLACSP Medicago sativa (clone pAcs784a) cold acl... 42 1.5
308gb|M93568.1|SOYMATSGA Glycine max maturation-assocated protein (... 42 1.5
309gb|L00921.1|SOYMATPRO Soybean maturation protein (MAT1) gene, co... 42 1.5
310ref|NM_127721.2| Arabidopsis thaliana unknown protein AT2G21490 ... 40 5.8
311gb|DQ111949.1| Prunus persica type II SK2 dehydrin (dhn3) mRNA, ... 40 5.8
312gb|AF521665.1| Azoarcus sp. CIB anaerobic benzoate catabolism ge... 40 5.8
313gb|BC046037.1| Danio rerio zgc:56269, mRNA (cDNA clone MGC:56269... 40 5.8
314gb|BC049470.1| Danio rerio apolipoprotein Eb, mRNA (cDNA clone M... 40 5.8
315ref|NM_131098.1| Danio rerio apolipoprotein Eb (apoeb), mRNA 40 5.8
316gb|AY159329.1| Nicotiana alata haplotype S7 hypothetical pollen ... 40 5.8
317gb|AY159328.1| Nicotiana alata haplotype S6 hypothetical pollen ... 40 5.8
318gb|AY159327.1| Nicotiana alata haplotype S3 hypothetical pollen ... 40 5.8
319gb|AY159326.1| Nicotiana alata haplotype S2 hypothetical pollen ... 40 5.8
320gb|AY159325.1| Nicotiana alata haplotype S1 hypothetical pollen ... 40 5.8
321gb|BT000900.1| Arabidopsis thaliana clone C105061 putative dehyd... 40 5.8
322gb|AC132133.1| Mus musculus BAC clone RP23-242A12 from 17, compl... 40 5.8
323gb|AF411554.1| Medicago sativa dehydrin-like protein mRNA, compl... 40 5.8
324emb|Y13652.1|DRAPLIPE Danio rerio mRNA for apolipoprotein E prec... 40 5.8
325emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 5.8
326emb|AJ428529.1|AEV428529 Azoarcus evansii bzdN gene, bzdO gene, ... 40 5.8
327emb|AJ236882.1|DRE236882 Danio rerio apoE gene, exons 1-5 40 5.8
328gb|BC065592.1| Danio rerio apolipoprotein Eb, mRNA (cDNA clone M... 40 5.8
329emb|BX510334.6| Zebrafish DNA sequence from clone DKEY-4D11 in l... 40 5.8
330emb|BX663604.9| Zebrafish DNA sequence from clone CH211-222K9 in... 40 5.8
331emb|BX546480.9| Zebrafish DNA sequence from clone DKEY-175C11, c... 40 5.8
332gb|AC006841.7| Arabidopsis thaliana chromosome 2 clone F3K23 map... 40 5.8
333gb|AC104837.2| Homo sapiens chromosome 1 clone RP4-641G12, compl... 40 5.8
334dbj|AK149200.1| Mus musculus 2 days neonate sympathetic ganglion... 40 5.8
335dbj|AK147619.1| Mus musculus adult male brain UNDEFINED_CELL_LIN... 40 5.8
336ref|XM_694127.1| PREDICTED: Danio rerio similar to apolipoprotei... 40 5.8
337gb|AY061911.1| Arabidopsis thaliana At2g21490/F3K23.25 mRNA, com... 40 5.8
338gb|AY052342.1| Arabidopsis thaliana At2g21490/F3K23.25 mRNA, com... 40 5.8
339dbj|AK014407.1| Mus musculus 12 days embryo embryonic body below... 40 5.8
340gb|AC007251.4| Homo sapiens BAC clone RP11-373G23 from 2, comple... 40 5.8
341dbj|AB162154.1| Chlamydomonas sp. W80 lea3 mRNA for group 3 late... 40 5.8
342gb|AY956844.1| Azoarcus toluvorans strain Td21 putative benzoyl-... 40 5.8
343gb|AY956842.1| Azoarcus tolulyticus strain 2FB6 putative benzoyl... 40 5.8
344gb|AY956841.1| Azoarcus tolulyticus strain Tol4 putative benzoyl... 40 5.8
345gb|AY088292.1| Arabidopsis thaliana clone 5256 mRNA, complete se... 40 5.8
346gb|AY170010.1| Cicer pinnatifidum dehydrin 1 mRNA, complete cds 40 5.8
347emb|BX004983.8| Zebrafish DNA sequence from clone DKEY-7F3, comp... 40 5.8
348emb|X63061.1|PSDHN1 P.sativum mRNA for dehydrin DHN1 40 5.8
349emb|AJ277643.1|NAL277643 Nicotiana alata 48A gene 40 5.8
350emb|X92650.1|HADEHYR H.annuus mRNA for dehydrin related protein 40 5.8
351emb|X91920.1|ATDEHYDRN A.thaliana mRNA for dehydrin protein 40 5.8
352gb|AC148214.3| Monodelphis domestica clone VMRC6-307F8, complete... 40 5.8
353gb|AF209908.1|AF209908 Prunus dulcis unknown mRNA 40 5.8
354gb|AY106495.1| Zea mays PCO063105 mRNA sequence 40 5.8
355emb|X63063.1|PSDHN3 P.sativum mRNA for dehydrin DHN3 40 5.8
356gb|AE017226.1| Treponema denticola ATCC 35405, complete genome 40 5.8
357ref|NM_024436.1| Mus musculus RAB22A, member RAS oncogene family... 40 5.8
358gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold 40 5.8
359ref|NM_199762.1| Danio rerio zgc:56269 (zgc:56269), mRNA 40 5.8
360emb|AL845503.5| Mouse DNA sequence from clone RP23-292G16 on chr... 40 5.8
361gb|L07516.1|ALFCAS18A Alfalfa cold acclimation-specific protein ... 40 5.8

>gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, complete cds
          Length = 2440

 Score =  829 bits (418), Expect = 0.0
 Identities = 428/430 (99%), Gaps = 1/430 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    gcgaggaccataccgtaagcatacatagataccatggttgaaccaaaaaggaaatttaca 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1841 gcgaggaccataccgtaagcatacatagataccatggttgaaccaaaaaggaaatttaca 1782

                                                                        
Query: 61   agattatatagtgtaaacagacgaaaacactcttaacacagtgttgttcacgtaaacttg 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1781 agattatatagtgtaaacagacgaaaacactcttaacacagtgttgttcacgtaaacttg 1722

                                                                        
Query: 121  aactagatacattcgcccctccaacagccaagtgagctaggtgaactatgctcacgttgt 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1721 aactagatacattcgcccctccaacagccaagtgagctaggtgaactatgctcacgttgt 1662

                                                                        
Query: 181  atggtggaattttattgtatcgccatcttattattgattctgcaacggtggtcgaccggc 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1661 atggtggaattttattgtatcgccatcttattattgattctgcaacggtggtcgaccggc 1602

                                                                        
Query: 241  acctccacactcaaaagtggcggccgcgggggctgggctcggagcgctcagtgctggcca 300
            ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1601 acctccacactcagaagtggcgg-cgcgggggctgggctcggagcgctcagtgctggcca 1543

                                                                        
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgccgtgc 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1542 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgccgtgc 1483

                                                                        
Query: 361  tgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgc 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1482 tgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgc 1423

                      
Query: 421  tgcccgtagg 430
            ||||||||||
Sbjct: 1422 tgcccgtagg 1413



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
            ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 1209 ccagggagcttctccttgatcttctccttgatgcccttcttc 1168



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 400  gtcatcccggtgtggccctgctgcccgtagg 430
            |||||||| ||||| ||||||||||||||||
Sbjct: 1320 gtcatcccagtgtgaccctgctgcccgtagg 1290



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 358  tgctgcccgtaggtgccaccggtg 381
            ||||||||||||||||| ||||||
Sbjct: 1425 tgctgcccgtaggtgccgccggtg 1402



to top

>gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, complete cds
          Length = 2790

 Score =  809 bits (408), Expect = 0.0
 Identities = 420/423 (99%), Gaps = 1/423 (0%)
 Strand = Plus / Minus

                                                                        
Query: 9    cataccgtaagcatacatagataccatggttgaaccaaaaaggaaatttacaagattata 68
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2483 cataccgtaagcatacatagataccatggttgaaccaaaaaggaaatttacaagattata 2424

                                                                        
Query: 69   tagtgtaaacagacgaaaacactcttaacacagtgttgttcacgtaaacttgaac-taga 127
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 2423 tagtgtaaacagacgaaaacactcttaacacagtgttgttcacgtaaacttgaacctaga 2364

                                                                        
Query: 128  tacattcgcccctccaacagccaagtgagctaggtgaactatgctcacgttgtatggtgg 187
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2363 tacattcgcccctccaacagccaagtgagctaggtgaactatgctcacgttgtatggtgg 2304

                                                                        
Query: 188  aattttattgtatcgccatcttattattgattctgcaacggtggtcgaccggcacctcca 247
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2303 aattttattgtatcgccatcttattattgattctgcaacggtggtcgaccggcacctcca 2244

                                                                        
Query: 248  cactcaaaagtggcggccgcgggggctgggctcggagcgctcagtgctggccagggagct 307
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2243 cactcagaagtggcggccgcgggggctgggctcggagcgctcagtgctggccagggagct 2184

                                                                        
Query: 308  tctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgccgtgctgcccgt 367
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2183 tctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgccgtgctgcccgt 2124

                                                                        
Query: 368  aggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgt 427
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2123 aggtgccaccggtgccntgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgt 2064

               
Query: 428  agg 430
            |||
Sbjct: 2063 agg 2061



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                        
Query: 358  tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2073 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 2014

                         
Query: 418  tgctgcccgtagg 430
            |||||||||||||
Sbjct: 2013 tgctgcccgtagg 2001



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                        
Query: 358  tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2013 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 1954

                         
Query: 418  tgctgcccgtagg 430
            |||||||||||||
Sbjct: 1953 tgctgcccgtagg 1941



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
            ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 1737 ccagggagcttctccttgatcttctccttgatgcccttcttc 1696



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 400  gtcatcccggtgtggccctgctgcccgtagg 430
            |||||||| ||||| ||||||||||||||||
Sbjct: 1848 gtcatcccagtgtgaccctgctgcccgtagg 1818



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 358  tgctgcccgtaggtgccaccggtg 381
            ||||||||||||||||| ||||||
Sbjct: 1953 tgctgcccgtaggtgccgccggtg 1930



to top

>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18)
          Length = 1049

 Score =  728 bits (367), Expect = 0.0
 Identities = 409/423 (96%), Gaps = 10/423 (2%)
 Strand = Plus / Minus

                                                                        
Query: 9    cataccgtaagcatacatagataccatggttgaaccaaaaaggaaatttacaagattata 68
            |||||||||||||||||||||||||||||||||||||||||||||||||||         
Sbjct: 1023 cataccgtaagcatacatagataccatggttgaaccaaaaaggaaatttac--------- 973

                                                                        
Query: 69   tagtgtaaacagacgaaaacactcttaacacagtgttgttcacgtaaacttgaac-taga 127
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 972  tagtgtaaacagacgaaaacactcttaacacagtgttgttcacgtaaacttgaacctaga 913

                                                                        
Query: 128  tacattcgcccctccaacagccaagtgagctaggtgaactatgctcacgttgtatggtgg 187
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 912  tacattcgcccctccaacagccaagtgagctaggtgaactatgctcacgttgtatggtgg 853

                                                                        
Query: 188  aattttattgtatcgccatcttattattgattctgcaacggtggtcgaccggcacctcca 247
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 852  aattttattgtatcgccatcttattattgattctgcaacggtggtcgaccggcacctcca 793

                                                                        
Query: 248  cactcaaaagtggcggccgcgggggctgggctcggagcgctcagtgctggccagggagct 307
            |||||| |||||||||||||||||||||||||||||||||||||||||| || || ||||
Sbjct: 792  cactcagaagtggcggccgcgggggctgggctcggagcgctcagtgctgtccgggcagct 733

                                                                        
Query: 308  tctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgccgtgctgcccgt 367
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 732  tctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgccgtgctgcccgt 673

                                                                        
Query: 368  aggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgt 427
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 672  aggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgt 613

               
Query: 428  agg 430
            |||
Sbjct: 612  agg 610



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 622 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 563

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 562 tgctgcccgtagg 550



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 346 ccagggagcttctccttgatcttctccttgatgcccttcttc 305



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 457 gtcatcccagtgtgaccctgctgcccgtagg 427



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 562 tgctgcccgtaggtgccgccggtg 539



to top

>emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin
          Length = 1016

 Score =  694 bits (350), Expect = 0.0
 Identities = 412/430 (95%), Gaps = 2/430 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   gcgaggaccataccgtaagcatacatagataccatggttgaaccaaaaaggaaatttaca 60
           |||||||||||||||||||||||| ||||||||| |  | |||||||||| |||||||||
Sbjct: 990 gcgaggaccataccgtaagcatac-tagataccaggtgttaaccaaaaag-aaatttaca 933

                                                                       
Query: 61  agattatatagtgtaaacagacgaaaacactcttaacacagtgttgttcacgtaaacttg 120
           ||||||||||||||||| | |  ||||||||||||||||||||||||||   ||||||||
Sbjct: 932 agattatatagtgtaaagacagcaaaacactcttaacacagtgttgttcgactaaacttg 873

                                                                       
Query: 121 aactagatacattcgcccctccaacagccaagtgagctaggtgaactatgctcacgttgt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 872 aactagatacattcgcccctccaacagccaagtgagctaggtgaactatgctcacgttgt 813

                                                                       
Query: 181 atggtggaattttattgtatcgccatcttattattgattctgcaacggtggtcgaccggc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 812 atggtggaattttattgtatcgccatcttattattgattctgcaacggtggtccaccggc 753

                                                                       
Query: 241 acctccacactcaaaagtggcggccgcgggggctgggctcggagcgctcagtgctggcca 300
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 752 acctccacactcagaagtggcggccgcgggggctgggctcggagcgctcagtgctggcca 693

                                                                       
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgccgtgc 360
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 692 aggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgccgtgc 633

                                                                       
Query: 361 tgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgc 420
           ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 632 tgcccgtaggtgccaccggtgccctgcatgcccgtgcctgtcatcccggtgtggccttgc 573

                     
Query: 421 tgcccgtagg 430
           ||||||||||
Sbjct: 572 tgcccgtagg 563



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 359 ccagggagcttctccttgatcttctccttgatgcccttcttc 318



