ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart17d07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009444.1| Triticum aestivum clone wlmk8.pk0004.f6:fis, full... 84 3e-13
2gb|AC127951.4| Rattus norvegicus 18 BAC CH230-150D9 (Children's ... 50 0.005
3emb|AL031737.2|HS8B22 Human DNA sequence from clone RP1-8B22 on ... 50 0.005
4emb|BX000479.11| Mouse DNA sequence from clone RP23-139I16 on ch... 50 0.005
5gb|AC139131.19| Mus musculus chromosome 7, clone RP23-301N20, co... 48 0.018
6gb|AC170188.2| Mus musculus BAC clone RP24-195M20 from chromosom... 48 0.018
7gb|AC161574.8| Mus musculus chromosome 1, clone RP23-352D14, com... 48 0.018
8gb|AC102938.20| Mus musculus chromosome 1, clone RP24-187H3, com... 48 0.018
9gb|AC004643.1| Homo sapiens chromosome 16, cosmid clone 363E3 (L... 48 0.018
10gb|AC183807.3| Pan troglodytes BAC clone CH251-65H22 from chromo... 48 0.018
11gb|AC149221.2| Mus musculus BAC clone RP23-402P22 from chromosom... 48 0.018
12gb|AC161612.5| Pan troglodytes BAC clone CH251-703C23 from chrom... 48 0.018
13gb|AC099704.7| Mus musculus chromosome 15, clone RP23-256A2, com... 48 0.018
14gb|AC126940.4| Mus musculus BAC clone RP23-77E4 from chromosome ... 48 0.018
15gb|AC134603.4| Mus musculus BAC clone RP23-246L24 from chromosom... 48 0.018
16gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosom... 48 0.018
17gb|AC091092.3| Papio anubis clone RP41-191D8, complete sequence 48 0.018
18gb|AC145964.3| Pan troglodytes BAC clone RP43-12F2 from 7, compl... 48 0.018
19gb|AC006974.2| Homo sapiens PAC clone RP5-958B11 from 7, complet... 48 0.018
20emb|X12918.1|HSATPI16 Human Na+,K+ ATPase gene part of intron XV... 48 0.018
21emb|AL929401.8| Human DNA sequence from clone RP11-366E13 on chr... 48 0.018
22emb|AL449403.11| Human DNA sequence from clone RP11-569G13 on ch... 48 0.018
23emb|AL445463.8| Human DNA sequence from clone RP11-264H19 on chr... 48 0.018
24emb|AL158827.27| Human DNA sequence from clone RP11-330M2 on chr... 48 0.018
25emb|AL133551.13| Human DNA sequence from clone RP11-57G10 on chr... 48 0.018
26emb|AL009172.1|HS212G6 Human DNA sequence from clone RP1-212G6 o... 48 0.018
27emb|AL645990.14| Mouse DNA sequence from clone RP23-403C12 on ch... 48 0.018
28gb|AC123900.2| Homo sapiens chromosome 3 clone RP11-640D6, compl... 48 0.018
29emb|AJ229043.1| Homo sapiens 959 kb contig between AML1 and CBR1... 48 0.018
30gb|AC117530.2| Homo sapiens chromosome 5 clone RP11-294P1, compl... 48 0.018
31gb|AC018695.6| Homo sapiens BAC clone RP11-568J23 from 16, compl... 48 0.018
32gb|AC158760.4| Mus musculus chromosome 5, clone RP23-319E24, com... 48 0.018
33gb|AC010411.7| Homo sapiens chromosome 5 clone CTD-2165P17, comp... 48 0.018
34gb|AC008856.6|AC008856 Homo sapiens chromosome 5 clone CTD-2178N... 48 0.018
35gb|AC026385.19|AC026385 Mus musculus 17 BAC RP23-413K14 complete... 48 0.018
36gb|AC148713.1| Macaca mulatta Major Histocompatibility Complex B... 48 0.018
