ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart17h12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ417517.1|OSA417517 Oryza sativa partial mRNA for H+-transp... 260 3e-66
2dbj|AK072694.1| Oryza sativa (japonica cultivar-group) cDNA clon... 260 3e-66
3ref|NM_195647.1| Oryza sativa (japonica cultivar-group) putative... 244 2e-61
4gb|AY108441.1| Zea mays PCO083558 mRNA sequence 184 2e-43
5gb|AC131968.1| Oryza sativa (japonica cultivar-group) chromosome... 149 8e-33
6gb|AC021892.16| Genomic sequence for Oryza sativa, Nipponbare st... 149 8e-33
7dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 149 8e-33
8gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 149 8e-33
9dbj|AB194067.1| Ipomoea nil mRNA for mitochondrial F1-ATPase gam... 135 1e-28
10dbj|D14699.1|IPBF1ATPG Ipomoea batatas mRNA for F1-ATPase gammma... 123 5e-25
11ref|NM_128864.2| Arabidopsis thaliana hydrogen-transporting ATP ... 109 7e-21
12gb|BT000409.1| Arabidopsis thaliana mitochondrial F1-ATPase, gam... 109 7e-21
13gb|AY136289.1| Arabidopsis thaliana mitochondrial F1-ATPase, gam... 109 7e-21
14gb|AY102152.1| Arabidopsis thaliana At2g33040/F25I18.22 mRNA, co... 109 7e-21
15gb|AY062627.1| Arabidopsis thaliana mitochondrial F1-ATPase, gam... 109 7e-21
16gb|AY039513.1| Arabidopsis thaliana At2g33040/F25I18.22 mRNA, co... 109 7e-21
17emb|BX819675.1|CNS0A9BS Arabidopsis thaliana Full-length cDNA Co... 109 7e-21
18gb|AY086685.1| Arabidopsis thaliana clone 26812 mRNA, complete s... 109 7e-21
19dbj|D88374.1| Arabidopsis thaliana mRNA for gamma subunit of mit... 109 7e-21
20gb|BT018752.1| Zea mays clone EL01N0523B01.d mRNA sequence 105 1e-19
21gb|AC003033.3| Arabidopsis thaliana chromosome 2 BAC T21L14 geno... 103 5e-19
22gb|AC002334.3| Arabidopsis thaliana chromosome 2 clone F25I18 ma... 103 5e-19
23gb|AF023858.1|AF023858 Solanum tuberosum ATP synthase gamma chai... 103 5e-19
24emb|BX820526.1|CNS0A9P1 Arabidopsis thaliana Full-length cDNA Co... 86 1e-13
25emb|AJ005366.1|ATA005366 Aesculus turbinata microsatellite DNA, ... 82 2e-12
26gb|AY375344.1| Gossypium barbadense fiber protein Fb33 mRNA, par... 64 4e-07
27emb|BX548171.4| Zebrafish DNA sequence from clone DKEY-152J20 in... 44 0.36
28emb|BX469923.7| Zebrafish DNA sequence from clone RP71-3J3 in li... 44 0.36
29gb|AC006354.2| Homo sapiens PAC clone RP5-1091B14 from 7, comple... 42 1.4
30gb|AC099791.2| Homo sapiens chromosome 1 clone RP11-430G17, comp... 42 1.4
31gb|AC022348.2|AC022348 Drosophila melanogaster, chromosome X, re... 42 1.4
32gb|AE003508.4| Drosophila melanogaster chromosome X, section 60 ... 42 1.4
33ref|NM_105208.1| Arabidopsis thaliana CYP96A3; heme binding / ir... 40 5.6
34ref|XM_585301.2| PREDICTED: Bos taurus similar to Ubiquitin-prot... 40 5.6
35ref|XM_615804.2| PREDICTED: Bos taurus similar to SORCS receptor... 40 5.6
36gb|AC126032.4| Mus musculus BAC clone RP24-94B12 from chromosome... 40 5.6
37emb|BX511153.9| Zebrafish DNA sequence from clone DKEYP-66D1 in ... 40 5.6
38dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113 40 5.6
39gb|AC074031.16| Homo sapiens 12 BAC RP11-272K23 (Roswell Park Ca... 40 5.6
40gb|AF528573.1| Arabidopsis thaliana ecotype Lisse-2 putative cyt... 40 5.6
41gb|AF528572.1| Arabidopsis thaliana ecotype Ita-0 putative cytoc... 40 5.6
42gb|AF528571.1| Arabidopsis thaliana ecotype Gr-3 putative cytoch... 40 5.6
43gb|AF528570.1| Arabidopsis thaliana ecotype Chi-1 putative cytoc... 40 5.6
44gb|AF528569.1| Arabidopsis thaliana ecotype Bs-1 putative cytoch... 40 5.6
45gb|AF528568.1| Arabidopsis thaliana ecotype Bla-1 putative cytoc... 40 5.6
46gb|AF528567.1| Arabidopsis thaliana ecotype Kas-1 putative cytoc... 40 5.6
47gb|AF528566.1| Arabidopsis thaliana ecotype Cvi-0 putative cytoc... 40 5.6
48gb|AC004512.2|T8F5 Arabidopsis thaliana chromosome 1 BAC T8F5 se... 40 5.6
49gb|AF087753.1|AF087753 Oryctolagus cuniculus clone Lb 80-H immun... 40 5.6
50emb|AL954692.9| Zebrafish DNA sequence from clone CH211-284O19, ... 40 5.6
51gb|AC026911.15| Mus musculus chromosome 1, clone RP23-190F21, co... 40 5.6 
>emb|AJ417517.1|OSA417517 Oryza sativa partial mRNA for H+-transporting ATP synthase (xd1
           gene)
          Length = 599