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 575 tgctgcccgtaggtgccgccggtg 552



to top

>gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 920

 Score =  553 bits (279), Expect = e-154
 Identities = 282/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 920 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 861

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 860 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 801

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 800 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 741

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 740 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 681

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 680 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 638



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 650 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 591

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 590 tgctgcccgtagg 578



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 374 ccagggagcttctccttgatcttctccttgatgcccttcttc 333



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 485 gtcatcccagtgtgaccctgctgcccgtagg 455



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 590 tgctgcccgtaggtgccgccggtg 567



to top

>gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 921

 Score =  553 bits (279), Expect = e-154
 Identities = 282/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 921 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 862

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 861 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 802

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 801 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 742

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 682

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 639



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 651 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 592

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 591 tgctgcccgtagg 579



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 375 ccagggagcttctccttgatcttctccttgatgcccttcttc 334



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 486 gtcatcccagtgtgaccctgctgcccgtagg 456



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 591 tgctgcccgtaggtgccgccggtg 568



to top

>gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 921

 Score =  553 bits (279), Expect = e-154
 Identities = 282/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 921 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 862

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 861 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 802

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 801 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 742

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 682

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 639



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 651 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 592

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 591 tgctgcccgtagg 579



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 375 ccagggagcttctccttgatcttctccttgatgcccttcttc 334



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 402 catcccggtgtggccctgctgcccgtagg 430
           ||||||||||||||||||||| |||||||
Sbjct: 538 catcccggtgtggccctgctgtccgtagg 510



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 486 gtcatcccagtgtgaccctgctgcccgtagg 456



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 591 tgctgcccgtaggtgccgccggtg 568



to top

>gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  553 bits (279), Expect = e-154
 Identities = 282/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 922 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 863

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 862 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 803

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 743

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 683

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 640



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 593

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 592 tgctgcccgtagg 580



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 487 gtcatcccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 592 tgctgcccgtaggtgccgccggtg 569



to top

>gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 921

 Score =  553 bits (279), Expect = e-154
 Identities = 282/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 921 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 862

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 861 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 802

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 801 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 742

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 682

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 639



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 651 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 592

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 591 tgctgcccgtagg 579



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 375 ccagggagcttctccttgatcttctccttgatgcccttcttc 334



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 486 gtcatcccagtgtgaccctgctgcccgtagg 456



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 591 tgctgcccgtaggtgccgccggtg 568



to top

>gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 980

 Score =  553 bits (279), Expect = e-154
 Identities = 282/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 980 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 921

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 920 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 861

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 860 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 801

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 800 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 741

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 740 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 698



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 710 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 651

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 650 tgctgcccgtagg 638



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 650 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 591

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 590 tgctgcccgtagg 578



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 374 ccagggagcttctccttgatcttctccttgatgcccttcttc 333



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 485 gtcatcccagtgtgaccctgctgcccgtagg 455



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 590 tgctgcccgtaggtgccgccggtg 567



to top

>gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 916

 Score =  553 bits (279), Expect = e-154
 Identities = 282/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 916 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 857

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 856 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 797

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 796 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 737

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 736 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 677

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 676 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 634



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 646 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 587

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 586 tgctgcccgtagg 574



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 370 ccagggagcttctccttgatcttctccttgatgcccttcttc 329



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 481 gtcatcccagtgtgaccctgctgcccgtagg 451



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 586 tgctgcccgtaggtgccgccggtg 563



to top

>gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  545 bits (275), Expect = e-152
 Identities = 281/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 922 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccgtc 863

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 862 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 803

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 743

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 683

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 640



 Score =  129 bits (65), Expect = 8e-27
 Identities = 71/73 (97%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 652 tgctgcccgtaggtgccgccggtgccgtgcatgcccgtgcctgtcatcccggtgtgaccc 593

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 592 tgctgcccgtagg 580



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 487 gtcatcccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 592 tgctgcccgtaggtgccgccggtg 569



to top

>gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  545 bits (275), Expect = e-152
 Identities = 281/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 922 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccgtc 863

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 862 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 803

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 743

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 683

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 640



 Score =  129 bits (65), Expect = 8e-27
 Identities = 71/73 (97%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 652 tgctgcccgtaggtgccgccggtgccgtgcatgcccgtgcctgtcatcccggtgtgaccc 593

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 592 tgctgcccgtagg 580



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 487 gtcatcccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 592 tgctgcccgtaggtgccgccggtg 569



to top

>gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  545 bits (275), Expect = e-152
 Identities = 281/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 922 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccgtc 863

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 862 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 803

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 743

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 683

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 640



 Score =  129 bits (65), Expect = 8e-27
 Identities = 71/73 (97%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 652 tgctgcccgtaggtgccgccggtgccgtgcatgcccgtgcctgtcatcccggtgtgaccc 593

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 592 tgctgcccgtagg 580



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 487 gtcatcccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 592 tgctgcccgtaggtgccgccggtg 569



to top

>gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 919

 Score =  545 bits (275), Expect = e-152
 Identities = 281/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 919 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 860

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||
Sbjct: 859 ttattattgattctgcaacggtggtcaaccggcacctccacactcagaagtggcggccgc 800

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 799 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 740

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 739 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 680

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 679 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 637



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 649 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 590

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 589 tgctgcccgtagg 577



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 373 ccagggagcttctccttgatcttctccttgatgcccttcttc 332



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 484 gtcatcccagtgtgaccctgctgcccgtagg 454



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 589 tgctgcccgtaggtgccgccggtg 566



to top

>gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  545 bits (275), Expect = e-152
 Identities = 281/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 922 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 863

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||
Sbjct: 862 ttattattgattctgcaacgctggtcgaccggcacctccacactcagaagtggcggccgc 803

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 743

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 683

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 640



 Score =  137 bits (69), Expect = 3e-29
 Identities = 72/73 (98%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 tgctgcccgtaggtgccgccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 593

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 592 tgctgcccgtagg 580



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 487 gtcatcccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 592 tgctgcccgtaggtgccgccggtg 569



to top

>gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  545 bits (275), Expect = e-152
 Identities = 281/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 922 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 863

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||
Sbjct: 862 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaggtggcggccgc 803

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 743

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 683

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 640



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 593

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 592 tgctgcccgtagg 580



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 487 gtcatcccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 592 tgctgcccgtaggtgccgccggtg 569



to top

>gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  545 bits (275), Expect = e-152
 Identities = 281/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 922 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 863

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||
Sbjct: 862 ttattattgattctgcaacgctggtcgaccggcacctccacactcagaagtggcggccgc 803

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 743

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 683

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 640



 Score =  137 bits (69), Expect = 3e-29
 Identities = 72/73 (98%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 tgctgcccgtaggtgccgccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 593

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 592 tgctgcccgtagg 580



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 487 gtcatcccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 592 tgctgcccgtaggtgccgccggtg 569



to top

>gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 922

 Score =  545 bits (275), Expect = e-152
 Identities = 281/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 922 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 863

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||
Sbjct: 862 ttattattgattctgcaacgctggtcgaccggcacctccacactcagaagtggcggccgc 803

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 743

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 683

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 640



 Score =  137 bits (69), Expect = 3e-29
 Identities = 72/73 (98%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 tgctgcccgtaggtgccgccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 593

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 592 tgctgcccgtagg 580



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 487 gtcatcccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 592 tgctgcccgtaggtgccgccggtg 569



to top

>gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 910

 Score =  537 bits (271), Expect = e-149
 Identities = 280/283 (98%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 910 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 851

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 850 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 791

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 790 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 731

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||
Sbjct: 730 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgcccccggcgccgtgc 671

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 670 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 628



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 379 ccagggagcttctccttgatcttctccttgatgcccttcttc 338



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 595 gtgccggtcatcccggtgtggccttgctgtccgtagg 559



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 517 tgctgcccgtaggtgccgccggtgccg 491



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 472 tgctgcccgtaggtgccgccggtgccg 446



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 541 gtgccggtcatgccagtgtgaccctgctgcccgtagg 505



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 496 gtgccggtcatgccagtgtgaccctgctgcccgtagg 460



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 640 tgctgcccgtaggtgccgccggtg 617



to top

>gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score =  537 bits (271), Expect = e-149
 Identities = 280/283 (98%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 907 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 848

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 847 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 788

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 787 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 728

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||
Sbjct: 727 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgcccccggcgccgtgc 668

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 667 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 625



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 592 gtgccggtcatcccggtgtggccttgctgtccgtagg 556



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 514 tgctgcccgtaggtgccgccggtgccg 488



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 469 tgctgcccgtaggtgccgccggtgccg 443



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtagg 502



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 637 tgctgcccgtaggtgccgccggtg 614



to top

>gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score =  537 bits (271), Expect = e-149
 Identities = 280/283 (98%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 907 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 848

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 847 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 788

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 787 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 728

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||
Sbjct: 727 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgcccccggcgccgtgc 668

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 667 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 625



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 592 gtgccggtcatcccggtgtggccttgctgtccgtagg 556



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 514 tgctgcccgtaggtgccgccggtgccg 488



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 469 tgctgcccgtaggtgccgccggtgccg 443



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtagg 502



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 637 tgctgcccgtaggtgccgccggtg 614



to top

>gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score =  537 bits (271), Expect = e-149
 Identities = 280/283 (98%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 907 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 848

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 847 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 788

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 787 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 728

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||
Sbjct: 727 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgcccccggcgccgtgc 668

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 667 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 625



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 592 gtgccggtcatcccggtgtggccttgctgtccgtagg 556



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 514 tgctgcccgtaggtgccgccggtgccg 488



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 469 tgctgcccgtaggtgccgccggtgccg 443



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtagg 502



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 637 tgctgcccgtaggtgccgccggtg 614



to top

>gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 904

 Score =  537 bits (271), Expect = e-149
 Identities = 280/283 (98%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 904 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 845

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 844 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 785

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 784 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 725

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||
Sbjct: 724 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgcccccggcgccgtgc 665

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 664 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 622



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 373 ccagggagcttctccttgatcttctccttgatgcccttcttc 332



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 589 gtgccggtcatcccggtgtggccttgctgtccgtagg 553



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 511 tgctgcccgtaggtgccgccggtgccg 485



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 466 tgctgcccgtaggtgccgccggtgccg 440



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 535 gtgccggtcatgccagtgtgaccctgctgcccgtagg 499



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 490 gtgccggtcatgccagtgtgaccctgctgcccgtagg 454



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 634 tgctgcccgtaggtgccgccggtg 611



to top

>gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 907

 Score =  537 bits (271), Expect = e-149
 Identities = 280/283 (98%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 907 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 848

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 847 ttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccgc 788

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 787 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 728

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||
Sbjct: 727 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgcccccggcgccgtgc 668

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 667 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 625



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 592 gtgccggtcatcccggtgtggccttgctgtccgtagg 556



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 514 tgctgcccgtaggtgccgccggtgccg 488



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 469 tgctgcccgtaggtgccgccggtgccg 443



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtagg 502



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 637 tgctgcccgtaggtgccgccggtg 614



to top

>gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 924

 Score =  535 bits (270), Expect = e-149
 Identities = 282/285 (98%), Gaps = 2/285 (0%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagcta--ggtgaactatgctcacgttgtatggtggaattttattgtatcgcca 205
           ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 924 ccaagtgagctataggtgaactatgctcacgttgtatggtggaattttattgtatcgcca 865

                                                                       
Query: 206 tcttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggcc 265
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 864 tcttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggcc 805

                                                                       
Query: 266 gcgggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtcca 325
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 804 gcgggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtcca 745

                                                                       
Query: 326 tgatgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgt 385
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 744 tgatgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgt 685

                                                        
Query: 386 gcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 684 gcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 640



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 593

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 592 tgctgcccgtagg 580



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 487 gtcatcccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 592 tgctgcccgtaggtgccgccggtg 569



to top

>gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 908

 Score =  523 bits (264), Expect = e-145
 Identities = 280/284 (98%), Gaps = 1/284 (0%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgag-ctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccat 206
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 908 ccaagtgaggctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccat 849

                                                                       
Query: 207 cttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccg 266
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 848 cttattattgattctgcaacggtggtcgaccggcacctccacactcagaagtggcggccg 789

                                                                       
Query: 267 cgggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccat 326
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 788 cgggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccat 729

                                                                       
Query: 327 gatgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtg 386
           |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||
Sbjct: 728 gatgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgcccccggcgccgtg 669

                                                       
Query: 387 catgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 668 catgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 625



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 376 ccagggagcttctccttgatcttctccttgatgcccttcttc 335



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||||||||||||||| ||||| |||||||
Sbjct: 592 gtgccggtcatcccggtgtggccttgctgtccgtagg 556



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 514 tgctgcccgtaggtgccgccggtgccg 488



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 469 tgctgcccgtaggtgccgccggtgccg 443



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 538 gtgccggtcatgccagtgtgaccctgctgcccgtagg 502



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 493 gtgccggtcatgccagtgtgaccctgctgcccgtagg 457



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 637 tgctgcccgtaggtgccgccggtg 614



to top

>gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 4
           (Dhn4) gene, complete cds
          Length = 906

 Score =  521 bits (263), Expect = e-145
 Identities = 278/283 (98%)
 Strand = Plus / Minus

                                                                       
Query: 148 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 906 ccaagtgagctaggtgaactatgctcacgttgtatggtggaattttattgtatcgccatc 847

                                                                       
Query: 208 ttattattgattctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgc 267
           |||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||
Sbjct: 846 ttattattgattctgcaacgctggtcgaccggcacctccacgctcagaagtggcggccgc 787

                                                                       
Query: 268 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 786 gggggctgggctcggagcgctcagtgctggccagggagcttctccttgatcttgtccatg 727

                                                                       
Query: 328 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgc 387
           ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||
Sbjct: 726 atgcccttcttctcgccggtgtcggtgccgtgctgcccgtaggtgcccccggcgccgtgc 667

                                                      
Query: 388 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 666 atgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 624



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 375 ccagggagcttctccttgatcttctccttgatgcccttcttc 334



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||||||||| || ||||| ||||||||||||||||
Sbjct: 537 gtgcctgtcatgccagtgtgaccctgctgcccgtagg 501



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           ||||||||||||||||| ||||| |||||||
Sbjct: 585 gtcatcccggtgtggccttgctgtccgtagg 555



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 513 tgctgcccgtaggtgccgccggtgccg 487



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 468 tgctgcccgtaggtgccgccggtgccg 442



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 492 gtgccggtcatgccagtgtgaccctgctgcccgtagg 456