37gb|AC148678.1| Macaca mulatta Major Histocompatibility Complex B... 48 0.018
38gb|AC010616.5|AC010616 Homo sapiens chromosome 19 clone CTD-2575... 48 0.018
39gb|AF015262.2|AF015262 Homo sapiens chromosome 21 clone Pac 255P... 48 0.018
40gb|AC108134.3| Homo sapiens chromosome 16 clone RP11-473M20, com... 48 0.018
41gb|AC079818.56| Mus musculus strain C57BL/6J chromosome 10 clone... 48 0.018
42gb|AC154463.2| Mus musculus BAC clone RP24-144A20 from chromosom... 48 0.018
43gb|AC008738.7| Homo sapiens chromosome 19 clone CTD-2540B15, com... 48 0.018
44gb|AC105287.5| Homo sapiens BAC clone RP11-313M11 from 4, comple... 48 0.018
45gb|AC008521.5|AC008521 Homo sapiens chromosome 19 clone CTC-461H... 48 0.018
46emb|AL163267.2|HS21C067 Homo sapiens chromosome 21 segment HS21C067 48 0.018
47gb|AC006120.1|AC006120 Homo sapiens chromosome 17, clone hRPK.34... 48 0.018
48gb|AC111107.18| Mus musculus chromosome 5, clone RP23-195P3, com... 48 0.018
49gb|AC079082.39| Mus musculus strain C57BL/6J chromosome 10 clone... 48 0.018
50emb|AL845418.17| Mouse DNA sequence from clone RP23-207F4 on chr... 48 0.018
51emb|CT025760.12| Mouse DNA sequence from clone RP23-351E9 on chr... 48 0.018
52gb|AC161288.2| Pan troglodytes BAC clone CH251-280I4 from chromo... 48 0.018
53gb|AC005187.1|AC005187 Homo sapiens chromosome 4 clone B153K6 ma... 48 0.018
54emb|AL954351.10| Mouse DNA sequence from clone RP23-109H4 on chr... 48 0.018
55gb|AC169811.2| Rhesus Macaque CHR7 BAC CH250-119C16 (Children's ... 48 0.018
56emb|AL773580.11| Mouse DNA sequence from clone RP23-26G3 on chro... 48 0.018
57emb|AL662823.12| Mouse DNA sequence from clone RP23-243E17 on ch... 48 0.018
58emb|AL645753.11| Mouse DNA sequence from clone CT7-315N12 on chr... 48 0.018
59emb|AL691425.6| Mouse DNA sequence from clone RP23-232E4 on chro... 48 0.018
60gb|AC183761.3| Pan troglodytes BAC clone CH251-710C5 from chromo... 46 0.073
61gb|AC129295.4| Mus musculus BAC clone RP24-560M23 from chromosom... 46 0.073
62gb|AC025540.7| Homo sapiens BAC clone RP11-295N22 from 7, comple... 46 0.073
63gb|AC006013.3| Homo sapiens PAC clone RP5-945F2 from 7, complete... 46 0.073
64gb|AC159647.2| Mus musculus BAC clone RP23-66A14 from chromosome... 46 0.073
65emb|AL360232.24| Human DNA sequence from clone RP11-374I18 on ch... 46 0.073
66emb|AL109659.20|HSJ1024N4 Human DNA sequence from clone RP5-1024... 46 0.073
67gb|AC158128.3| Mus musculus chromosome 15, clone RP24-310D6, com... 46 0.073
68gb|AC007688.15| Homo sapiens 12 BAC RPCI11-392P7 (Roswell Park C... 46 0.073
69emb|AL589737.11| Mouse DNA sequence from clone RP23-43L14 on chr... 46 0.073
70gb|AC154282.1| Mus musculus BAC clone RP24-273O7 from chromosome... 46 0.073
71gb|AC157823.2| Mus musculus BAC clone RP23-382L21 from chromosom... 46 0.073
72gb|AC157660.2| Mus musculus BAC clone RP23-263I16 from chromosom... 46 0.073
73dbj|BS000126.1| Pan troglodytes chromosome 22 clone:PTB-128A24, ... 46 0.073
74gb|AC112957.14| Mus musculus chromosome 15, clone RP23-418C6, co... 46 0.073