 Score =  260 bits (131), Expect = 3e-66
 Identities = 194/215 (90%)
 Strand = Plus / Minus

                                                                       
Query: 205 agtttcatcatcatccctcaagagcagaggcaccggatatgatctcagtgagctccgtag 264
           ||||||||||| |||||||||| ||||| || || || || |||||| ||||||| ||||
Sbjct: 499 agtttcatcattatccctcaagggcagaagcgccagagataatctcaatgagctctgtag 440

                                                                       
Query: 265 tgatagatgcttgacgtgtcctgttgtatgtcagtgtaagacggtcaagcatttcaccgg 324
           ||||||||||||||||||||||||||||||| || || || || |||||||||||||| |
Sbjct: 439 tgatagatgcttgacgtgtcctgttgtatgtgagggtgagtcgatcaagcatttcaccag 380

                                                                       
Query: 325 catttctgctggagctgtccatagcagacatacgggcaccaagctcactgcaggcattct 384
           | |||||||||||||||||||||||||||||||| || |||||||||||||| |||||||
Sbjct: 379 cgtttctgctggagctgtccatagcagacatacgtgctccaagctcactgcatgcattct 320

                                              
Query: 385 ctagaacagcattatacataacacaagaaaactgg 419
           ||||| |||||||||||| ||||||||||||||||
Sbjct: 319 ctagagcagcattatacacaacacaagaaaactgg 285
to top
>dbj|AK072694.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023135E20, full
            insert sequence
          Length = 1413

 Score =  260 bits (131), Expect = 3e-66
 Identities = 194/215 (90%)
 Strand = Plus / Minus

                                                                        
Query: 205  agtttcatcatcatccctcaagagcagaggcaccggatatgatctcagtgagctccgtag 264
            ||||||||||| |||||||||| ||||| || || || || |||||| ||||||| ||||
Sbjct: 1049 agtttcatcattatccctcaagggcagaagcgccagagataatctcaatgagctctgtag 990

                                                                        
Query: 265  tgatagatgcttgacgtgtcctgttgtatgtcagtgtaagacggtcaagcatttcaccgg 324
            ||||||||||||||||||||||||||||||| || || || || |||||||||||||| |
Sbjct: 989  tgatagatgcttgacgtgtcctgttgtatgtgagggtgagtcgatcaagcatttcaccag 930

                                                                        
Query: 325  catttctgctggagctgtccatagcagacatacgggcaccaagctcactgcaggcattct 384
            | |||||||||||||||||||| ||||||||||| || |||||||||||||| |||||||
Sbjct: 929  cgtttctgctggagctgtccatggcagacatacgtgctccaagctcactgcatgcattct 870

                                               
Query: 385  ctagaacagcattatacataacacaagaaaactgg 419
            ||||| |||||||||||||||||||||||||||||
Sbjct: 869  ctagagcagcattatacataacacaagaaaactgg 835
to top
>ref|NM_195647.1| Oryza sativa (japonica cultivar-group) putative ATP synthase gamma
            chain, mitochondrial precursor (OSJNBa0053D03.10), mRNA
          Length = 1107

 Score =  244 bits (123), Expect = 2e-61
 Identities = 183/203 (90%)
 Strand = Plus / Minus

                                                                        
Query: 217  atccctcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgctt 276
            |||||||||| ||||| || || || || |||||| ||||||| ||||||||||||||||
Sbjct: 1105 atccctcaagggcagaagcgccagagataatctcaatgagctctgtagtgatagatgctt 1046

                                                                        
Query: 277  gacgtgtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctgg 336
            ||||||||||||||||||| || || || || |||||||||||||| || ||||||||||
Sbjct: 1045 gacgtgtcctgttgtatgtgagggtgagtcgatcaagcatttcaccagcgtttctgctgg 986