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 636 tgctgcccgtaggtgccgccggtg 613



to top

>emb|X62476.1|TARAB15B T.aestivum rab15B mRNA
          Length = 1068

 Score =  418 bits (211), Expect = e-114
 Identities = 351/391 (89%), Gaps = 15/391 (3%)
 Strand = Plus / Minus

                                                                        
Query: 49   aggaaatttacaagattatatagtgtaa---acagacgaaaacactcttaacacagtgtt 105
            |||||| ||||||||||||| |||||||   ||||||||||| ||||  ||||| || ||
Sbjct: 1007 aggaaacttacaagattatacagtgtaataaacagacgaaaa-actcaaaacactgt-tt 950

                                                                        
Query: 106  gttcacgtaaacttgaac-tagatacattcgcccctccaacagccaagtgagctaggtga 164
            |||||||||||||||| | |||||||| | || |||||||||  ||||||||||||||||
Sbjct: 949  gttcacgtaaacttgagcctagatacagtggctcctccaacacgcaagtgagctaggtga 890

                                                                        
Query: 165  actatgctcacgttgtatggtggaattttattgtatcg-----ccatcttattattgatt 219
            |||| |||||||||||||||||||||||||||||||||     | |||||||||||||||
Sbjct: 889  actaggctcacgttgtatggtggaattttattgtatcgtatcgcgatcttattattgatt 830

                                                                        
Query: 220  ctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgcgggggctgggct 279
            ||||||||||||||||||||||||||||| |||| ||||||||||||||||  ||   ||
Sbjct: 829  ctgcaacggtggtcgaccggcacctccactctcagaagtggcggccgcgggctctc--ct 772

                                                                        
Query: 280  cggagcgctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttc 339
            |  ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 771  c--agcgctcagtgctggcctgggagcttctccttgatcttgtccatgatgcccttcttc 714

                                                                        
Query: 340  tcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcct 399
            ||||||||||| ||||||||||||||||||||||| ||||||||||||   |||||||||
Sbjct: 713  tcgccggtgtcagtgccgtgctgcccgtaggtgcctccggtgccgtgcgcccccgtgcct 654

                                           
Query: 400  gtcatcccggtgtggccctgctgcccgtagg 430
            |||||||||||||||||| ||||||||||||
Sbjct: 653  gtcatcccggtgtggcccggctgcccgtagg 623



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| ||||||||||||||
Sbjct: 341 gggagcttctccttgatcttctccttgatgcccttcttc 303



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||||||||||||||||||||
Sbjct: 545 gtgccggtcatcccagtgtggccctgctgcccgtagg 509



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| ||||||||||||||||
Sbjct: 500 gtgccggtcatcccagtgtgaccctgctgcccgtagg 464



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 521 tgctgcccgtaggtgccgccggtgccg 495



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 476 tgctgcccgtaggtgccgccggtgccg 450



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 402 catcccggtgtggccctgctgcccgtagg 430
           ||||||||||||||| ||||| |||||||
Sbjct: 582 catcccggtgtggccttgctgtccgtagg 554



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| |||| |||||||||||
Sbjct: 455 gtgccggtcatcccagtgtgacccttctgcccgtagg 419



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 360 ctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||| |||||||||
Sbjct: 429 ctgcccgtaggtgccgccggtgccg 405



to top

>gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, complete cds
          Length = 1124

 Score =  410 bits (207), Expect = e-111
 Identities = 351/391 (89%), Gaps = 16/391 (4%)
 Strand = Plus / Minus

                                                                        
Query: 49   aggaaatttacaagattatatagtgtaa---acagacgaaaacactcttaacacagtgtt 105
            |||||| ||||||||||||| | |||||   ||||||||||| ||||  ||||| || ||
Sbjct: 1021 aggaaacttacaagattatacaatgtaataaacagacgaaaa-actcaaaacactgt-tt 964

                                                                        
Query: 106  gttcacgtaaacttgaac-tagatacattcgcccctccaacagccaagtgagctaggtga 164
            |||||||||||||||| | |||||||| | || ||||||||||| |||||||||||||||
Sbjct: 963  gttcacgtaaacttgagcctagatacagtggctcctccaacagc-aagtgagctaggtga 905

                                                                        
Query: 165  actatgctcacgttgtatggtggaattttattgtatcg-----ccatcttattattgatt 219
            |||| |||||||||||||||||||||||||||||||||     | |||||||||||||||
Sbjct: 904  actaggctcacgttgtatggtggaattttattgtatcgtatcgcgatcttattattgatt 845

                                                                        
Query: 220  ctgcaacggtggtcgaccggcacctccacactcaaaagtggcggccgcgggggctgggct 279
            ||||||||||||||||||||||||||||| |||| ||||||||||||||||  ||   ||
Sbjct: 844  ctgcaacggtggtcgaccggcacctccactctcagaagtggcggccgcgggctctc--ct 787

                                                                        
Query: 280  cggagcgctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttc 339
            |  ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 786  c--agcgctcagtgctggcctgggagcttctccttgatcttgtccatgatgcccttcttc 729

                                                                        
Query: 340  tcgccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcct 399
            ||||||||||| ||||||||||||||||||||||| ||||||||||||   |||||||||
Sbjct: 728  tcgccggtgtcagtgccgtgctgcccgtaggtgcctccggtgccgtgcgcccccgtgcct 669

                                           
Query: 400  gtcatcccggtgtggccctgctgcccgtagg 430
            |||||||||||||||||| ||||||||||||
Sbjct: 668  gtcatcccggtgtggcccggctgcccgtagg 638



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||||||||||||||||||||
Sbjct: 560 gtgccggtcatcccagtgtggccctgctgcccgtagg 524



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 301 gggagcttctccttgatcttgtccatgatgcccttctt 338
           |||||||||||||||||||| ||| | |||||||||||
Sbjct: 356 gggagcttctccttgatcttctccttcatgcccttctt 319



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| ||||||||||||||||
Sbjct: 515 gtgccggtcatcccagtgtgaccctgctgcccgtagg 479



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 536 tgctgcccgtaggtgccgccggtgccg 510



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 358 tgctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||||| |||||||||
Sbjct: 491 tgctgcccgtaggtgccgccggtgccg 465



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 402 catcccggtgtggccctgctgcccgtagg 430
           ||||||||||||||| ||||| |||||||
Sbjct: 597 catcccggtgtggccttgctgtccgtagg 569



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| |||| |||||||||||
Sbjct: 470 gtgccggtcatcccagtgtgacccttctgcccgtagg 434



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 360 ctgcccgtaggtgccaccggtgccg 384
           ||||||||||||||| |||||||||
Sbjct: 444 ctgcccgtaggtgccgccggtgccg 420



to top

>gb|AY895902.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin
           4-like (Dhn4) gene, partial sequence
          Length = 422

 Score =  404 bits (204), Expect = e-110
 Identities = 207/208 (99%)
 Strand = Plus / Minus

                                                                       
Query: 223 caacggtggtcgaccggcacctccacactcaaaagtggcggccgcgggggctgggctcgg 282
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 422 caacggtggtcgaccggcacctccacactcagaagtggcggccgcgggggctgggctcgg 363

                                                                       
Query: 283 agcgctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 362 agcgctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 303

                                                                       
Query: 343 ccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtc 402
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302 ccggtgtcggtgccgtgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtc 243

                                       
Query: 403 atcccggtgtggccctgctgcccgtagg 430
           ||||||||||||||||||||||||||||
Sbjct: 242 atcccggtgtggccctgctgcccgtagg 215



 Score =  145 bits (73), Expect = 1e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                       
Query: 358 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 tgctgcccgtaggtgccaccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccc 168

                        
Query: 418 tgctgcccgtagg 430
           |||||||||||||
Sbjct: 167 tgctgcccgtagg 155



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 400 gtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| ||||||||||||||||
Sbjct: 62  gtcatcccagtgtgaccctgctgcccgtagg 32



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||||||||| ||||||
Sbjct: 167 tgctgcccgtaggtgccgccggtg 144



to top

>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0034E03 map near 50283S, complete sequence
          Length = 134074

 Score =  121 bits (61), Expect = 2e-24
 Identities = 67/69 (97%)
 Strand = Plus / Minus

                                                                         
Query: 286   gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
             |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 60516 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 60457

                      
Query: 346   gtgtcggtg 354
             |||||||||
Sbjct: 60456 gtgtcggtg 60448



 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                         
Query: 286   gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
             |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 82912 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 82853



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                         
Query: 290   agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgt 349
             |||||||||| || ||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 75496 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtgt 75437



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                      
Query: 290   agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
             |||||||||| || |||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 67053 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 66997



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 301   gggagcttctccttgatcttgtccatgatgcccttcttc 339
             |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 82708 gggagcttctccttgatcttctccttgatccccttcttc 82670



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 301   gggagcttctccttgatcttgtccatgatgcccttcttc 339
             |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 75302 gggagcttctccttgatcttctccttgattcccttcttc 75264



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 301   gggagcttctccttgatcttgtccatgatgcccttcttc 339
             |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 60330 gggagcttctccttgatcttctccttgatccccttcttc 60292



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 400   gtcatcccggtgtggccctgctgcccgta 428
             |||||||||| ||||||||||||||||||
Sbjct: 66955 gtcatcccggcgtggccctgctgcccgta 66927



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 304   agcttctccttgatcttgtccatgatgcccttcttc 339
             ||||||||||||||||| ||| |||| |||||||||
Sbjct: 66862 agcttctccttgatcttctccttgattcccttcttc 66827



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 400   gtcatcccggtgtggccctgctgcccgta 428
             |||||||||| ||| ||||||||||||||
Sbjct: 75392 gtcatcccggcgtgcccctgctgcccgta 75364



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 411   gtggccctgctgcccgtagg 430
             ||||||||||||||||||||
Sbjct: 60400 gtggccctgctgcccgtagg 60381



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  121 bits (61), Expect = 2e-24
 Identities = 67/69 (97%)
 Strand = Plus / Plus

                                                                            
Query: 286      gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
                |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14766544 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 14766603

                         
Query: 346      gtgtcggtg 354
                |||||||||
Sbjct: 14766604 gtgtcggtg 14766612



 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Plus

                                                                            
Query: 286      gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
                |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 14744148 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 14744207



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                            
Query: 290      agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgt 349
                |||||||||| || ||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 14751564 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtgt 14751623



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                         
Query: 290      agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
                |||||||||| || |||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 14760007 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 14760063



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                          
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttctcg 342
                |||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 14645649 gggagcttctccttgatcttctccatcatacccttcttctcg 14645690



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttc 339
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14766730 gggagcttctccttgatcttctccttgatccccttcttc 14766768



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttc 339
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14751758 gggagcttctccttgatcttctccttgattcccttcttc 14751796



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttc 339
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14744352 gggagcttctccttgatcttctccttgatccccttcttc 14744390



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttc 339
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14645835 gggagcttctccttgatcttctccttgattcccttcttc 14645873



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 400      gtcatcccggtgtggccctgctgcccgta 428
                |||||||||| ||||||||||||||||||
Sbjct: 14760105 gtcatcccggcgtggccctgctgcccgta 14760133



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 304      agcttctccttgatcttgtccatgatgcccttcttc 339
                ||||||||||||||||| ||| |||| |||||||||
Sbjct: 14760198 agcttctccttgatcttctccttgattcccttcttc 14760233



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 400      gtcatcccggtgtggccctgctgcccgta 428
                |||||||||| ||| ||||||||||||||
Sbjct: 14751668 gtcatcccggcgtgcccctgctgcccgta 14751696



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 411      gtggccctgctgcccgtagg 430
                ||||||||||||||||||||
Sbjct: 14766660 gtggccctgctgcccgtagg 14766679



to top

>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21
          Length = 2537

 Score =  121 bits (61), Expect = 2e-24
 Identities = 67/69 (97%)
 Strand = Plus / Minus

                                                                        
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
            |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2175 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 2116

                     
Query: 346  gtgtcggtg 354
            |||||||||
Sbjct: 2115 gtgtcggtg 2107



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttc 339
            |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 1959 gggagcttctccttgatcttctccttgatccccttcttc 1921



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 411  gtggccctgctgcccgtagg 430
            ||||||||||||||||||||
Sbjct: 2059 gtggccctgctgcccgtagg 2040



to top

>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds
          Length = 864

 Score =  121 bits (61), Expect = 2e-24
 Identities = 67/69 (97%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 525

                    
Query: 346 gtgtcggtg 354
           |||||||||
Sbjct: 524 gtgtcggtg 516



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 411 gtggccctgctgcccgtagg 430
           ||||||||||||||||||||
Sbjct: 468 gtggccctgctgcccgtagg 449



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  121 bits (61), Expect = 2e-24
 Identities = 67/69 (97%)
 Strand = Plus / Plus

                                                                            
Query: 286      gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
                |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14846981 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttctcgccg 14847040

                         
Query: 346      gtgtcggtg 354
                |||||||||
Sbjct: 14847041 gtgtcggtg 14847049



 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Plus

                                                                            
Query: 286      gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
                |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 14824585 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 14824644



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                            
Query: 290      agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgt 349
                |||||||||| || ||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 14832001 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtgt 14832060



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                         
Query: 290      agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
                |||||||||| || |||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 14840444 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 14840500



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                          
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttctcg 342
                |||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 14727650 gggagcttctccttgatcttctccatcatacccttcttctcg 14727691



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttc 339
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14847167 gggagcttctccttgatcttctccttgatccccttcttc 14847205



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttc 339
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14832195 gggagcttctccttgatcttctccttgattcccttcttc 14832233



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttc 339
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14824789 gggagcttctccttgatcttctccttgatccccttcttc 14824827



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 301      gggagcttctccttgatcttgtccatgatgcccttcttc 339
                |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 14727836 gggagcttctccttgatcttctccttgattcccttcttc 14727874



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 400      gtcatcccggtgtggccctgctgcccgta 428
                |||||||||| ||||||||||||||||||
Sbjct: 14840542 gtcatcccggcgtggccctgctgcccgta 14840570



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 304      agcttctccttgatcttgtccatgatgcccttcttc 339
                ||||||||||||||||| ||| |||| |||||||||
Sbjct: 14840635 agcttctccttgatcttctccttgattcccttcttc 14840670



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 400      gtcatcccggtgtggccctgctgcccgta 428
                |||||||||| ||| ||||||||||||||
Sbjct: 14832105 gtcatcccggcgtgcccctgctgcccgta 14832133



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 411      gtggccctgctgcccgtagg 430
                ||||||||||||||||||||
Sbjct: 14847097 gtggccctgctgcccgtagg 14847116



to top

>dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K14, full
           insert sequence
          Length = 709