75gb|AC006070.1|AC006070 Homo sapiens chromosome 17, clone hRPK.20... 46 0.073
76gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, co... 46 0.073
77gb|AC134590.5| Mus musculus BAC clone RP23-368K22 from 9, comple... 46 0.073
78emb|AL669981.11| Mouse DNA sequence from clone RP23-335B9 on chr... 46 0.073
79emb|AL731783.10| Mouse DNA sequence from clone RP23-124E18 on ch... 46 0.073
80gb|AC093353.11| Mus musculus chromosome 10, clone RP23-19C22, co... 44 0.29
81gb|AC125156.3| Mus musculus BAC clone RP24-386H5 from chromosome... 44 0.29
82gb|AC133214.3| Mus musculus BAC clone RP23-72A15 from chromosome... 44 0.29
83gb|AC122809.4| Mus musculus BAC clone RP23-272E5 from chromosome... 44 0.29
84gb|AC124415.4| Mus musculus BAC clone RP24-298J2 from chromosome... 44 0.29
85gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complet... 44 0.29
86gb|AC126695.4| Mus musculus BAC clone RP23-313D2 from 18, comple... 44 0.29
87gb|AC102339.16| Mus musculus chromosome 18, clone RP24-573J7, co... 44 0.29
88gb|AF549168.1| Homo sapiens exonuclease 1 (EXO1) gene, complete cds 44 0.29
89ref|NG_002793.1| Homo sapiens pelota/integrin, alpha 1 region (P... 44 0.29
90gb|AC102675.9| Mus musculus, clone RP23-232O16, complete sequence 44 0.29
91emb|AL591022.6| Human DNA sequence from clone RP13-485J5 on chro... 44 0.29
92emb|AL360269.21| Human DNA sequence from clone RP11-192I3 on chr... 44 0.29
93emb|AL365366.20| Human DNA sequence from clone RP11-553N16 on ch... 44 0.29
94emb|AL356125.13| Human DNA sequence from clone RP11-85G2 on chro... 44 0.29
95emb|AL161738.15| Human DNA sequence from clone RP11-549G1 on chr... 44 0.29
96emb|AL096802.11|HSBG13C1 Human DNA sequence from clone GS1-13C1 ... 44 0.29
97emb|AL049736.10|HSDJ723E3 Human DNA sequence from clone RP4-723E... 44 0.29
98gb|AC157581.2| Mus musculus chromosome 18, clone RP24-249P15, co... 44 0.29
99emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 44 0.29
100gb|AC092897.6| Homo sapiens 3 BAC RP11-292P2 (Roswell Park Cance... 44 0.29
101gb|AC127702.2| Homo sapiens BAC clone RP11-1386H14 from UL, comp... 44 0.29
102gb|AC008427.9| Homo sapiens chromosome 5 clone CTC-307M15, compl... 44 0.29
103gb|AC108206.3| Homo sapiens BAC clone RP11-203B7 from 4, complet... 44 0.29
104gb|AC027326.6| Homo sapiens chromosome 5 clone CTD-2072B24, comp... 44 0.29
105gb|AC026230.5|AC026230 Homo sapiens chromosome 5 clone CTD-2288O... 44 0.29
106dbj|AK042135.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 44 0.29
107dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.29
108gb|AC104081.2| Homo sapiens BAC clone RP11-559A1 from 2, complet... 44 0.29
109gb|AC010975.9| Homo sapiens BAC clone RP11-191H23 from 2, comple... 44 0.29
110gb|AC004916.2|AC004916 Homo sapiens PAC clone RP5-891L14 from 7p... 44 0.29
111gb|AC008910.5|AC008910 Homo sapiens chromosome 5 clone CTD-2267A... 44 0.29
112gb|AC084357.23| Homo sapiens 12q BAC RP11-415I12 (Roswell Park C... 44 0.29