                                                                        
Query: 337  agctgtccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcat 396
            |||||||||| ||||||||||| || |||||||||||||| |||||||||||| ||||||
Sbjct: 985  agctgtccatggcagacatacgtgctccaagctcactgcatgcattctctagagcagcat 926

                                   
Query: 397  tatacataacacaagaaaactgg 419
            |||||||||||||||||||||||
Sbjct: 925  tatacataacacaagaaaactgg 903
to top
>gb|AY108441.1| Zea mays PCO083558 mRNA sequence
          Length = 1514

 Score =  184 bits (93), Expect = 2e-43
 Identities = 174/201 (86%)
 Strand = Plus / Minus

                                                                        
Query: 219  ccctcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttga 278
            |||||||| || || ||||| ||||| |||||||| ||||| || ||||| |||||||| 
Sbjct: 1065 ccctcaagggccgatgcaccagatataatctcagtaagctctgtggtgatggatgcttgg 1006

                                                                        
Query: 279  cgtgtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggag 338
            |||||||||||||| || || || ||||| |||||||| || || ||||||||||| |||
Sbjct: 1005 cgtgtcctgttgtaagtgagagtgagacgatcaagcatatcgccagcatttctgctagag 946

                                                                        
Query: 339  ctgtccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcatta 398
            |||||||| |||||||||||||| |||||||||||||| |||||||||||  || |||| 
Sbjct: 945  ctgtccatggcagacatacgggctccaagctcactgcatgcattctctagggcaccattg 886

                                 
Query: 399  tacataacacaagaaaactgg 419
            ||||| |||||||||||||||
Sbjct: 885  tacatgacacaagaaaactgg 865
to top
>gb|AC131968.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAa0053D03, complete sequence
          Length = 150496

 Score =  149 bits (75), Expect = 8e-33
 Identities = 111/123 (90%)
 Strand = Plus / Minus

                                                                         
Query: 284   cctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctgtc 343
             |||||||||||| || || || || |||||||||||||| || |||||||||||||||||
Sbjct: 23627 cctgttgtatgtgagggtgagtcgatcaagcatttcaccagcgtttctgctggagctgtc 23568

                                                                         
Query: 344   catagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatacat 403
             ||| ||||||||||| || |||||||||||||| |||||||||||| |||||||||||||
Sbjct: 23567 catggcagacatacgtgctccaagctcactgcatgcattctctagagcagcattatacat 23508

                
Query: 404   aac 406
             |||
Sbjct: 23507 aac 23505



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                         
Query: 205   agtttcatcatcatccctcaagagcagaggcaccggatatgatctcagtgagctccgtag 264
             ||||||||||| |||||||||| ||||| || || || || |||||| ||||||| ||||
Sbjct: 24040 agtttcatcattatccctcaagggcagaagcgccagagataatctcaatgagctctgtag 23981

                                    
Query: 265   tgatagatgcttgacgtgtcctg 287
             |||||||||||||||||||||||
Sbjct: 23980 tgatagatgcttgacgtgtcctg 23958
to top
>gb|AC021892.16| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0053D03, from chromosome 10, complete sequence
          Length = 199113

 Score =  149 bits (75), Expect = 8e-33
 Identities = 111/123 (90%)
 Strand = Plus / Plus

                                                                         
Query: 284   cctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctgtc 343
             |||||||||||| || || || || |||||||||||||| || |||||||||||||||||
Sbjct: 36374 cctgttgtatgtgagggtgagtcgatcaagcatttcaccagcgtttctgctggagctgtc 36433

                                                                         
Query: 344   catagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatacat 403
             ||| ||||||||||| || |||||||||||||| |||||||||||| |||||||||||||
Sbjct: 36434 catggcagacatacgtgctccaagctcactgcatgcattctctagagcagcattatacat 36493

                
Query: 404   aac 406
             |||
Sbjct: 36494 aac 36496



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 74/83 (89%)
 Strand = Plus / Plus

                                                                         
Query: 205   agtttcatcatcatccctcaagagcagaggcaccggatatgatctcagtgagctccgtag 264
             ||||||||||| |||||||||| ||||| || || || || |||||| ||||||| ||||
Sbjct: 35961 agtttcatcattatccctcaagggcagaagcgccagagataatctcaatgagctctgtag 36020

                                    
Query: 265   tgatagatgcttgacgtgtcctg 287
             |||||||||||||||||||||||
Sbjct: 36021 tgatagatgcttgacgtgtcctg 36043
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score =  149 bits (75), Expect = 8e-33
 Identities = 111/123 (90%)
 Strand = Plus / Minus

                                                                           
Query: 284     cctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctgtc 343
               |||||||||||| || || || || |||||||||||||| || |||||||||||||||||
Sbjct: 8220105 cctgttgtatgtgagggtgagtcgatcaagcatttcaccagcgtttctgctggagctgtc 8220046