 Score =  113 bits (57), Expect = 5e-22
 Identities = 66/69 (95%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 613 gctcagtgctggccgggcagcttctccttgatcttgtccatgatgcccttcttcttgccg 554

                    
Query: 346 gtgtcggtg 354
           |||||||||
Sbjct: 553 gtgtcggtg 545



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 427 gggagcttctccttgatcttctccttgatccccttcttc 389



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 411 gtggccctgctgcccgtagg 430
           ||||||||||||||||||||
Sbjct: 497 gtggccctgctgcccgtagg 478



to top

>emb|X52424.1|OSRAB16D O.sativa DNA for rab 16D gene
          Length = 2459

 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                        
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
            |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1529 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 1470



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttc 339
            |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 1325 gggagcttctccttgatcttctccttgatccccttcttc 1287



to top

>dbj|AK109096.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-A09, full
           insert sequence
          Length = 852

 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 563 gctcagtgctggccggggagcttctccttgatcttgtccacgatgcccttcttctcgccg 504



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 359 gggagcttctccttgatcttctccttgatccccttcttc 321



to top

>gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 991 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 932

              
Query: 346 gtg 348
           |||
Sbjct: 931 gtg 929



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 808 gggagcttctccttgatcttctccttcatgcccttcttc 770



to top

>gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 993 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 934

              
Query: 346 gtg 348
           |||
Sbjct: 933 gtg 931



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 810 gggagcttctccttgatcttctccttcatgcccttcttc 772



to top

>gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 991 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 932

              
Query: 346 gtg 348
           |||
Sbjct: 931 gtg 929



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 808 gggagcttctccttgatcttctccttcatgcccttcttc 770



to top

>gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 991 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 932

              
Query: 346 gtg 348
           |||
Sbjct: 931 gtg 929



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 808 gggagcttctccttgatcttctccttcatgcccttcttc 770



to top

>gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 992

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 978 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 919

              
Query: 346 gtg 348
           |||
Sbjct: 918 gtg 916



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 795 gggagcttctccttgatcttctccttcatgcccttcttc 757



to top

>gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 994

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 980 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 921

              
Query: 346 gtg 348
           |||
Sbjct: 920 gtg 918



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 797 gggagcttctccttgatcttctccttcatgcccttcttc 759



to top

>gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 991 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 932

              
Query: 346 gtg 348
           |||
Sbjct: 931 gtg 929



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 808 gggagcttctccttgatcttctccttcatgcccttcttc 770



to top

>gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1000

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 986 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 927

              
Query: 346 gtg 348
           |||
Sbjct: 926 gtg 924



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 803 gggagcttctccttgatcttctccttcatgcccttcttc 765



to top

>gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1005

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 991 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 932

              
Query: 346 gtg 348
           |||
Sbjct: 931 gtg 929



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 808 gggagcttctccttgatcttctccttcatgcccttcttc 770



to top

>gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 993 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 934

              
Query: 346 gtg 348
           |||
Sbjct: 933 gtg 931



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 810 gggagcttctccttgatcttctccttcatgcccttcttc 772



to top

>gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 993 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 934

              
Query: 346 gtg 348
           |||
Sbjct: 933 gtg 931



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 810 gggagcttctccttgatcttctccttcatgcccttcttc 772



to top

>gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1004

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 990 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 931

              
Query: 346 gtg 348
           |||
Sbjct: 930 gtg 928



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 807 gggagcttctccttgatcttctccttcatgcccttcttc 769



to top

>gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 993 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 934

              
Query: 346 gtg 348
           |||
Sbjct: 933 gtg 931



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 810 gggagcttctccttgatcttctccttcatgcccttcttc 772



to top

>gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 987 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 928

              
Query: 346 gtg 348
           |||
Sbjct: 927 gtg 925



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 804 gggagcttctccttgatcttctccttcatgcccttcttc 766



to top

>gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 9 (Dhn9)
           gene, complete cds
          Length = 1007

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 993 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 934

              
Query: 346 gtg 348
           |||
Sbjct: 933 gtg 931



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 810 gggagcttctccttgatcttctccttcatgcccttcttc 772



to top

>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3)
           mRNA, complete cds
          Length = 793

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 485 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcaccg 426

              
Query: 346 gtg 348
           |||
Sbjct: 425 gtg 423



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 304 agcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 296 agcttctccttgatcttatccttgattcccttcttc 261



to top

>emb|X78429.1|TDDEH16 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd16
          Length = 814

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 517 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcaccg 458

              
Query: 346 gtg 348
           |||
Sbjct: 457 gtg 455



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 304 agcttctccttgatcttgtccatgatgcccttcttct 340
           |||||||| |||||||| ||| |||||||||||||||
Sbjct: 328 agcttctctttgatcttatccttgatgcccttcttct 292



to top

>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17)
          Length = 812

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 56/59 (94%)
 Strand = Plus / Minus

                                                                      
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| || || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 547 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 489



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||||||| ||| ||||||||||
Sbjct: 322 gggagcttctccttgatcttgtccttgaggcccttcttc 284



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 466 cccgtgccggtcattccggtgtgtccctgctgcccatagg 427



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 355 ccgtgctgcccgtaggtgccaccggt 380
           ||||||||||| ||||||||||||||
Sbjct: 373 ccgtgctgcccataggtgccaccggt 348



to top

>gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, complete cds
          Length = 1791

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                        
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
            ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1158 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 1099

               
Query: 346  gtg 348
            |||
Sbjct: 1098 gtg 1096



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 975 gggagcttctccttgatcttctccttcatgcccttcttc 937



to top

>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds
          Length = 1575

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 56/59 (94%)
 Strand = Plus / Minus

                                                                       
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||||||| || || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1362 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 1304



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                   
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttc 339
            |||||||||||||||||||||||| ||| ||||||||||
Sbjct: 1137 gggagcttctccttgatcttgtccttgaggcccttcttc 1099



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 391  cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
            |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 1281 cccgtgccggtcattccggtgtgtccctgctgcccatagg 1242



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 355  ccgtgctgcccgtaggtgccaccggt 380
            ||||||||||| ||||||||||||||
Sbjct: 1188 ccgtgctgcccataggtgccaccggt 1163



to top

>gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, complete cds
          Length = 1630

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                        
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
            ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1218 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccg 1159

               
Query: 346  gtg 348
            |||
Sbjct: 1158 gtg 1156



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttc 339
            |||||||||||||||||||| ||| | ||||||||||||
Sbjct: 1035 gggagcttctccttgatcttctccttcatgcccttcttc 997



to top

>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds
          Length = 1560

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 56/59 (94%)
 Strand = Plus / Minus

                                                                       
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||||||| || || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1325 gctcagtgctgtccgggcagcttctccttgatcttgtccatgatgcccttcttctcgcc 1267



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                   
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttc 339
            |||||||||||||||||||||||| ||| ||||||||||
Sbjct: 1100 gggagcttctccttgatcttgtccttgaggcccttcttc 1062



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 391  cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
            |||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 1244 cccgtgccggtcattccggtgtgtccctgctgcccatagg 1205



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 355  ccgtgctgcccgtaggtgccaccggt 380
            ||||||||||| ||||||||||||||
Sbjct: 1151 ccgtgctgcccataggtgccaccggt 1126



to top

>emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd27e
          Length = 751

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 65/72 (90%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || ||||||||||| |||||||||||||| |||||||||||||||
Sbjct: 507 gctcagtgctgtcccggcagcttctccttaatcttgtccatgatccccttcttctcgccg 448

                       
Query: 346 gtgtcggtgccg 357
           ||| | ||||||
Sbjct: 447 gtgccagtgccg 436



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||  | ||||||||||||
Sbjct: 312 gggagcttctccttgatcttctctttcatgcccttcttc 274



to top

>emb|X15994.1|ZMRAB17G Maize RAB-17 gene
          Length = 1986

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 59/64 (92%)
 Strand = Plus / Minus

                                                                        
Query: 285  cgctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            |||||||||||| || || ||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 1300 cgctcagtgctgtccgggcagcttctccttgatcttgtccataatgcctttcttctcgcc 1241

                
Query: 345  ggtg 348
            ||||
Sbjct: 1240 ggtg 1237



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 406  ccggtgtggccctgctgcccgtagg 430
            |||||||| ||||||||||||||||
Sbjct: 1209 ccggtgtgtccctgctgcccgtagg 1185



to top

>emb|X52423.1|OSRAB16C O.sativa DNA for rab 16C gene
          Length = 2493

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                        
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgt 349
            |||||||||| || ||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 2054 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtgt 1995



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttc 339
            |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 1860 gggagcttctccttgatcttctccttgattcccttcttc 1822



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 400  gtcatcccggtgtggccctgctgcccgta 428
            |||||||||| ||||||||||||||||||
Sbjct: 1950 gtcatcccggcgtggccctgctgcccgta 1922



to top

>emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene, rab
          Length = 781

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 65/72 (90%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||||||||||||||| |||||||||||||| 
Sbjct: 476 gctcagtgctgtcccggcagcttctccttgatcttgtccatgatccccttcttctcgccc 417

                       
Query: 346 gtgtcggtgccg 357
           ||| | ||||||
Sbjct: 416 gtgccagtgccg 405



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 301 gggagcttctccttgatcttgtccatgatgcccttctt 338
           |||||||||||||||||||| ||| | |||||||||||
Sbjct: 281 gggagcttctccttgatcttctccttcatgcccttctt 244



to top

>dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096D05, full
           insert sequence
          Length = 795

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgt 349
           |||||||||| || ||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 571 agtgctggccgggaagcttttccttgatcttgtccatgaagcccttcttctcgccggtgt 512



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 377 gggagcttctccttgatcttctccttgattcccttcttc 339



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 400 gtcatcccggtgtggccctgctgcccgta 428
           |||||||||| ||| ||||||||||||||
Sbjct: 467 gtcatcccggcgtgcccctgctgcccgta 439



to top

>gb|AY177889.1| Sorghum bicolor clone BAC IS_21O3 ABA-induced RAB17-like gene,
            partial sequence
          Length = 4636

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                       
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||| || || ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1509 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctcgccggtg 1451



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 304  agcttctccttgatcttgtccatgatgcccttcttc 339
            ||||||||||||||||| ||| |||| |||||||||
Sbjct: 1345 agcttctccttgatcttctccttgattcccttcttc 1310



to top

>gb|AY349220.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||||||||| || |||||||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgccggtg 149



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 954



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 397 gggagcttttccttgatgttctccattacacccttcttctcgccggtg 350



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



to top

>gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, complete cds
          Length = 654

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 589 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 530

              
Query: 346 gtg 348
           |||
Sbjct: 529 gtg 527



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 325 ccagggagcttctccttgatcttatccttgatacccttcttc 284



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 439 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 400



to top

>gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1371

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 856 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 797

              
Query: 346 gtg 348
           |||
Sbjct: 796 gtg 794



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 592 ccagggagcttctccttgatcttatccttgatacccttcttc 551



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 706 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 667



to top

>gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 853 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 794

              
Query: 346 gtg 348
           |||
Sbjct: 793 gtg 791



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 589 ccagggagcttctccttgatcttatccttgatacccttcttc 548



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 703 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 664



to top

>gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 853 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 794

              
Query: 346 gtg 348
           |||
Sbjct: 793 gtg 791



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 589 ccagggagcttctccttgatcttatccttgatacccttcttc 548



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 703 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 664



to top

>gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1332

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 815 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 756

              
Query: 346 gtg 348
           |||
Sbjct: 755 gtg 753



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 551 ccagggagcttctccttgatcttatccttgatacccttcttc 510



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 665 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 626



to top

>gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1357

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 840 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 781

              
Query: 346 gtg 348
           |||
Sbjct: 780 gtg 778



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 573 gggagcttctccttgatcttatccttgatacccttcttc 535



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 690 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 651



to top

>gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 853 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 794

              
Query: 346 gtg 348
           |||
Sbjct: 793 gtg 791



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 589 ccagggagcttctccttgatcttatccttgatacccttcttc 548



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 703 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 664



to top

>gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1373

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 856 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 797

              
Query: 346 gtg 348
           |||
Sbjct: 796 gtg 794



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 592 ccagggagcttctccttgatcttatccttgatacccttcttc 551



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 395 tgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||| |||||||| ||||| ||||||||||| ||||
Sbjct: 702 tgccggtcatcccagtgtgaccctgctgcccatagg 667



to top

>gb|AY895924.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1375

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 858 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 799

              
Query: 346 gtg 348
           |||
Sbjct: 798 gtg 796



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 594 ccagggagcttctccttgatcttatccttgatacccttcttc 553



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 708 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 669



to top

>gb|AY895923.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1364

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 849 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 790

              
Query: 346 gtg 348
           |||
Sbjct: 789 gtg 787



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 585 ccagggagcttctccttgatcttatccttgatacccttcttc 544



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 699 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 660



to top

>gb|AY895922.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1364

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 849 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 790

              
Query: 346 gtg 348
           |||
Sbjct: 789 gtg 787



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 585 ccagggagcttctccttgatcttatccttgatacccttcttc 544



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 699 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 660



to top

>gb|AY895921.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1373

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 856 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 797

              
Query: 346 gtg 348
           |||
Sbjct: 796 gtg 794



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 592 ccagggagcttctccttgatcttatccttgatacccttcttc 551



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 395 tgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||| |||||||| ||||| ||||||||||| ||||
Sbjct: 702 tgccggtcatcccagtgtgaccctgctgcccatagg 667



to top

>gb|AY895920.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1363

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 846 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 787

              
Query: 346 gtg 348
           |||
Sbjct: 786 gtg 784



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 582 ccagggagcttctccttgatcttatccttgatacccttcttc 541



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 696 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 657



to top

>gb|AY895919.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1366

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 849 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 790

              
Query: 346 gtg 348
           |||
Sbjct: 789 gtg 787



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 585 ccagggagcttctccttgatcttatccttgatacccttcttc 544



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 699 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 660



to top

>gb|AY895918.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 826 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 767

              
Query: 346 gtg 348
           |||
Sbjct: 766 gtg 764



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 562 ccagggagcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 673 gtgccggtcatcccagtgtgaccctgctgcccatagg 637



to top

>gb|AY895917.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1370

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 853 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 794

              
Query: 346 gtg 348
           |||
Sbjct: 793 gtg 791



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 589 ccagggagcttctccttgatcttatccttgatacccttcttc 548



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 703 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 664



to top

>gb|AY895916.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 826 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 767