113dbj|BS000195.1| Pan troglodytes chromosome 22 clone:PTB-014E11, ... 44 0.29
114dbj|AP003940.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.29
115gb|AC153621.5| Mus musculus 6 BAC RP23-272K20 (Roswell Park Canc... 44 0.29
116dbj|AP005714.3| Homo sapiens genomic DNA, chromosome 8q24, clone... 44 0.29
117gb|U39155.1|HSPDEA9 Human phosphodiesterase (PDEA) gene, intron ... 44 0.29
118gb|AC002546.1|AC002546 Homo sapiens chromosome 17, clone 193h18,... 44 0.29
119emb|AL669950.11| Mouse DNA sequence from clone RP23-14C19 on chr... 44 0.29
120gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, com... 42 1.1
121gb|AC102297.12| Mus musculus chromosome 1, clone RP24-392K18, co... 42 1.1
122gb|AC107645.28| Mus musculus chromosome 15, clone RP23-78J21, co... 42 1.1
123gb|AC166111.4| Mus musculus BAC clone RP23-68O7 from chromosome ... 42 1.1
124gb|AC117203.4| Mus musculus BAC clone RP23-251N4 from chromosome... 42 1.1
125gb|AC114667.12| Mus musculus chromosome 1, clone RP24-175L10, co... 42 1.1
126gb|AC147455.3| Atelerix albiventris clone LB4-341B4, complete se... 42 1.1
127gb|AC167971.3| Mus musculus BAC clone RP24-439I22 from chromosom... 42 1.1
128gb|AC124637.10| Mus musculus chromosome 15, clone RP23-458B6, co... 42 1.1
129gb|AC119856.13| Mus musculus chromosome 5, clone RP23-256B18, co... 42 1.1
130gb|AY703980.1| Ptilonorhynchus violaceus microsatellite SBBAAGG1... 42 1.1
131gb|AC113050.9| Mus musculus chromosome 1, clone RP23-250O14, com... 42 1.1
132gb|AC162902.4| Mus musculus BAC clone RP23-448D23 from chromosom... 42 1.1
133gb|AC120004.14| Mus musculus chromosome 5, clone RP24-150N15, co... 42 1.1
134gb|AC132833.10| Mus musculus chromosome 15, clone RP24-498G7, co... 42 1.1
135gb|AC124103.5| Mus musculus chromosome 15, clone RP24-271M13, co... 42 1.1
136gb|AC132274.3| Mus musculus BAC clone RP24-341I21 from chromosom... 42 1.1
137gb|AC114342.12| Mus musculus chromosome 5, clone RP24-143H14, co... 42 1.1
138gb|AC147676.10| Canis Familiaris, clone XX-25H12, complete sequence 42 1.1
139gb|AC118606.13| Mus musculus chromosome 5, clone RP24-69F9, comp... 42 1.1
140gb|AC159980.10| Mus musculus chromosome 3, clone RP24-171D20, co... 42 1.1
141gb|AC148008.2| Mus musculus BAC clone RP23-253C14 from chromosom... 42 1.1
142gb|AC132332.2| Mus musculus BAC clone RP24-222H7 from chromosome... 42 1.1
143gb|AC090046.10| Mus musculus chromosome 6, clone RP23-82P24, com... 42 1.1
144gb|AC141886.3| Mus musculus BAC clone RP24-87G24 from chromosome... 42 1.1
145gb|AC135240.2| Mus musculus BAC clone RP24-63O24 from chromosome... 42 1.1
146gb|AC146594.3| Mus musculus BAC clone RP24-155O13 from chromosom... 42 1.1
147gb|AC144794.2| Mus musculus BAC clone RP24-463B6 from chromosome... 42 1.1
148gb|AC158925.4| Mus musculus chromosome 1, clone RP23-22I7, compl... 42 1.1
149gb|AC158968.3| Mus musculus chromosome 1, clone RP23-411D16, com... 42 1.1
150gb|AC116503.17| Mus musculus chromosome 9, clone RP24-302M3, com... 42 1.1
151gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, co... 42 1.1
152gb|AC104868.8| Mus musculus chromosome 1, clone RP24-532K6, comp... 42 1.1
153gb|AC163033.4| Mus musculus BAC clone RP23-432F6 from chromosome... 42 1.1
154gb|AC153007.4| Mus musculus BAC clone RP24-266E2 from chromosome... 42 1.1
155gb|AC165239.3| Mus musculus chromosome 19, clone RP24-73C2, comp... 42 1.1
156gb|AC163025.3| Mus musculus chromosome 1, clone RP23-80N7, compl... 42 1.1
157gb|AC137108.12| Mus musculus chromosome 9, clone RP23-277J20, co... 42 1.1
158gb|AC005102.1| Homo sapiens BAC clone CTA-356E1 from 7, complete... 42 1.1
159gb|AC132624.3| Mus musculus BAC clone RP23-77B21 from chromosome... 42 1.1
160gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosom... 42 1.1
161gb|AC138457.3| Mus musculus BAC clone RP23-358E1 from chromosome... 42 1.1
162gb|AC133653.4| Mus musculus BAC clone RP24-320J12 from chromosom... 42 1.1
163gb|AC136915.14| Mus musculus chromosome 16, clone RP23-65O24, co... 42 1.1
164emb|CT009594.4| Mouse DNA sequence from clone RP23-146J6 on chro... 42 1.1
165gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosom... 42 1.1
166gb|AC135963.3| Mus musculus BAC clone RP23-346N11 from chromosom... 42 1.1
167gb|AC129598.4| Mus musculus BAC clone RP23-283O5 from chromosome... 42 1.1
168gb|AC132395.3| Mus musculus BAC clone RP23-391F17 from chromosom... 42 1.1
169gb|AC004787.1|HUAC004787 Homo sapiens Chromosome 16 BAC clone CI... 42 1.1
170gb|AC122466.2| Mus musculus BAC clone RP24-304N8 from chromosome... 42 1.1
171gb|AC124485.3| Mus musculus BAC clone RP23-450J12 from chromosom... 42 1.1
172gb|AC116999.2| Mus musculus BAC clone RP23-28L10 from 19, comple... 42 1.1
173gb|AC117243.3| Mus musculus BAC clone RP24-198D9 from 9, complet... 42 1.1
174gb|AC117255.3| Mus musculus BAC clone RP24-481E4 from 3, complet... 42 1.1
175gb|AC122823.2| Mus musculus BAC clone RP23-205I22 from 18, compl... 42 1.1
176gb|AC003076.2| Homo sapiens PAC clone RP5-1008B19 from 7, comple... 42 1.1
177gb|AC005377.2| Homo sapiens PAC clone RP5-1136G2 from 7, complet... 42 1.1
178gb|AC107756.9| Mus musculus chromosome 18, clone RP23-214K19, co... 42 1.1
179gb|AC116468.13| Mus musculus chromosome 16, clone RP23-166G21, c... 42 1.1
180gb|AC116713.8| Mus musculus chromosome 9, clone RP23-118M23, com... 42 1.1
181gb|AC109213.6| Mus musculus chromosome 16, clone RP23-345L20, co... 42 1.1
182gb|AC163283.3| Mus musculus BAC clone RP23-405A16 from chromosom... 42 1.1
183gb|AC142328.1| Pan troglodytes BAC clone RP43-24E4 from 7, compl... 42 1.1
184gb|AC107801.14| Mus musculus, clone RP23-29M6, complete sequence 42 1.1
185emb|AL732423.12| Human DNA sequence from clone RP11-345L8 on chr... 42 1.1
186emb|AL513007.5| Human DNA sequence from clone CTD-2530H13 on chr... 42 1.1
187emb|AL354736.10| Human DNA sequence from clone RP11-205B18 on ch... 42 1.1
188emb|AL161742.7| Human DNA sequence from clone RP4-597J3 on chrom... 42 1.1
189emb|AL139344.24| Human DNA sequence from clone RP1-223H12 on chr... 42 1.1