                                                                           
Query: 344     catagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatacat 403
               ||| ||||||||||| || |||||||||||||| |||||||||||| |||||||||||||
Sbjct: 8220045 catggcagacatacgtgctccaagctcactgcatgcattctctagagcagcattatacat 8219986

                  
Query: 404     aac 406
               |||
Sbjct: 8219985 aac 8219983



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                           
Query: 205     agtttcatcatcatccctcaagagcagaggcaccggatatgatctcagtgagctccgtag 264
               ||||||||||| |||||||||| ||||| || || || || |||||| ||||||| ||||
Sbjct: 8220518 agtttcatcattatccctcaagggcagaagcgccagagataatctcaatgagctctgtag 8220459

                                      
Query: 265     tgatagatgcttgacgtgtcctg 287
               |||||||||||||||||||||||
Sbjct: 8220458 tgatagatgcttgacgtgtcctg 8220436
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  149 bits (75), Expect = 8e-33
 Identities = 111/123 (90%)
 Strand = Plus / Minus

                                                                           
Query: 284     cctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctgtc 343
               |||||||||||| || || || || |||||||||||||| || |||||||||||||||||
Sbjct: 8225204 cctgttgtatgtgagggtgagtcgatcaagcatttcaccagcgtttctgctggagctgtc 8225145

                                                                           
Query: 344     catagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatacat 403
               ||| ||||||||||| || |||||||||||||| |||||||||||| |||||||||||||
Sbjct: 8225144 catggcagacatacgtgctccaagctcactgcatgcattctctagagcagcattatacat 8225085

                  
Query: 404     aac 406
               |||
Sbjct: 8225084 aac 8225082



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                           
Query: 205     agtttcatcatcatccctcaagagcagaggcaccggatatgatctcagtgagctccgtag 264
               ||||||||||| |||||||||| ||||| || || || || |||||| ||||||| ||||
Sbjct: 8225617 agtttcatcattatccctcaagggcagaagcgccagagataatctcaatgagctctgtag 8225558

                                      
Query: 265     tgatagatgcttgacgtgtcctg 287
               |||||||||||||||||||||||
Sbjct: 8225557 tgatagatgcttgacgtgtcctg 8225535
to top
>dbj|AB194067.1| Ipomoea nil mRNA for mitochondrial F1-ATPase gamma subunit, complete
            cds
          Length = 1412

 Score =  135 bits (68), Expect = 1e-28
 Identities = 149/176 (84%)
 Strand = Plus / Minus

                                                                        
Query: 240  gatatgatctcagtgagctccgtagtgatagatgcttgacgtgtcctgttgtatgtcagt 299
            ||||||||||| || || || || ||||||||||||||||| || |||||||| || || 
Sbjct: 1033 gatatgatctctgtcagttctgtggtgatagatgcttgacgggttctgttgtaagtgagg 974

                                                                        
Query: 300  gtaagacggtcaagcatttcaccggcatttctgctggagctgtccatagcagacatacgg 359
            || || || |||||||||||||| ||||| ||||||||||||||||| |||||||| |  
Sbjct: 973  gtgaggcgatcaagcatttcaccagcattcctgctggagctgtccatggcagacatcctt 914

                                                                    
Query: 360  gcaccaagctcactgcaggcattctctagaacagcattatacataacacaagaaaa 415
            || ||  |||||||||| ||||||||||||||||||||  |||| ||||| |||||
Sbjct: 913  gccccttgctcactgcaagcattctctagaacagcattgaacattacacatgaaaa 858
to top
>dbj|D14699.1|IPBF1ATPG Ipomoea batatas mRNA for F1-ATPase gammma subunit, complete cds
          Length = 1389

 Score =  123 bits (62), Expect = 5e-25
 Identities = 116/134 (86%)
 Strand = Plus / Minus

                                                                        
Query: 264  gtgatagatgcttgacgtgtcctgttgtatgtcagtgtaagacggtcaagcatttcaccg 323
            ||||||||||||||||| || |||||||| || || || || || |||||||||||||| 
Sbjct: 1010 gtgatagatgcttgacgggttctgttgtaagtgagggtgaggcgatcaagcatttcacca 951

                                                                        
Query: 324  gcatttctgctggagctgtccatagcagacatacgggcaccaagctcactgcaggcattc 383
            ||||| ||||||||||||||||| |||||||| |  || ||  |||||||||| ||||||
Sbjct: 950  gcattcctgctggagctgtccatggcagacatccttgccccttgctcactgcaagcattc 891

                          
Query: 384  tctagaacagcatt 397
            ||||||||||||||
Sbjct: 890  tctagaacagcatt 877
to top
>ref|NM_128864.2| Arabidopsis thaliana hydrogen-transporting ATP synthase, rotational
            mechanism / hydrogen-transporting ATPase, rotational
            mechanism AT2G33040 mRNA, complete cds
          Length = 1309