              
Query: 346 gtg 348
           |||
Sbjct: 766 gtg 764



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 562 ccagggagcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 673 gtgccggtcatcccagtgtgaccctgctgcccatagg 637



to top

>gb|AY895915.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1366

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 849 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 790

              
Query: 346 gtg 348
           |||
Sbjct: 789 gtg 787



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 585 ccagggagcttctccttgatcttatccttgatacccttcttc 544



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 699 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 660



to top

>gb|AY895914.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1366

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 849 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 790

              
Query: 346 gtg 348
           |||
Sbjct: 789 gtg 787



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 585 ccagggagcttctccttgatcttatccttgatacccttcttc 544



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 699 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 660



to top

>gb|AY895913.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1344

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 827 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 768

              
Query: 346 gtg 348
           |||
Sbjct: 767 gtg 765



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 563 ccagggagcttctccttgatcttatccttgatacccttcttc 522



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 674 gtgccggtcatcccagtgtgaccctgctgcccatagg 638



to top

>gb|AY895912.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 826 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 767

              
Query: 346 gtg 348
           |||
Sbjct: 766 gtg 764



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 562 ccagggagcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 673 gtgccggtcatcccagtgtgaccctgctgcccatagg 637



to top

>gb|AY895911.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 826 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 767

              
Query: 346 gtg 348
           |||
Sbjct: 766 gtg 764



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 562 ccagggagcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 673 gtgccggtcatcccagtgtgaccctgctgcccatagg 637



to top

>gb|AY895910.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1363

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 846 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 787

              
Query: 346 gtg 348
           |||
Sbjct: 786 gtg 784



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 582 ccagggagcttctccttgatcttatccttgatacccttcttc 541



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 696 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 657



to top

>gb|AY895909.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1369

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 852 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 793

              
Query: 346 gtg 348
           |||
Sbjct: 792 gtg 790



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 588 ccagggagcttctccttgatcttatccttgatacccttcttc 547



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 702 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 663



to top

>gb|AY895908.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1337

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 822 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 763

              
Query: 346 gtg 348
           |||
Sbjct: 762 gtg 760



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 558 ccagggagcttctccttgatcttatccttgatacccttcttc 517



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 672 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 633



to top

>gb|AY895907.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1343

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 826 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 767

              
Query: 346 gtg 348
           |||
Sbjct: 766 gtg 764



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 562 ccagggagcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 673 gtgccggtcatcccagtgtgaccctgctgcccatagg 637



to top

>gb|AY895906.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1342

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 826 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 767

              
Query: 346 gtg 348
           |||
Sbjct: 766 gtg 764



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 562 ccagggagcttctccttgatcttatccttgatacccttcttc 521



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 394 gtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           ||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 673 gtgccggtcatcccagtgtgaccctgctgcccatagg 637



to top

>gb|AY895905.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 7
           (Dhn7) gene, complete cds
          Length = 1363

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                       
Query: 286 gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
           ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 846 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 787

              
Query: 346 gtg 348
           |||
Sbjct: 786 gtg 784



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 582 ccagggagcttctccttgatcttatccttgatacccttcttc 541



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 696 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 657



to top

>gb|AF043092.1|AF043092 Hordeum vulgare dehydrin 7 (dhn7) gene, complete cds
          Length = 2127

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                        
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
            ||||||||||| || || |||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 1182 gctcagtgctgtccgggcagcttctccttgattttgtccatgatgcccttcttttcgccg 1123

               
Query: 346  gtg 348
            |||
Sbjct: 1122 gtg 1120



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| |||| |||||||||
Sbjct: 918 ccagggagcttctccttgatcttatccttgatacccttcttc 877



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 391  cccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
            |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct: 1032 cccgtgccggtcatcccagtgtgaccctgctgcccatagg 993



to top

>gb|U63831.1|SBU63831 Sorghum bicolor dehydrin (DHN2) mRNA, partial cds
          Length = 549

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                      
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||| || || ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 320 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctcgccggtg 262



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 304 agcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 159 agcttctccttgatcttctccttgattcccttcttc 124



to top

>gb|M93342.2|WHTCOAC Triticum aestivum cold acclimation protein WCS120 (WCS120) mRNA,
           complete cds
          Length = 1504

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                         
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 90  gggagcttctccttgatcttctccatgatgcccttcttctcgccgg 45



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                        
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
            ||||||||||| ||||| ||||| ||||||||||||||||||| || |||||||||||||
Sbjct: 1200 gctcagtgctgtccaggcagcttatccttgatcttgtccatgaggctcttcttctcgccg 1141



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 534 ccagggagcttctccttgatgttctccatgacgcccttcttctcgccggtg 484



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           ||||||||||| |||||||| || ||||||| |||||||||||||||||
Sbjct: 282 ccagggagcttgtccttgatgttctccatgacgcccttcttctcgccgg 234



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| |||||||| || ||||||| |||||||||||||||
Sbjct: 918 ccagggagcttttccttgatgttctccatgacgcccttcttctcgcc 872



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| |||||||| || ||||||| ||| |||||||||||
Sbjct: 726 ccagggagcttgtccttgatgttctccatgacgcctttcttctcgcc 680



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 127  atacattcgcccctccaacagccaagtgagctaggtgaacta 168
            |||||||| | ||||||||  |||||||||||||||||||||
Sbjct: 1307 atacattctctcctccaacgaccaagtgagctaggtgaacta 1266



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 358 tgctgcccgtaggtgccaccggt 380
           |||||||||||||||||||||||
Sbjct: 771 tgctgcccgtaggtgccaccggt 749



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | |||||||| ||||  |||||||| ||||||| ||| ||||
Sbjct: 489 ccggtgccgtgcgtccccgtgccagtcactccggtgtgtccctgctccccatagg 435



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 406 ccggtgtggccctgctgcccgtagg 430
           |||||||| ||||||||||||||||
Sbjct: 975 ccggtgtgtccctgctgcccgtagg 951



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 406 ccggtgtggccctgctgcccgtagg 430
           |||||||| ||||||||||||||||
Sbjct: 783 ccggtgtgtccctgctgcccgtagg 759



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 406 ccggtgtggccctgctgcccgtagg 430
           |||||||| ||||||||||||||||
Sbjct: 591 ccggtgtgtccctgctgcccgtagg 567



to top

>gb|AF031247.1|AF031247 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-2)
           mRNA, complete cds
          Length = 1518

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                         
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 121 gggagcttctccttgatcttctccatgatgcccttcttctcgccgg 76



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                       
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||||||
Sbjct: 1293 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgccggtg 1235



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 1072 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 1025



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcgg 352
           ||||| ||||| |||||||| || ||||||| |||||||||||||||||||||||
Sbjct: 493 ccaggaagcttgtccttgatgttctccatgacgcccttcttctcgccggtgtcgg 439



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||| |||||||| || ||||||| ||| |||||||||||||||
Sbjct: 880 gggagcttgtccttgatgttctccatgacgcctttcttctcgccggtg 833



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||||||||| || |||||||  ||||||||||||||
Sbjct: 688 gggagcttctccttgatgttctccatgacacccttcttctcgcc 645



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 376  ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
            |||||||||||| | |||||||  ||||  |||||||| || |||||||||||||
Sbjct: 1030 ccggtgccgtgcgtccccgtgctggtcactccggtgtgtccgtgctgcccgtagg 976



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 358 tgctgcccgtaggtgccaccggt 380
           |||||||||||||||||||||||
Sbjct: 928 tgctgcccgtaggtgccaccggt 906



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 377  cggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
            ||||||||||  | || ||||| ||| | |||||||| ||||||||||||||||
Sbjct: 1230 cggtgccgtgagtcccagtgccggtcgtgccggtgtgtccctgctgcccgtagg 1177



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 391 cccgtgcctgtcatcccggtgtggccctgctgc 423
           |||||||| ||||||||||| || |||||||||
Sbjct: 631 cccgtgccggtcatcccggtatgtccctgctgc 599



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 114  aaacttgaactagatacattcgcccctccaac 145
            |||||| ||| |||||||||||| ||||||||
Sbjct: 1433 aaacttaaaccagatacattcgctcctccaac 1402



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 358  tgctgcccgtaggtgccaccggtg 381
            ||||||||||||||||| ||||||
Sbjct: 1189 tgctgcccgtaggtgccgccggtg 1166



to top

>gb|AF181460.1|AF181460 Hordeum vulgare dehydrin (Dhn10) gene, complete cds
          Length = 2501

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 54/58 (93%)
 Strand = Plus / Minus

                                                                      
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggt 347
            ||||||||||||| ||||| ||||||||||||||||| || |||||||||||||||||
Sbjct: 1896 agtgctggccaggcagcttttccttgatcttgtccataatacccttcttctcgccggt 1839



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 304  agcttctccttgatcttgtccatgatgcccttcttc 339
            ||||||||||||||||| ||| ||||||||||||||
Sbjct: 1261 agcttctccttgatcttctccttgatgcccttcttc 1226



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 307  ttctccttgatcttgtccatgatgcccttcttctc 341
            |||||| ||||||||||| | ||||||||||||||
Sbjct: 1561 ttctccatgatcttgtccttcatgcccttcttctc 1527



to top

>gb|AF181455.1|AF181455 Hordeum vulgare dehydrin (Dhn5) gene, complete cds
          Length = 3447

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                         
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 666 gggagcttctccttgatcttctccatgatgcccttcttctcgccgg 621



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                           
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 1521 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 1475



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           ||||||||||| ||||||||||| ||||||| |||||||||||||||||
Sbjct: 867 ccagggagcttgtccttgatcttctccatgaggcccttcttctcgccgg 819



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 1911 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 1864



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 2324 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 2270



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 2103 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 2056



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggt 347
            ||||| ||||| |||||||| || ||||||| ||||||||||||||||||
Sbjct: 1128 ccaggaagcttgtccttgatgttctccatgacgcccttcttctcgccggt 1079



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            |||||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 1326 gggagcttatccttgatgttctccattacacccttcttctcgccggtg 1279



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 376  ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
            |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 2061 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 2007



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 355  ccgtgctgcccgtaggtgccaccggtg 381
            |||||||||||||||||||| ||||||
Sbjct: 2022 ccgtgctgcccgtaggtgccgccggtg 1996



to top

>gb|AF043095.1|AF043095 Hordeum vulgare dehydrin 10 (dhn10) gene, complete cds
          Length = 2984

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 54/58 (93%)
 Strand = Plus / Minus

                                                                      
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggt 347
            ||||||||||||| ||||| ||||||||||||||||| || |||||||||||||||||
Sbjct: 2294 agtgctggccaggcagcttttccttgatcttgtccataatacccttcttctcgccggt 2237



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 304  agcttctccttgatcttgtccatgatgcccttcttc 339
            ||||||||||||||||| ||| ||||||||||||||
Sbjct: 1659 agcttctccttgatcttctccttgatgcccttcttc 1624



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 307  ttctccttgatcttgtccatgatgcccttcttctc 341
            |||||| ||||||||||| | ||||||||||||||
Sbjct: 1959 ttctccatgatcttgtccttcatgcccttcttctc 1925



to top

>gb|AF058794.1|AF058794 Triticum aestivum COR39 (cor39) mRNA, complete cds
          Length = 1243

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                         
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 118 gggagcttctccttgatcttctccatgatgcccttcttctcgccgg 73



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                       
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1228 gctcagtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 1170



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 562 ccagggagcttctccttgatgttctccatgaggcccttcttctcgccggtg 512



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 943 gggagcttctccttgatgttctccatgacgcccttcttctcgccggtg 896



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 297 gccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 755 gccagggagcttgtccttgatgttctccatgacgcccttcttctcgccggtg 704



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           ||||||||||| |||||||| || ||||| | |||||||||||||||||
Sbjct: 310 ccagggagcttgtccttgatgttctccatcacgcccttcttctcgccgg 262



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgc 423
           |||||||||||  | |||||||| |||||||||||||| || ||||||
Sbjct: 901 ccggtgccgtgtgtccccgtgccggtcatcccggtgtgtccgtgctgc 854



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 358 tgctgcccgtaggtgccaccggt 380
           |||||||||||||||||||||||
Sbjct: 799 tgctgcccgtaggtgccaccggt 777



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | |||||||| ||||  |||||||| ||||||| ||| ||||
Sbjct: 517 ccggtgccgtgcgtccccgtgccggtcactccggtgtgtccctgctccccatagg 463



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 406  ccggtgtggccctgctgcccgtagg 430
            |||||||| ||||||||||||||||
Sbjct: 1003 ccggtgtgtccctgctgcccgtagg 979



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 406 ccggtgtggccctgctgcccgtagg 430
           |||||||| ||||||||||||||||
Sbjct: 811 ccggtgtgtccctgctgcccgtagg 787



to top

>gb|M95810.1|BLYDHN5 Hordeum vulgare dehydrin DHN5 (Dhn5) gene, complete cds
          Length = 2432

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                         
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 659 gggagcttctccttgatcttctccatgatgcccttcttctcgccgg 614



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                           
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 1514 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 1468



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           ||||||||||| ||||||||||| ||||||| |||||||||||||||||
Sbjct: 860 ccagggagcttgtccttgatcttctccatgaggcccttcttctcgccgg 812



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 1904 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 1857



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 2317 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 2263



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 2096 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 2049



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggt 347
            ||||| ||||| |||||||| || ||||||| ||||||||||||||||||
Sbjct: 1121 ccaggaagcttgtccttgatgttctccatgacgcccttcttctcgccggt 1072



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            |||||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 1319 gggagcttatccttgatgttctccattacacccttcttctcgccggtg 1272



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 376  ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
            |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 2054 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 2000



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 355  ccgtgctgcccgtaggtgccaccggtg 381
            |||||||||||||||||||| ||||||
Sbjct: 2015 ccgtgctgcccgtaggtgccgccggtg 1989



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 1715 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 1665



to top

>gb|L27516.1|WHTWCS66X Triticum aestivum (Wcs66) gene, complete cds
          Length = 1629

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                         
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 144 gggagcttctccttgatcttctccatgatgcccttcttctcgccgg 99



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                        
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
            ||||||||||| ||||| ||||| ||||||||||||||||||| || |||||||||||||
Sbjct: 1488 gctcagtgctgtccaggtagcttgtccttgatcttgtccatgaggctcttcttctcgccg 1429



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 822 ccagggagcttgtccttgatgttctccatgaggcccttcttctcgccggtg 772



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcg 351
           |||||||||||||||||||| || ||||||| || ||||||||||||| |||||
Sbjct: 630 ccagggagcttctccttgatgttctccatgaggctcttcttctcgccgatgtcg 577