190gb|AC108679.6| Homo sapiens 3 BAC RP11-485G4 (Roswell Park Cance... 42 1.1
191emb|AL031118.22|HS153G14 Human DNA sequence from clone RP1-153G1... 42 1.1
192emb|AL034349.3|HS86D1 Human DNA sequence from clone RP1-86D1 on ... 42 1.1
193gb|AC158961.3| Mus musculus chromosome 1, clone RP23-316E20, com... 42 1.1
194gb|AC158781.4| Mus musculus chromosome 7, clone RP23-264H19, com... 42 1.1
195gb|AC096039.7| Rattus norvegicus 4 BAC CH230-29I22 (Children's H... 42 1.1
196gb|AC166109.1| Mus musculus BAC clone RP23-152E23 from chromosom... 42 1.1
197emb|AJ000511.1|MSXDERIV Megaselia scalaris DNA for unknown gene,... 42 1.1
198gb|AC026898.8| Homo sapiens chromosome 18, clone RP11-767C4, com... 42 1.1
199emb|AL928857.15| Mouse DNA sequence from clone RP24-499A8 on chr... 42 1.1
200gb|AC119566.11| Homo sapiens 12 BAC RP11-41H6 (Roswell Park Canc... 42 1.1
201emb|AL589744.18| Mouse DNA sequence from clone RP23-80C18 on chr... 42 1.1
202gb|AC113985.11| Mus musculus chromosome 6, clone RP24-103E20, co... 42 1.1
203emb|CR753179.6| Opossum DNA sequence from clone XX-529L22, compl... 42 1.1
204gb|AC022276.35| Homo sapiens 12 BAC RP11-161A14 (Roswell Park Ca... 42 1.1
205emb|CR631130.1| Human DNA sequence from clone XX-NCIH2171_2B12, ... 42 1.1
206gb|AC079766.7| Homo sapiens BAC clone RP11-188P17 from 4, comple... 42 1.1
207gb|AC022023.7| Homo sapiens chromosome 10 clone RP11-411P18, com... 42 1.1
208gb|AC108681.2| Homo sapiens 3q BAC RP11-30O15 (Roswell Park Canc... 42 1.1
209gb|AC103974.6| Homo sapiens chromosome 11, clone RP11-1081L13, c... 42 1.1
210gb|AC084361.19| Homo sapiens 12 BAC RP11-364C11 (Roswell Park Ca... 42 1.1
211gb|AC156278.8| Mus musculus 6 BAC RP24-249N9 (Roswell Park Cance... 42 1.1
212gb|AC026790.5| Homo sapiens chromosome 5 clone CTD-2228A4, compl... 42 1.1
213gb|AC096760.3| Homo sapiens BAC clone RP11-577B11 from 4, comple... 42 1.1
214gb|AC098677.2| Homo sapiens BAC clone RP11-416E16 from 4, comple... 42 1.1
215gb|AC091878.2| Homo sapiens chromosome 5 clone CTD-3065A13, comp... 42 1.1
216gb|AC182430.2| Pan troglodytes BAC clone CH251-398I16 from chrom... 42 1.1
217gb|AC009335.10| Homo sapiens chromosome 17, clone RP11-20O2, com... 42 1.1
218gb|AC027271.7| Homo sapiens BAC clone RP11-365H22 from 4, comple... 42 1.1
219gb|AC074139.4| Homo sapiens chromosome 19 clone LLNLF-144G11, co... 42 1.1
220gb|AC068254.6| Homo sapiens chromosome 18, clone RP11-543H23, co... 42 1.1
221gb|AC015726.8| Homo sapiens chromosome , clone RP11-78O7, comple... 42 1.1
222gb|AC128031.4| Rattus norvegicus BAC CH230-418E23 (Children's H... 42 1.1
223gb|AC155312.2| Mus musculus BAC clone RP23-411F11 from chromosom... 42 1.1
224dbj|AK171904.1| Mus musculus activated spleen cDNA, RIKEN full-l... 42 1.1
225gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold 42 1.1
226gb|AC156033.6| Mus musculus BAC clone RP23-377G8 from chromosome... 42 1.1
227gb|AC152161.4| Mus musculus chromosome 19, clone RP23-162O21, co... 42 1.1