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                        
Query: 222  tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
            ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 1098 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 1039

                                                                        
Query: 282  gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
            |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 1038 gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 979

                                                                        
Query: 342  tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatac 401
            ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||  ||
Sbjct: 978  tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcattgaac 919

                       
Query: 402  ataacacaaga 412
            || ||||||||
Sbjct: 918  atcacacaaga 908
to top
>gb|BT000409.1| Arabidopsis thaliana mitochondrial F1-ATPase, gamma subunit
           (ATP3_ARATH) (At2g33040) mRNA, complete cds
          Length = 1092

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                       
Query: 222 tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
           ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 965 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 906

                                                                       
Query: 282 gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
           |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 905 gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 846

                                                                       
Query: 342 tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatac 401
           ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||  ||
Sbjct: 845 tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcattgaac 786

                      
Query: 402 ataacacaaga 412
           || ||||||||
Sbjct: 785 atcacacaaga 775
to top
>gb|AY136289.1| Arabidopsis thaliana mitochondrial F1-ATPase, gamma subunit
            (ATP3_ARATH) (At2g33040) mRNA, complete cds
          Length = 1265

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                        
Query: 222  tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
            ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 1053 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 994

                                                                        
Query: 282  gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
            |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 993  gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 934

                                                                        
Query: 342  tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatac 401
            ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||  ||
Sbjct: 933  tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcattgaac 874

                       
Query: 402  ataacacaaga 412
            || ||||||||
Sbjct: 873  atcacacaaga 863
to top
>gb|AY102152.1| Arabidopsis thaliana At2g33040/F25I18.22 mRNA, complete cds
          Length = 978

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                       
Query: 222 tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
           ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 965 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 906

                                                                       
Query: 282 gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
           |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 905 gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 846

                                                                       
Query: 342 tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatac 401
           ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||  ||
Sbjct: 845 tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcattgaac 786

                      
Query: 402 ataacacaaga 412
           || ||||||||
Sbjct: 785 atcacacaaga 775
to top
>gb|AY062627.1| Arabidopsis thaliana mitochondrial F1-ATPase, gamma subunit
            (ATP3_ARATH) (At2g33040; F25I18.22) mRNA, complete cds
          Length = 1360

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                        
Query: 222  tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
            ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 1064 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 1005

                                                                        
Query: 282  gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
            |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 1004 gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 945

                                                                        
Query: 342  tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatac 401
            ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||  ||
Sbjct: 944  tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcattgaac 885

                       
Query: 402  ataacacaaga 412
            || ||||||||
Sbjct: 884  atcacacaaga 874
to top
>gb|AY039513.1| Arabidopsis thaliana At2g33040/F25I18.22 mRNA, complete cds
          Length = 1238

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                        
Query: 222  tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
            ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 1051 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 992

                                                                        
Query: 282  gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
            |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 991  gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 932

                                                                        
Query: 342  tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatac 401
            ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||  ||
Sbjct: 931  tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcattgaac 872

                       
Query: 402  ataacacaaga 412
            || ||||||||
Sbjct: 871  atcacacaaga 861
to top
>emb|BX819675.1|CNS0A9BS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS16ZE03 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1205

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                        
Query: 222  tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
            ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 1068 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 1009

                                                                        
Query: 282  gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
            |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 1008 gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 949

                                                                        
Query: 342  tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatac 401
            ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||  ||
Sbjct: 948  tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcattgaac 889

                       
Query: 402  ataacacaaga 412
            || ||||||||
Sbjct: 888  atcacacaaga 878
to top
>gb|AY086685.1| Arabidopsis thaliana clone 26812 mRNA, complete sequence
          Length = 1310

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                        
Query: 222  tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
            ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 1098 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 1039

                                                                        
Query: 282  gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
            |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 1038 gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 979

                                                                        
Query: 342  tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatac 401
            ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||  ||
Sbjct: 978  tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcattgaac 919

                       
Query: 402  ataacacaaga 412
            || ||||||||
Sbjct: 918  atcacacaaga 908
to top
>dbj|D88374.1| Arabidopsis thaliana mRNA for gamma subunit of mitochondrial
            F1-ATPase, complete cds
          Length = 1267

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                        
Query: 222  tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
            ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 1039 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 980

                                                                        
Query: 282  gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
            |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 979  gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 920

                                                                        
Query: 342  tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcattatac 401
            ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||  ||
Sbjct: 919  tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcattgaac 860

                       
Query: 402  ataacacaaga 412
            || ||||||||
Sbjct: 859  atcacacaaga 849
to top
>gb|BT018752.1| Zea mays clone EL01N0523B01.d mRNA sequence
          Length = 1345

 Score =  105 bits (53), Expect = 1e-19
 Identities = 169/207 (81%), Gaps = 8/207 (3%)
 Strand = Plus / Minus