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggt 347
            ||||||||||| |||||||| || ||||||| |||||||||| |||||||
Sbjct: 1014 ccagggagcttgtccttgatgttctccatgacgcccttcttcccgccggt 965



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           |||||||| |||||||| || ||||||| |||||||||||||||||
Sbjct: 333 gggagcttgtccttgatgttctccatgacgcccttcttctcgccgg 288



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||||||| |||||||| || ||||||| | |||||||||||||
Sbjct: 1206 ccagggagcttgtccttgatgttctccatgacggccttcttctcgcc 1160



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 127  atacattcgcccctccaacagccaagtgagctaggtgaacta 168
            |||||||| | ||||||||  |||||||||||||||||||||
Sbjct: 1595 atacattctctcctccaacgaccaagtgagctaggtgaacta 1554



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 358 tgctgcccgtaggtgccaccggt 380
           |||||||||||||||||||||||
Sbjct: 867 tgctgcccgtaggtgccaccggt 845



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 406  ccggtgtggccctgctgcccgtagg 430
            |||||||| ||||||||||||||||
Sbjct: 1263 ccggtgtgtccctgctgcccgtagg 1239



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 391  cccgtgcctgtcatcccggtgtggccctgctgc 423
            |||||||| |||||||||||||| || ||||||
Sbjct: 1146 cccgtgccggtcatcccggtgtgtccgtgctgc 1114



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 406 ccggtgtggccctgctgcccgtagg 430
           |||||||| ||||||||||||||||
Sbjct: 879 ccggtgtgtccctgctgcccgtagg 855



to top

>emb|X71362.1|HVDHN7 H.vulgare gene for dehydrin 7
          Length = 2138

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 304  agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1501 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 1457



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttc 339
            |||||||||||||||||||| ||| | || |||||||||
Sbjct: 1372 gggagcttctccttgatcttctccttcatccccttcttc 1334



to top

>emb|X15290.1|HVDHN3 Zea mays mRNA for dehydrin (dhn1 gene)
          Length = 852

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 284 gcgctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgc 343
           ||||||||||||| || || |||||||| |||||||||||||| ||||| ||||||||||
Sbjct: 603 gcgctcagtgctgtccgggcagcttctctttgatcttgtccataatgcctttcttctcgc 544

                
Query: 344 cggtg 348
           |||||
Sbjct: 543 cggtg 539



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 304 agcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 406 agcttctccttgatcttctccttgattcccttcttc 371



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 406 ccggtgtggccctgctgcccgtagg 430
           |||||||| ||||||||||||||||
Sbjct: 511 ccggtgtgtccctgctgcccgtagg 487



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 406 ccggtgtggccctgctgcccgtagg 430
           |||||||| ||||||||||||||||
Sbjct: 481 ccggtgtgtccctgctgcccgtagg 457



to top

>emb|X15288.1|HVDHN8 Barley mRNA for dehydrin (dhn8)
          Length = 683

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 474 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 430



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 345 gggagcttctccttgatcttctccttcatccccttcttc 307



to top

>emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene
          Length = 2890

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                     
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
            |||||||||| || |||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 1983 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 1927



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 400  gtcatcccggtgtggccctgctgcccgta 428
            |||||||||| ||||||||||||||||||
Sbjct: 1885 gtcatcccggcgtggccctgctgcccgta 1857



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 304  agcttctccttgatcttgtccatgatgcccttcttc 339
            ||||||||||||||||| ||| |||| |||||||||
Sbjct: 1792 agcttctccttgatcttctccttgatccccttcttc 1757



to top

>emb|X98326.1|HVDEHYDRN H.vulgare mRNA for dehydrin
          Length = 671

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 463 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 419



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 331 gggagcttctccttgatcttctccttcatccccttcttc 293



to top

>gb|AF181461.1|AF181461 Hordeum vulgare dehydrin (Dhn11) gene, complete cds
          Length = 2009

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                     
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
            |||||||| || ||||||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 1641 gctcagtggtgtccagggagcttctccttgatcttctccatgatacccttcttctcg 1585



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 304  agcttctccttgatcttgtccatgatgcccttcttct 340
            ||||||||||| ||||| ||| |||||||||||||||
Sbjct: 1512 agcttctcctttatcttctccttgatgcccttcttct 1476



to top

>gb|AF181451.1|AF181451 Hordeum vulgare dehydrin (Dhn1) mRNA, complete cds
          Length = 512

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 428 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 384



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 299 gggagcttctccttgatcttctccttcatccccttcttc 261



to top

>dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H03, full
           insert sequence
          Length = 872

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           |||||||||| || |||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 628 agtgctggccgggcagcttctccttgatcttgtccatgaatcccttcttctcgccgg 572



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 400 gtcatcccggtgtggccctgctgcccgta 428
           |||||||||| ||||||||||||||||||
Sbjct: 530 gtcatcccggcgtggccctgctgcccgta 502



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 304 agcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||| ||| |||| |||||||||
Sbjct: 437 agcttctccttgatcttctccttgattcccttcttc 402



to top

>gb|AY895879.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1446

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895878.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895877.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895876.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1291

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895875.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895874.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1249

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895873.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1202

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895872.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1268

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895871.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1330

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 476 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 432



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 347 gggagcttctccttgatcttctccttcatccccttcttc 309



to top

>gb|AY895870.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1428

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895869.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895868.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895867.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1417

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 476 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 432



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 347 gggagcttctccttgatcttctccttcatccccttcttc 309



to top

>gb|AY895866.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1428

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895865.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 476 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 432



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 347 gggagcttctccttgatcttctccttcatccccttcttc 309



to top

>gb|AY895864.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1230

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895863.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895862.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895861.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1243

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 486 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 442



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 357 gggagcttctccttgatcttctccttcatccccttcttc 319



to top

>gb|AY895860.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1249

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895859.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1243

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 486 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 442



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 357 gggagcttctccttgatcttctccttcatccccttcttc 319



to top

>gb|AY895858.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1269

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY895857.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 1
           (Dhn1) gene, partial cds
          Length = 1249

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 482 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 438



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| | || |||||||||
Sbjct: 353 gggagcttctccttgatcttctccttcatccccttcttc 315



to top

>gb|AY104757.1| Zea mays PCO142314 mRNA sequence
          Length = 899

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 284 gcgctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgc 343
           ||||||||||||| || || |||||||| |||||||||||||| ||||| ||||||||||
Sbjct: 600 gcgctcagtgctgtccgggcagcttctctttgatcttgtccataatgcctttcttctcgc 541

                
Query: 344 cggtg 348
           |||||
Sbjct: 540 cggtg 536



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 406 ccggtgtggccctgctgcccgtagg 430
           |||||||| ||||||||||||||||
Sbjct: 508 ccggtgtgtccctgctgcccgtagg 484



to top

>gb|AF043087.1|AF043087 Hordeum vulgare dehydrin 1 (dhn1) gene, complete cds
          Length = 2717

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 44/45 (97%)
 Strand = Plus / Minus

                                                         
Query: 304  agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1758 agcttctccttgatcttgtccatgacgcccttcttctcgccggtg 1714



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttc 339
            |||||||||||||||||||| ||| | || |||||||||
Sbjct: 1629 gggagcttctccttgatcttctccttcatccccttcttc 1591



to top

>gb|AF043086.1|AF043086 Hordeum vulgare dehydrin 11 (dhn11) gene, complete cds
          Length = 2420

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                     
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
            |||||||| || ||||||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 1649 gctcagtggtgtccagggagcttctccttgatcttctccatgatacccttcttctcg 1593



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 304  agcttctccttgatcttgtccatgatgcccttcttct 340
            ||||||||||| ||||| ||| |||||||||||||||
Sbjct: 1520 agcttctcctttatcttctccttgatgcccttcttct 1484



to top

>emb|X78432.1|TDDEH38 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd38
          Length = 555

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||||||||||||||||||||||
Sbjct: 131 gggagcttctccttgatgttctccatgatgcccttcttctcgccggtg 84



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||| ||||| ||||||||||| | ||||||||||| || ||||||||| ||||||
Sbjct: 343 agtgctgtccaggcagcttctccttcaccttgtccatgaggctcttcttctcaccggtg 285



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 125 agatacattcgcccctccaacagccaagtgagctaggtgaacta 168
           ||||||||| || ||||||||  |||||||||||||||||||||
Sbjct: 456 agatacatttgctcctccaacgaccaagtgagctaggtgaacta 413



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 392 ccgtgcctgtcatcccggtgtggccctgctgcccgt 427
           ||||||||||||| || ||||| || ||||||||||
Sbjct: 205 ccgtgcctgtcattccagtgtgtccatgctgcccgt 170



to top

>emb|X78430.1|TDDEH25 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd25a
          Length = 565

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||||||||||||||||||||||
Sbjct: 137 gggagcttctccttgatgttctccatgatgcccttcttctcgccggtg 90



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||| ||||| ||||||||||| | ||||||||||| || ||||||||| ||||||
Sbjct: 349 agtgctgtccaggcagcttctccttcaccttgtccatgaggctcttcttctcaccggtg 291



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 125 agatacattcgcccctccaacagccaagtgagctaggtgaacta 168
           ||||||||| || ||||||||  |||||||||||||||||||||
Sbjct: 462 agatacatttgctcctccaacgaccaagtgagctaggtgaacta 419



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 392 ccgtgcctgtcatcccggtgtggccctgctgcccgt 427
           ||||||||||||| || ||||| || ||||||||||
Sbjct: 211 ccgtgcctgtcattccagtgtgtccatgctgcccgt 176



to top

>gb|AY349246.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349245.1| Hordeum vulgare subsp. spontaneum NPGS PI 560556 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349244.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349243.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349242.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 374 caccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 741 caccggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||| || ||||||   ||||||||||| ||||||
Sbjct: 778 agcttctccttgatgttctccatggcacccttcttctcaccggtg 734



to top

>gb|AY349241.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349239.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349238.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 tgctgcccgtaggtgccacc 377
           ||||||||||||||||||||
Sbjct: 637 tgctgcccgtaggtgccacc 618



to top

>gb|AY349237.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 954



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



to top

>gb|AY349234.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 954



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349232.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349230.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1061

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1014 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 960



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349229.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349224.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349223.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 954



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 778 agcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, complete cds
          Length = 483

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 288 tcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           ||||||||| || || ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 483 tcagtgctgtccgggcagcttttccttgatcttgtccatgatgcccttcttttcgccgg 425



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttc 339
           ||||||||||||||||||||||| ||| ||||||||||||||
Sbjct: 266 ccagggagcttctccttgatcttatccttgatgcccttcttc 225



to top

>gb|AF043096.1|AF043096 Hordeum vulgare dehydrin 5 (dhn5) gene, complete cds
          Length = 2814

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                           
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            |||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 1519 ccagggagcttctccttgatgttctccatgatgcccttcttctcgcc 1473



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           ||||| |||||||||||||| |||||||||||||||||||||||||
Sbjct: 664 gggagtttctccttgatcttctccatgatgcccttcttctcgccgg 619



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccgg 346
           ||||||||||| ||||||||||| ||||||| |||||||||||||||||
Sbjct: 865 ccagggagcttgtccttgatcttctccatgaggcccttcttctcgccgg 817



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 1909 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 1862



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 2322 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 2268



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 2101 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 2054



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||| ||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 1126 ccaggaagcttgtccttgatgttctccatgacgcccttcttctcgccggtg 1076



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 298  ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            ||||||||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 1720 ccagggagcttttccttgatgttctccattacacccttcttctcgccggtg 1670



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            |||||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 1324 gggagcttatccttgatgttctccattacacccttcttctcgccggtg 1277



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 376  ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
            |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 2059 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 2005



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 355  ccgtgctgcccgtaggtgccaccggtg 381
            |||||||||||||||||||| ||||||
Sbjct: 2020 ccgtgctgcccgtaggtgccgccggtg 1994



to top

>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds
          Length = 1637

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 297  gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
            |||||||||||||||||||||||| ||||||| |||||||||||||
Sbjct: 1291 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 1246



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcg 342
            |||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 1464 gggagcttctccttgatcttctccatcatgcccttcttctcg 1423



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 301  gggagcttctccttgatctt 320
            ||||||||||||||||||||
Sbjct: 1143 gggagcttctccttgatctt 1124



to top

>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds
          Length = 3086

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                          
Query: 297  gccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
            |||||||||||||||||||||||| ||||||| |||||||||||||
Sbjct: 2206 gccagggagcttctccttgatcttctccatgacgcccttcttctcg 2161



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 301  gggagcttctccttgatcttgtccatgatgcccttcttctcg 342
            |||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 2379 gggagcttctccttgatcttctccatcatgcccttcttctcg 2338



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 301  gggagcttctccttgatctt 320
            ||||||||||||||||||||
Sbjct: 2058 gggagcttctccttgatctt 2039



to top

>gb|U73212.1|TAU73212 Triticum aestivum cold acclimation protein WCOR80 (Wcor80) mRNA,
           complete cds
          Length = 465

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggt 347
           ||||||| ||||| ||||||||||||| ||||||||||| || |||||||||||||||
Sbjct: 327 agtgctgtccaggcagcttctccttgaccttgtccatgaggctcttcttctcgccggt 270



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||||||| |||||||||||||||
Sbjct: 115 gggagcttctccttgatgttctccatgatgcctttcttctcgccggtg 68



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 125 agatacattcgcccctccaacagccaagtgagctaggtgaacta 168
           |||||||||||| |||||||   |||||||||||||||||||||
Sbjct: 439 agatacattcgctcctccaatgaccaagtgagctaggtgaacta 396



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 392 ccgtgcctgtcatcccggtgtggccctgctgcccgt 427
           ||||||| ||||| || ||||| |||||||||||||
Sbjct: 180 ccgtgccggtcattccagtgtgtccctgctgcccgt 145



to top

>emb|X15289.1|HVDHN9 Barley mRNA for dehydrin (dhn9)
          Length = 683

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 468 agcttctccttgatcttgtccatgacacccttcttctcgccggtg 424



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 gggagcttctccttgatctt 320
           ||||||||||||||||||||
Sbjct: 336 gggagcttctccttgatctt 317



to top

>gb|AF181452.1|AF181452 Hordeum vulgare dehydrin (Dhn2) gene, complete cds
          Length = 1294

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                         
Query: 304  agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 1161 agcttctccttgatcttgtccatgacacccttcttctcgccggtg 1117



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 301  gggagcttctccttgatctt 320
            ||||||||||||||||||||
Sbjct: 1029 gggagcttctccttgatctt 1010



to top

>gb|AF043088.1|AF043088 Hordeum vulgare dehydrin 2 (dhn2) gene, complete cds
          Length = 1849