                                                                        
Query: 217  atccctcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgctt 276
            |||| ||||| || || ||||| ||||| |||||||| ||||| || ||||| |||||||
Sbjct: 1039 atccttcaagggctgatgcaccagatataatctcagtaagctctgtggtgatggatgctt 980

                                                                        
Query: 277  gacgtgtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctgg 336
            | |||||||||||||| || || || ||||| |||||| | | ||  ||||||||||| |
Sbjct: 979  ggcgtgtcctgttgtaagtaagcgtgagacgatcaagcctattacgagcatttctgctag 920

                                                                        
Query: 337  agctgtccatagcagaca----tacgggcaccaagctcactgcaggcattctctagaaca 392
            |||||||||| |||||||    || ||    ||||||||||||| |||||||||||  ||
Sbjct: 919  agctgtccatggcagacacttttaagg----caagctcactgcatgcattctctagggca 864

                                       
Query: 393  gcattatacataacacaagaaaactgg 419
             |||| ||||| |||||||||||||||
Sbjct: 863  ccattgtacatgacacaagaaaactgg 837
to top
>gb|AC003033.3| Arabidopsis thaliana chromosome 2 BAC T21L14 genomic sequence,
            complete sequence
          Length = 96801

 Score =  103 bits (52), Expect = 5e-19
 Identities = 145/176 (82%)
 Strand = Plus / Minus

                                                                        
Query: 222  tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
            ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 4494 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 4435

                                                                        
Query: 282  gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
            |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 4434 gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 4375

                                                                    
Query: 342  tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcatt 397
            ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||
Sbjct: 4374 tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcatt 4319
to top
>gb|AC002334.3| Arabidopsis thaliana chromosome 2 clone F25I18 map TEn5, complete
             sequence
          Length = 93158

 Score =  103 bits (52), Expect = 5e-19
 Identities = 145/176 (82%)
 Strand = Plus / Minus

                                                                         
Query: 222   tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
             ||||||||||| || || || || |||||| | ||||| || || ||||| |||||||| 
Sbjct: 81469 tcaagagcagaagctccagagataatctcaataagctctgttgtaatagaagcttgacga 81410

                                                                         
Query: 282   gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
             |||||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 81409 gtcctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 81350

                                                                     
Query: 342   tccatagcagacatacgggcaccaagctcactgcaggcattctctagaacagcatt 397
             ||||| |||||||| |  || || | |||||| || |||||||| ||||| |||||
Sbjct: 81349 tccatggcagacattcttgctcccatctcactacatgcattctccagaaccgcatt 81294
to top
>gb|AF023858.1|AF023858 Solanum tuberosum ATP synthase gamma chain mRNA, nuclear gene
           encoding mitochondrial protein, partial cds
          Length = 718

 Score =  103 bits (52), Expect = 5e-19
 Identities = 100/116 (86%)
 Strand = Plus / Minus

                                                                       
Query: 240 gatatgatctcagtgagctccgtagtgatagatgcttgacgtgtcctgttgtatgtcagt 299
           |||||||||||| | ||||| || ||||||||||||||||| || |||||||| || || 
Sbjct: 475 gatatgatctcaatcagctctgtggtgatagatgcttgacgggttctgttgtaagtaaga 416

                                                                   
Query: 300 gtaagacggtcaagcatttcaccggcatttctgctggagctgtccatagcagacat 355
           || ||||| |||||||| ||| |||||||||||||||| || ||||| ||||||||
Sbjct: 415 gtgagacgatcaagcatgtcaacggcatttctgctggaactatccatggcagacat 360
to top
>emb|BX820526.1|CNS0A9P1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH44ZD12 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1327

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Minus

                                                                        
Query: 222  tcaagagcagaggcaccggatatgatctcagtgagctccgtagtgatagatgcttgacgt 281
            ||||||||||| || || || || || ||| ||||||| || |||||||| |||||||| 
Sbjct: 1080 tcaagagcagaagctccagagataatgtcaatgagctctgttgtgatagaagcttgacga 1021

                                                                        
Query: 282  gtcctgttgtatgtcagtgtaagacggtcaagcatttcaccggcatttctgctggagctg 341
            || ||||||||||| || || |||||||| |||||||| || || |||||||| ||||||
Sbjct: 1020 gttctgttgtatgtgagggtgagacggtcgagcatttctcctgcgtttctgcttgagctg 961

                       
Query: 342  tccatagcaga 352
            | ||| |||||
Sbjct: 960  ttcatggcaga 950
to top
>emb|AJ005366.1|ATA005366 Aesculus turbinata microsatellite DNA, locus AT7D8
          Length = 408

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 303 agacggtcaagcatttcaccggcatttctgctggagctgtccatagcagacatacgggca 362
           |||||||||||||||||||| ||||||||||| ||||| ||||| |||||||| |  || 
Sbjct: 244 agacggtcaagcatttcaccagcatttctgcttgagctatccatggcagacatccttgct 185