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                         
Query: 304  agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
            |||||||||||||||||||||||||  ||||||||||||||||||
Sbjct: 1169 agcttctccttgatcttgtccatgacacccttcttctcgccggtg 1125



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 301  gggagcttctccttgatctt 320
            ||||||||||||||||||||
Sbjct: 1037 gggagcttctccttgatctt 1018



to top

>gb|AY823548.1| Pennisetum glaucum putative RAB protein mRNA, complete cds
          Length = 616

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 285 cgctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||| ||||||| || || |||||||||||||||||||||||||  ||||||||||| ||
Sbjct: 504 cgcttagtgctgcccgggaagcttctccttgatcttgtccatgagtcccttcttctctcc 445

               
Query: 345 ggtg 348
           ||||
Sbjct: 444 ggtg 441



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttc 339
           |||||||||||||||||||| ||| ||||||| ||||||
Sbjct: 335 gggagcttctccttgatcttctccttgatgcctttcttc 297



to top

>ref|NM_192219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 687

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| |||||||||||||||||||| |||| ||||||||||||||||
Sbjct: 674 tggccggggagcttctccttgatcttctccacgatgcccttcttctcg 627



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 304 agcttctccttgatcttgtccatgatgcccttcttct 340
           ||||||||||| ||||| ||| |||||| ||||||||
Sbjct: 527 agcttctcctttatcttctccttgatgctcttcttct 491



to top

>gb|AY349233.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| |||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 tgctgcccgtaggtgccacc 377
           ||||||||||||||||||||
Sbjct: 637 tgctgcccgtaggtgccacc 618



to top

>gb|AY349231.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| |||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 tgctgcccgtaggtgccacc 377
           ||||||||||||||||||||
Sbjct: 637 tgctgcccgtaggtgccacc 618



to top

>gb|AY349228.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1055

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1008 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 954



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| |||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 tgctgcccgtaggtgccacc 377
           ||||||||||||||||||||
Sbjct: 637 tgctgcccgtaggtgccacc 618



to top

>gb|AY349227.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| |||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 tgctgcccgtaggtgccacc 377
           ||||||||||||||||||||
Sbjct: 637 tgctgcccgtaggtgccacc 618



to top

>gb|AY349222.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| |||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 tgctgcccgtaggtgccacc 377
           ||||||||||||||||||||
Sbjct: 637 tgctgcccgtaggtgccacc 618



to top

>gb|AY349221.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 1049

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttctccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| |||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 tgctgcccgtaggtgccacc 377
           ||||||||||||||||||||
Sbjct: 637 tgctgcccgtaggtgccacc 618



to top

>gb|AY333185.1| Oryza sativa (japonica cultivar-group) drought-resistant protein
           mRNA, complete cds
          Length = 1021

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| |||||||||||||||||||| |||| ||||||||||||||||
Sbjct: 763 tggccggggagcttctccttgatcttctccacgatgcccttcttctcg 716



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 304 agcttctccttgatcttgtccatgatgcccttcttct 340
           ||||||||||| ||||| ||| |||||| ||||||||
Sbjct: 616 agcttctcctttatcttctccttgatgctcttcttct 580



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                                
Query: 295      tggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
                ||||| |||||||||||||||||||| |||| ||||||||||||||||
Sbjct: 29117641 tggccggggagcttctccttgatcttctccacgatgcccttcttctcg 29117594



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                     
Query: 304      agcttctccttgatcttgtccatgatgcccttcttct 340
                ||||||||||| ||||| ||| |||||| ||||||||
Sbjct: 29117494 agcttctcctttatcttctccttgatgctcttcttct 29117458



to top

>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0421H07
          Length = 158126

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 295   tggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
             ||||| |||||||||||||||||||| |||| ||||||||||||||||
Sbjct: 78007 tggccggggagcttctccttgatcttctccacgatgcccttcttctcg 77960



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 304   agcttctccttgatcttgtccatgatgcccttcttct 340
             ||||||||||| ||||| ||| |||||| ||||||||
Sbjct: 77860 agcttctcctttatcttctccttgatgctcttcttct 77824



to top

>emb|X57327.1|OSRAB25 Rice rab25 mRNA
          Length = 920

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| |||||||||||||||||||| |||| ||||||||||||||||
Sbjct: 734 tggccggggagcttctccttgatcttctccacgatgcccttcttctcg 687



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 304 agcttctccttgatcttgtccatgatgcccttcttct 340
           ||||||||||| ||||| ||| |||||| ||||||||
Sbjct: 587 agcttctcctttatcttctccttgatgctcttcttct 551



to top

>dbj|AK063691.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-F09, full
           insert sequence
          Length = 761

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| |||||||||||||||||||| |||| ||||||||||||||||
Sbjct: 555 tggccggggagcttctccttgatcttctccacgatgcccttcttctcg 508



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 304 agcttctccttgatcttgtccatgatgcccttcttct 340
           ||||||||||| ||||| ||| |||||| ||||||||
Sbjct: 408 agcttctcctttatcttctccttgatgctcttcttct 372



to top

>gb|U11696.1|SBU11696 Sorghum bicolor dehydrin (DHN1) mRNA, complete cds
          Length = 748

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||||| || || ||||||||||||||||||||||||||||| ||||||||
Sbjct: 498 agtgctgtccgggcagcttctccttgatcttgtccatgatgcctttcttctc 447



to top

>gb|AY349240.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 5 (Dhn5)
            gene, partial cds
          Length = 1049

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 290  agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
            ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 1002 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 948



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||||||| |||||||| || |||||||||||||||||||||||
Sbjct: 199 ccagggagcttgtccttgatgttctccatgatgcccttcttctcgcc 153



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 781 gggagcttctccttgatgttctccatgacacccttcttctcgccggtg 734



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||| |||||||| || ||||||| |||||||||||||||||||
Sbjct: 589 gggagcttatccttgatgttttccatgacgcccttcttctcgccggtg 542



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 739 ccggtgccgtgcgtcccagtgccggtcactccggtgtgtccgtgctgcccgtagg 685



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 700 ccgtgctgcccgtaggtgccgccggtg 674



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||| |||||| |||||||| || ||||| |  ||||||||||||||||||
Sbjct: 400 ccagagagcttttccttgatgttctccattacacccttcttctcgccggtg 350



to top

>gb|AY349236.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 345



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtg 125



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 130 ccggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtagg 76



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 91  ccgtgctgcccgtaggtgccgccggtg 65



to top

>gb|AY349235.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 345



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtg 125



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 130 ccggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtagg 76



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 91  ccgtgctgcccgtaggtgccgccggtg 65



to top

>gb|AY349226.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 345



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtg 125



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 130 ccggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtagg 76



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 91  ccgtgctgcccgtaggtgccgccggtg 65



to top

>gb|AY349225.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 5 (Dhn5)
           gene, partial cds
          Length = 446

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           ||||||| ||||| ||||| ||||||||||||||||||| || ||||||||||||
Sbjct: 399 agtgctgtccaggcagcttgtccttgatcttgtccatgaggctcttcttctcgcc 345



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||||| || |||||||  ||||||||||||||||||
Sbjct: 169 agcttctccttgatgttctccatgacacccttcttctcgccggtg 125



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 376 ccggtgccgtgcatgcccgtgcctgtcatcccggtgtggccctgctgcccgtagg 430
           |||||||||||| | || ||||| ||||  |||||||| || |||||||||||||
Sbjct: 130 ccggtgccgtgcgtcccagtgccggtcactccggtgtgaccgtgctgcccgtagg 76



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 355 ccgtgctgcccgtaggtgccaccggtg 381
           |||||||||||||||||||| ||||||
Sbjct: 91  ccgtgctgcccgtaggtgccgccggtg 65



to top

>gb|AF031249.1|AF031249 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-4)
           mRNA, complete cds
          Length = 680

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||| ||||| ||||| |||||||||||||||||||||| ||| ||||| ||||||
Sbjct: 392 agtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcaccggtg 334



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||||||||||||| || || | ||  ||||||||||||||||||
Sbjct: 219 gggagcttctccttgatgttctcgacgacacccttcttctcgccggtg 172



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           |||||||||||| ||||  | |||| || |||||||||||||||||||
Sbjct: 93  gggagcttctccgtgatgctctccacgacgcccttcttctcgccggtg 46



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||| ||||||||||||
Sbjct: 144 tgctgcccgtacgtgccaccggtg 121



to top

>gb|AF031250.1|AF031250 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-5)
           mRNA, complete cds
          Length = 697

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||| ||||| ||||| |||||||||||||||||||||| ||| ||||| ||||||
Sbjct: 416 agtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcaccggtg 358



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgcc 356
           ||||||||||||||||| || || | || ||||||||||||||||||| |||||||
Sbjct: 243 gggagcttctccttgatgttctcgacgacgcccttcttctcgccggtgccggtgcc 188



to top

>dbj|AB049336.1| Nicotiana tabacum NtERD10B mRNA for dehydrin, complete cds
          Length = 796

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           |||||||| ||||||||||| |||||||||||||| |||||||||||
Sbjct: 539 tggccaggaagcttctccttaatcttgtccatgattcccttcttctc 493



to top

>gb|U73213.1|TAU73213 Triticum aestivum cold acclimation protein WCOR726 (Wcor726) mRNA,
           complete cds
          Length = 667

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||| ||||| ||||| |||||||||||||||||||||| ||| ||||| ||||||
Sbjct: 436 agtgctgtccaggcagcttgtccttgatcttgtccatgatgctcttgttctcaccggtg 378



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgcc 356
           ||||||||||||||||| || || |||| |||||||||||||| |||| |||||||
Sbjct: 263 gggagcttctccttgatgttctcgatgacgcccttcttctcgctggtgccggtgcc 208



to top

>gb|AF155129.1|AF155129 Hordeum vulgare dehydrin 12 (Dhn12) gene, complete cds
          Length = 2890

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                        
Query: 286  gctcagtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccg 345
            ||||||||||| || || |||||||||||||||||||||| ||  ||||||| |||||||
Sbjct: 1897 gctcagtgctgtccgggcagcttctccttgatcttgtccacgactcccttctcctcgccg 1838

             
Query: 346  g 346
            |
Sbjct: 1837 g 1837



to top

>gb|AY465376.1| Prunus persica dehydrin 2 mRNA, complete cds
          Length = 829

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 307 ttctccttgatcttgtccatgatgcccttcttctc 341
           ||||||||||||||||||||||| |||||||||||
Sbjct: 682 ttctccttgatcttgtccatgatccccttcttctc 648



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 298 ccagggagcttctccttgatcttgtccat 326
           ||||| |||||||||||||||||||||||
Sbjct: 547 ccaggcagcttctccttgatcttgtccat 519



to top

>gb|AF172263.1| Prunus dulcis abscisic acid response protein (rab21) mRNA, complete
           cds
          Length = 897

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 307 ttctccttgatcttgtccatgatgcccttcttctc 341
           ||||||||||||||||||||||| |||||||||||
Sbjct: 676 ttctccttgatcttgtccatgatccccttcttctc 642



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 298 ccagggagcttctccttgatcttgtccat 326
           ||||| |||||||||||||||||||||||
Sbjct: 541 ccaggcagcttctccttgatcttgtccat 513



to top

>gb|M62987.1|CRTDESRSA Craterostigma plantagineum dessication-related protein mRNA,
           complete cds
          Length = 634

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 288 tcagtgctggccagggagcttctccttgatcttgtccat 326
           |||||||||||| |||||||||||||||||||| |||||
Sbjct: 415 tcagtgctggccggggagcttctccttgatcttctccat 377



to top

>dbj|AB049335.1| Nicotiana tabacum NtERD10A mRNA for dehydrin, partial cds
          Length = 342

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           |||||||| ||||||||||| ||||||||||| || |||||||||||
Sbjct: 74  tggccaggaagcttctccttaatcttgtccataattcccttcttctc 28



to top

>dbj|AB076807.1| Triticum aestivum Wdhn13 mRNA for LEA D-11 dehydrin, complete cds
          Length = 657

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 290 agtgctggccagggagcttctccttgatcttgtccatgatgcccttcttctcgccggtg 348
           ||||||| ||||| ||||| ||||||||||||||||| |||| ||| ||||| ||||||
Sbjct: 383 agtgctgtccaggcagcttgtccttgatcttgtccatcatgctcttgttctcaccggtg 325



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgcc 356
           |||||||||||||| || || | || ||||||||||||||||||| |||||||
Sbjct: 207 agcttctccttgatgttctcgacgacgcccttcttctcgccggtgccggtgcc 155



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgcc 344
           |||||||||||| ||||  | ||||||| |||||||||||||||
Sbjct: 78  gggagcttctccgtgatgctttccatgacgcccttcttctcgcc 35



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 358 tgctgcccgtaggtgccaccggtg 381
           ||||||||||| ||||||||||||
Sbjct: 129 tgctgcccgtacgtgccaccggtg 106



to top

>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0037B06 map near 50283S, complete sequence
          Length = 149398

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 301   gggagcttctccttgatcttgtccatgatgcccttcttctcg 342
             |||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 89067 gggagcttctccttgatcttctccatcatacccttcttctcg 89026



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 301   gggagcttctccttgatcttgtccatgatgcccttcttc 339
             |||||||||||||||||||| ||| |||| |||||||||
Sbjct: 88881 gggagcttctccttgatcttctccttgattcccttcttc 88843



to top

>emb|X74067.1|CPCDET619 Craterostigma plantagineum CDeT6-19 gene for dessication-related
            protein
          Length = 1742

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 304  agcttctccttgatcttgtccatgatgcccttcttctc 341
            |||||||| ||||||||||||||||||||||| |||||
Sbjct: 1517 agcttctctttgatcttgtccatgatgccctttttctc 1480



to top

>gb|M62988.1|CRTDESRSB Craterostigma plantagineum dessication-related protein mRNA,
           complete cds
          Length = 741

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctc 341
           |||||||| ||||||||||||||||||||||| |||||
Sbjct: 516 agcttctctttgatcttgtccatgatgccctttttctc 479



to top

>emb|X13204.1|GHLEA11 Cotton set 5B Lea gene for seed protein D-11
          Length = 970

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 298 ccagggagcttctccttgatcttgtccat 326
           |||||||||||||||||||||||||||||
Sbjct: 839 ccagggagcttctccttgatcttgtccat 811



to top

>gb|M19379.1|COTSPE G.hirsutum (cotton) storage protein (late embryogenesis abundant)
           mRNA, partial cds, clone D11
          Length = 435