                                    
Query: 363 ccaagctcactgcaggcattctcta 387
           ||  |||||||||| ||||||||||
Sbjct: 184 ccttgctcactgcaagcattctcta 160
to top
>gb|AY375344.1| Gossypium barbadense fiber protein Fb33 mRNA, partial cds
          Length = 1083

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 143/180 (79%)
 Strand = Plus / Minus

                                                                       
Query: 240 gatatgatctcagtgagctccgtagtgatagatgcttgacgtgtcctgttgtatgtcagt 299
           ||||| |||||| | | |||||| | ||| || |||||||| || ||||| ||||| || 
Sbjct: 784 gatataatctcaatcaactccgtggggattgaagcttgacgggttctgttatatgtaaga 725

                                                                       
Query: 300 gtaagacggtcaagcatttcaccggcatttctgctggagctgtccatagcagacatacgg 359
           || ||  | |||||||| || ||||| |||||||| ||||| |||||||||||||| |  
Sbjct: 724 gtcaggggatcaagcatgtcgccggcgtttctgcttgagctatccatagcagacatcctt 665

                                                                       
Query: 360 gcaccaagctcactgcaggcattctctagaacagcattatacataacacaagaaaactgg 419
           || ||  ||||||| || |||||||| | ||| |||||  |||| |||||||| ||||||
Sbjct: 664 gctccttgctcactacaagcattctccaaaaccgcattgaacatgacacaagagaactgg 605
to top
>emb|BX548171.4| Zebrafish DNA sequence from clone DKEY-152J20 in linkage group 14,
             complete sequence
          Length = 174366

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 49    aacaaaatgaaacaaggttgat 70
             ||||||||||||||||||||||
Sbjct: 76742 aacaaaatgaaacaaggttgat 76763
to top
>emb|BX469923.7| Zebrafish DNA sequence from clone RP71-3J3 in linkage group 5, complete
              sequence
          Length = 151639

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 49     aacaaaatgaaacaaggttgat 70
              ||||||||||||||||||||||
Sbjct: 141154 aacaaaatgaaacaaggttgat 141175
to top
>gb|AC006354.2| Homo sapiens PAC clone RP5-1091B14 from 7, complete sequence
          Length = 155742

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 370   cactgcaggcattctctagaa 390
             |||||||||||||||||||||
Sbjct: 28734 cactgcaggcattctctagaa 28754
to top
>gb|AC099791.2| Homo sapiens chromosome 1 clone RP11-430G17, complete sequence
          Length = 239704

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 135    agaaaacaaaaggctgtttcagatt 159
              ||||| |||||||||||||||||||
Sbjct: 116217 agaaaccaaaaggctgtttcagatt 116193
to top
>gb|AC022348.2|AC022348 Drosophila melanogaster, chromosome X, region 17E-18A, BAC clone
             BACR32F24, complete sequence
          Length = 162307

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 188   taaagacgatggtgtagagtt 208
             |||||||||||||||||||||
Sbjct: 60105 taaagacgatggtgtagagtt 60125
to top
>gb|AE003508.4| Drosophila melanogaster chromosome X, section 60 of 74 of the complete
             sequence
          Length = 290619

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 188   taaagacgatggtgtagagtt 208
             |||||||||||||||||||||
Sbjct: 96699 taaagacgatggtgtagagtt 96719
to top
>ref|NM_105208.1| Arabidopsis thaliana CYP96A3; heme binding / iron ion binding /
           monooxygenase/ oxygen binding AT1G65340 (CYP96A3) mRNA,
           complete cds
          Length = 1512

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 tcatcatccctcaagagcagaggc 235
           ||||||||||||||||| ||||||
Sbjct: 807 tcatcatccctcaagaggagaggc 830
to top
>ref|XM_585301.2| PREDICTED: Bos taurus similar to Ubiquitin-protein ligase E3C
            (LOC508513), mRNA
          Length = 4685

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 172  cattggaacatacaaataaa 191
            ||||||||||||||||||||
Sbjct: 4643 cattggaacatacaaataaa 4624
to top
>ref|XM_615804.2| PREDICTED: Bos taurus similar to SORCS receptor 1 isoform a
            (LOC535694), mRNA
          Length = 1284

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 129  cacaggagaaaacaaaaggc 148
            ||||||||||||||||||||
Sbjct: 1110 cacaggagaaaacaaaaggc 1129
to top
>gb|AC126032.4| Mus musculus BAC clone RP24-94B12 from chromosome 1, complete sequence
          Length = 207475

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   catcatccctcaagagcaga 232
             ||||||||||||||||||||
Sbjct: 71753 catcatccctcaagagcaga 71772
to top
>emb|BX511153.9| Zebrafish DNA sequence from clone DKEYP-66D1 in linkage group 2,
            complete sequence
          Length = 146969