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 298 ccagggagcttctccttgatcttgtccat 326
           |||||||||||||||||||||||||||||
Sbjct: 390 ccagggagcttctccttgatcttgtccat 362



to top

>gb|M81791.1|COTLEA3C Gossypium hirsutum DNA fragment
          Length = 209

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 298 ccagggagcttctccttgatcttgtccat 326
           |||||||||||||||||||||||||||||
Sbjct: 109 ccagggagcttctccttgatcttgtccat 81



to top

>gb|M81654.1|COTLEA3A Gossypium hirsutum dehydrin (Lea3-D11) gene, complete cds
          Length = 531

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 298 ccagggagcttctccttgatcttgtccat 326
           |||||||||||||||||||||||||||||
Sbjct: 401 ccagggagcttctccttgatcttgtccat 373



to top

>gb|AY425975.1| Streptocarpus primulifolius microsatellite B22 sequence
          Length = 646

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 307 ttctccttgatcttgtccatgatgcccttcttctcg 342
           |||||||||||||| ||||| |||||||||||||||
Sbjct: 399 ttctccttgatcttatccatcatgcccttcttctcg 364



to top

>emb|AJ606474.1| Fagus sylvatica mRNA for dehydrin/response ABA (rab1 gene)
          Length = 952

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||| ||||||||||| ||||| |||||||| |||||||||||
Sbjct: 761 ccaggaagcttctcctttatcttttccatgatccccttcttctc 718



to top

>gb|AF044584.1|AF044584 Lavatera thuringiaca cold regulated LTCOR18 (LtCor18) mRNA,
           complete cds
          Length = 759

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||| ||||||||||||||||| ||||| || |||||||||||
Sbjct: 508 ccaggaagcttctccttgatcttctccataatacccttcttctc 465



to top

>ref|NM_126038.2| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18)
           transcript variant AT5G66400.1 mRNA, complete cds
          Length = 864

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 631 agcttttccttgatcttgtccatcatccccttcttctcg 593



to top

>ref|NM_001037085.1| Arabidopsis thaliana RAB18 (RESPONSIVE TO ABA 18) AT5G66400 (RAB18)
           transcript variant AT5G66400.2 mRNA, complete cds
          Length = 881

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 628 agcttttccttgatcttgtccatcatccccttcttctcg 590



to top

>gb|L04173.1|ATH18RAB Arabidopsis thaliana glycine rich protein (RAB18) gene, complete cds
          Length = 1676

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 304  agcttctccttgatcttgtccatgatgcccttcttctcg 342
            ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 1381 agcttttccttgatcttgtccatcatccccttcttctcg 1343



to top

>gb|AY093779.1| Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds
          Length = 798

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 624 agcttttccttgatcttgtccatcatccccttcttctcg 586



to top

>gb|AF428458.1|AF428458 Arabidopsis thaliana AT5g66400/K1F13_5 mRNA, complete cds
          Length = 861

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 631 agcttttccttgatcttgtccatcatccccttcttctcg 593



to top

>gb|AY050416.1| Arabidopsis thaliana At1g11360/T23J18_35 mRNA, complete cds
          Length = 1018

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 235 agcttttccttgatcttgtccatcatccccttcttctcg 273



to top

>gb|AF236067.1|AF236067 Elaeis guineensis clone pKT5 dehydrin-like protein mRNA, complete
           cds
          Length = 775

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||| || ||||||||||||||||| ||||| || |||||||||||
Sbjct: 471 tggcctggtagcttctccttgatcttttccatcatccccttcttctc 425



to top

>dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13
          Length = 83511

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                   
Query: 304  agcttctccttgatcttgtccatgatgcccttcttctcg 342
            ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 7446 agcttttccttgatcttgtccatcatccccttcttctcg 7484



to top

>emb|X68042.1|ATRAB18A A.thaliana rab18 gene
          Length = 1528

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 304  agcttctccttgatcttgtccatgatgcccttcttctcg 342
            ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 1237 agcttttccttgatcttgtccatcatccccttcttctcg 1199



to top

>emb|X64327.1|LGNPR1 L.gibba gene NPR1 (negatively phytochrome regulated 1)
          Length = 1573

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 310  tccttgatcttgtccatgatgcccttcttct 340
            ||||||||||| |||||||||||||||||||
Sbjct: 1356 tccttgatcttctccatgatgcccttcttct 1326



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 295  tggccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
            ||||| || ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 1482 tggcccggcagcttctcctttatcttctccattatccccttcttctc 1436



to top

>gb|BT002226.1| Arabidopsis thaliana At5g66400/K1F13_5 mRNA, complete cds
          Length = 561

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 542 agcttttccttgatcttgtccatcatccccttcttctcg 504



to top

>gb|AY587109.1| Oryza sativa (japonica cultivar-group) dehydration-stress inducible
           protein 1 mRNA, complete cds
          Length = 1315

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctc 341
           |||||||||||||||||||| | || ||||||||||||
Sbjct: 728 agcttctccttgatcttgtcgaggaagcccttcttctc 691



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttct 340
           ||||| || ||||||||||||||||| ||| |||  ||||||||||
Sbjct: 476 tggccgggcagcttctccttgatcttctccttgagccccttcttct 431



to top

>gb|AY786415.1| Oryza sativa (japonica cultivar-group) SK3-type dehydrin 1 (Dhn1)
           mRNA, complete cds
          Length = 1117

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctc 341
           |||||||||||||||||||| | || ||||||||||||
Sbjct: 718 agcttctccttgatcttgtcgaggaagcccttcttctc 681



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttct 340
           ||||| || ||||||||||||||||| ||| |||  ||||||||||
Sbjct: 466 tggccgggcagcttctccttgatcttctccttgagccccttcttct 421



to top

>gb|AF345988.1| Cornus sericea 60 kDa dehydrin-like protein (Rod60) mRNA, complete
            cds
          Length = 1921

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 292  tgctggccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
            ||||| ||||| ||||||||||||||||| |||||||  || ||||||||
Sbjct: 1751 tgctgtccaggaagcttctccttgatcttctccatgactcctttcttctc 1702



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                      
Query: 304      agcttctccttgatcttgtccatgatgcccttcttctc 341
                |||||||||||||||||||| | || ||||||||||||
Sbjct: 27184559 agcttctccttgatcttgtcgaggaagcccttcttctc 27184596



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                              
Query: 295      tggccagggagcttctccttgatcttgtccatgatgcccttcttct 340
                ||||| || ||||||||||||||||| ||| |||  ||||||||||
Sbjct: 27184811 tggccgggcagcttctccttgatcttctccttgagccccttcttct 27184856



to top

>gb|L19419.1|LHPESI Lophopyrum elongatum ES135 mRNA sequence
          Length = 1130

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||||||||||||||| ||||||| ||| ||||||||
Sbjct: 624 agcttctccttgatcttttccatgaagcctttcttctc 587



to top

>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1725_H08
          Length = 155431

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 304   agcttctccttgatcttgtccatgatgcccttcttctc 341
             |||||||||||||||||||| | || ||||||||||||
Sbjct: 81008 agcttctccttgatcttgtcgaggaagcccttcttctc 81045



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 295   tggccagggagcttctccttgatcttgtccatgatgcccttcttct 340
             ||||| || ||||||||||||||||| ||| |||  ||||||||||
Sbjct: 81260 tggccgggcagcttctccttgatcttctccttgagccccttcttct 81305



to top

>dbj|AP005055.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0684A08
          Length = 137841

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 304   agcttctccttgatcttgtccatgatgcccttcttctc 341
             |||||||||||||||||||| | || ||||||||||||
Sbjct: 35230 agcttctccttgatcttgtcgaggaagcccttcttctc 35267



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 295   tggccagggagcttctccttgatcttgtccatgatgcccttcttct 340
             ||||| || ||||||||||||||||| ||| |||  ||||||||||
Sbjct: 35482 tggccgggcagcttctccttgatcttctccttgagccccttcttct 35527



to top

>dbj|AK070197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N13, full
           insert sequence
          Length = 1292

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctc 341
           |||||||||||||||||||| | || ||||||||||||
Sbjct: 740 agcttctccttgatcttgtcgaggaagcccttcttctc 703



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 295 tggccagggagcttctccttgatcttgtccatgatgcccttcttct 340
           ||||| || ||||||||||||||||| ||| |||  ||||||||||
Sbjct: 488 tggccgggcagcttctccttgatcttctccttgagccccttcttct 443



to top

>dbj|AB011367.1| Oryza sativa mRNA for LIP9, partial cds
          Length = 680

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 304 agcttctccttgatcttgtccatgatgcccttcttctc 341
           |||||||||||||||||||| | || ||||||||||||
Sbjct: 161 agcttctccttgatcttgtcgaggaagcccttcttctc 124



to top

>gb|AY243045.1| Boea crassifolia dehydrin-like protein Dh2 mRNA, complete cds
          Length = 697

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 297 gccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           |||||| || ||||||||||| |||||||| || |||||||||||
Sbjct: 468 gccaggcagtttctccttgattttgtccatcatccccttcttctc 424



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 304 agcttctccttgatcttgtccatgatgcccttctt 338
           ||||||||||||| ||||||| |||| ||||||||
Sbjct: 347 agcttctccttgaccttgtccttgatccccttctt 313



to top

>gb|AY266052.1| Deschampsia antarctica dehydrin-like protein pseudogene, partial
           sequence
          Length = 454

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 50/57 (87%), Gaps = 1/57 (1%)
 Strand = Plus / Minus

                                                                    
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctcgccggtgtcggtgccg 357
           |||||||||||||| |||||||||||||  || ||||||||||| ||| | ||||||
Sbjct: 454 gggagcttctcctt-atcttgtccatgagtcctttcttctcgcctgtgcctgtgccg 399



to top

>emb|X83597.1|STDHN1 S.tuberosum dhn1 gene
          Length = 494

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||||||||| |||||||| ||||| || |||||||||||
Sbjct: 492 gggagcttctctttgatcttctccataattcccttcttctc 452



to top

>emb|X83596.1|SCDHN1 S.commersonii dhn1 gene
          Length = 493

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 301 gggagcttctccttgatcttgtccatgatgcccttcttctc 341
           |||||||| ||||||||||| ||||| || |||||||||||
Sbjct: 492 gggagcttttccttgatcttctccataattcccttcttctc 452



to top

>gb|AY160772.1| Citrus x paradisi dehydrin mRNA, complete cds
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 297 gccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||||||||||||||||||  || ||||  ||||||||||||||
Sbjct: 742 gccagggagcttctccttgagtttctccaatatgcccttcttctc 698



to top

>gb|AY105067.1| Zea mays PCO081051 mRNA sequence
          Length = 1398

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 301 gggagcttctccttgatcttgtcca 325
           |||||||||||||||||||||||||
Sbjct: 761 gggagcttctccttgatcttgtcca 737



to top

>dbj|AP006422.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT33E11, TM0310b,
             complete sequence
          Length = 93261

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 298   ccagggagcttctccttgatcttgtccat 326
             ||||| |||||||||||||||||||||||
Sbjct: 26378 ccaggaagcttctccttgatcttgtccat 26406



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                          
Query: 297   gccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
             |||||| ||||||||||||||||| ||||| || || ||||||||
Sbjct: 25828 gccaggaagcttctccttgatcttatccattatccctttcttctc 25872



to top

>gb|M94012.1|SOYMATSGB Glycine max maturation-associated protein (MAT9) mRNA, complete cds
          Length = 947

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| ||||||||||| ||||||||||| || || |||||||||
Sbjct: 701 ccaggaagcttctccttaatcttgtccataatccctttcttctcg 657



to top

>gb|M81655.1|COTLEA3B Gossypium hirsutum dehydrin (Lea3-D147) gene, complete cds
          Length = 531

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 298 ccagggagcttctccttgatcttgtccat 326
           ||||||||||||||||||||||| |||||
Sbjct: 399 ccagggagcttctccttgatcttatccat 371



to top

>gb|U10111.1|GMU10111 Glycine max Essex dehydrin-like protein mRNA, complete cds
          Length = 958

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctcg 342
           ||||| ||||||||||| ||||||||||| || || |||||||||
Sbjct: 691 ccaggaagcttctccttaatcttgtccataatccctttcttctcg 647



to top

>dbj|AB010898.1| Daucus carota mRNA for ecpp44, complete cds
          Length = 925

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 304 agcttctccttgatcttgtccatgatgcccttcttct 340
           ||||||||||||||||| ||||| | |||||||||||
Sbjct: 535 agcttctccttgatcttctccataaagcccttcttct 499



to top

>gb|AY607706.1| Quercus robur dehydrin 2 (Dhn2) mRNA, partial cds
          Length = 860

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||| ||||||||||||||||| ||||| |  |||||||||||
Sbjct: 624 ccaggaagcttctccttgatcttctccatcactcccttcttctc 581



to top

>emb|AJ704825.1| Glycine max partial lea8 gene for putative dehydrin
          Length = 591

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 307 ttctccttgatcttgtccatgatgcccttcttctcg 342
           |||||||||||||||||||| || || |||||||||
Sbjct: 581 ttctccttgatcttgtccataatccctttcttctcg 546



to top

>emb|AJ844016.1| Plantago major partial mRNA for hypothetical protein
          Length = 566

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 310 tccttgatcttgtccatgatgcccttcttctc 341
           ||||||||||||||||  ||||||||||||||
Sbjct: 244 tccttgatcttgtccaccatgcccttcttctc 213



to top

>gb|U91970.1|PSU91970 Pisum sativum dehydrin 3 (Dhn3) mRNA, complete cds
          Length = 809

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||| ||||||||||| ||||||||||| || || ||||||||
Sbjct: 620 ccaggaagcttctccttaatcttgtccataatccctttcttctc 577



to top

>gb|U91969.1|PSU91969 Pisum sativum dehydrin 2 (Dhn2) mRNA, complete cds
          Length = 1125

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 298 ccagggagcttctccttgatcttgtccatgatgcccttcttctc 341
           ||||| ||||||||||| ||||||||||| || || ||||||||
Sbjct: 840 ccaggaagcttctccttaatcttgtccataatccctttcttctc 797


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,536,529
Number of Sequences: 3902068
Number of extensions: 3536529
Number of successful extensions: 73121
Number of sequences better than 10.0: 361
Number of HSP's better than 10.0 without gapping: 360
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 71524
Number of HSP's gapped (non-prelim): 1580
length of query: 430
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 408
effective length of database: 17,147,199,772
effective search space: 6996057506976
effective search space used: 6996057506976
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top