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 39   tgccactttgaacaaaatga 58
            ||||||||||||||||||||
Sbjct: 7139 tgccactttgaacaaaatga 7120
to top
>dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113
          Length = 1841713

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    ttggaacatacaaataaaga 193
              ||||||||||||||||||||
Sbjct: 917496 ttggaacatacaaataaaga 917477
to top
>gb|AC074031.16| Homo sapiens 12 BAC RP11-272K23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 163912

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    gaaaacaaaaggctgtttca 155
              ||||||||||||||||||||
Sbjct: 109507 gaaaacaaaaggctgtttca 109488
to top
>gb|AF528573.1| Arabidopsis thaliana ecotype Lisse-2 putative cytochrome P450
           (At1g65340) gene, partial cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 tcatcatccctcaagagcagaggc 235
           ||||||||||||||||| ||||||
Sbjct: 589 tcatcatccctcaagaggagaggc 612
to top
>gb|AF528572.1| Arabidopsis thaliana ecotype Ita-0 putative cytochrome P450
           (At1g65340) gene, partial cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 tcatcatccctcaagagcagaggc 235
           ||||||||||||||||| ||||||
Sbjct: 589 tcatcatccctcaagaggagaggc 612
to top
>gb|AF528571.1| Arabidopsis thaliana ecotype Gr-3 putative cytochrome P450
           (At1g65340) gene, partial cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 tcatcatccctcaagagcagaggc 235
           ||||||||||||||||| ||||||
Sbjct: 589 tcatcatccctcaagaggagaggc 612
to top
>gb|AF528570.1| Arabidopsis thaliana ecotype Chi-1 putative cytochrome P450
           (At1g65340) gene, partial cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 tcatcatccctcaagagcagaggc 235
           ||||||||||||||||| ||||||
Sbjct: 589 tcatcatccctcaagaggagaggc 612
to top
>gb|AF528569.1| Arabidopsis thaliana ecotype Bs-1 putative cytochrome P450
           (At1g65340) gene, partial cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 tcatcatccctcaagagcagaggc 235
           ||||||||||||||||| ||||||
Sbjct: 589 tcatcatccctcaagaggagaggc 612
to top
>gb|AF528568.1| Arabidopsis thaliana ecotype Bla-1 putative cytochrome P450
           (At1g65340) gene, partial cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 tcatcatccctcaagagcagaggc 235
           ||||||||||||||||| ||||||
Sbjct: 589 tcatcatccctcaagaggagaggc 612
to top
>gb|AF528567.1| Arabidopsis thaliana ecotype Kas-1 putative cytochrome P450
           (At1g65340) gene, partial cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 tcatcatccctcaagagcagaggc 235
           ||||||||||||||||| ||||||
Sbjct: 589 tcatcatccctcaagaggagaggc 612
to top
>gb|AF528566.1| Arabidopsis thaliana ecotype Cvi-0 putative cytochrome P450
           (At1g65340) gene, partial cds
          Length = 939

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 212 tcatcatccctcaagagcagaggc 235
           ||||||||||||||||| ||||||
Sbjct: 589 tcatcatccctcaagaggagaggc 612
to top
>gb|AC004512.2|T8F5 Arabidopsis thaliana chromosome 1 BAC T8F5 sequence, complete sequence
          Length = 88292

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 212   tcatcatccctcaagagcagaggc 235
             ||||||||||||||||| ||||||
Sbjct: 34902 tcatcatccctcaagaggagaggc 34879
to top
>gb|AF087753.1|AF087753 Oryctolagus cuniculus clone Lb 80-H immunoglobulin heavy chain
           V-D-J region (IgH) gene, partial cds
          Length = 346

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 170 ttcattggaacatacaaata 189
           ||||||||||||||||||||
Sbjct: 320 ttcattggaacatacaaata 301
to top
>emb|AL954692.9| Zebrafish DNA sequence from clone CH211-284O19, complete sequence
          Length = 101677

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 39    tgccactttgaacaaaatga 58
             ||||||||||||||||||||
Sbjct: 95201 tgccactttgaacaaaatga 95182
to top
>gb|AC026911.15| Mus musculus chromosome 1, clone RP23-190F21, complete sequence
          Length = 239743

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 213    catcatccctcaagagcaga 232
              ||||||||||||||||||||
Sbjct: 195123 catcatccctcaagagcaga 195142


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,832,986
Number of Sequences: 3902068
Number of extensions: 4832986
Number of successful extensions: 83530
Number of sequences better than 10.0: 51
Number of HSP's better than 10.0 without gapping: 51
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83428
Number of HSP's gapped (non-prelim): 100
length of query: 419
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 397
effective length of database: 17,147,199,772
effective search space: 6807438309484
effective search space used: 6807438309484
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top