228emb|AL391686.10| Human DNA sequence from clone CTB-BR164I22 on c... 42 1.1
229gb|AC096975.5| Rattus norvegicus 2 BAC CH230-203P11 (Children's ... 42 1.1
230emb|CR383656.1| Human chromosome 14 DNA sequence BAC R-536C10 of... 42 1.1
231gb|AC159279.2| Mus musculus BAC clone RP23-342D8 from chromosome... 42 1.1
232gb|AC160246.2| Mus musculus BAC clone RP24-465F1 from chromosome... 42 1.1
233gb|AC158544.1| Mus musculus 10 BAC RP24-212P21 (Roswell Park Can... 42 1.1
234gb|AC087104.2|AC087104 Danio rerio clone 20A7, complete sequence 42 1.1
235gb|AC127185.3| Rattus norvegicus BAC CH230-28E5 (Children's Hos... 42 1.1
236gb|AC159987.5| Mus musculus 10 BAC RP23-475N14 (Roswell Park Can... 42 1.1
237dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.1
238gb|AC025750.10| Homo sapiens BAC clone RP11-804P20 from 2, compl... 42 1.1
239gb|AC154214.1| Mus musculus BAC clone RP24-129M18 from chromosom... 42 1.1
240gb|AC154576.2| Mus musculus BAC clone RP23-372B6 from chromosome... 42 1.1
241gb|AC149590.5| Mus musculus BAC clone RP23-348L9 from chromosome... 42 1.1
242gb|AC153575.5| Mus musculus 6 BAC RP23-157O3 (Roswell Park Cance... 42 1.1
243gb|AC092141.4| Homo sapiens chromosome 16 clone RP11-478K1, comp... 42 1.1
244gb|AC017088.8| Homo sapiens BAC clone RP11-496P1 from 2, complet... 42 1.1
245gb|AC009058.10| Homo sapiens chromosome 16 clone RP11-292B23, co... 42 1.1
246gb|AC073539.3|AC073539 Homo sapiens chromosome 19 clone RP11-157... 42 1.1
247gb|AC016543.6|AC016543 Homo sapiens chromosome 14q24.3 clone RP1... 42 1.1
248gb|AC093769.3| Homo sapiens BAC clone RP11-114I18 from 2, comple... 42 1.1
249gb|AC068538.8| Homo sapiens BAC clone RP11-141G4 from 2, complet... 42 1.1
250gb|AC129664.7| Homo sapiens BAC clone RP11-237A9 from 4, complet... 42 1.1
251gb|AC084123.9| Homo sapiens chromosome 8, clone CTD-2267H22, com... 42 1.1
252gb|AC132220.10| Homo sapiens chromosome 15, clone RP11-1142D4, c... 42 1.1
253gb|AC079248.5| Homo sapiens BAC clone RP11-24J11 from 2, complet... 42 1.1
254gb|AC099661.11| Homo sapiens 3 BAC RP11-110C15 (Roswell Park Can... 42 1.1
255gb|AC134661.4| Homo sapiens chromosome 15, clone CTD-3098H5, com... 42 1.1
256gb|AC022308.17|AC022308 Homo sapiens chromosome 15 clone RP11-34... 42 1.1
257gb|AC122769.11| Mus musculus chromosome 15, clone RP24-153A12, c... 42 1.1
258emb|AL844528.13| Mouse DNA sequence from clone RP23-139H14 on ch... 42 1.1
259gb|AC008996.5|AC008996 Homo sapiens chromosome 19 clone LLNLR-24... 42 1.1
260dbj|AP003299.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.1
261gb|AC108391.14| Mus musculus chromosome 1, clone RP23-16N14, com... 42 1.1
262dbj|BS000198.1| Pan troglodytes chromosome 22 clone:RP43-091A22,... 42 1.1
263emb|BX511169.2|RN224C24 Rattus norvegicus chromosome 1 BAC RP32-... 42 1.1
264gb|AC007182.3|AC007182 Homo sapiens chromosome 14 clone BAC 507E... 42 1.1
265gb|AC115020.11| Mus musculus chromosome 1, clone RP24-231D14, co... 42 1.1
266gb|AC005994.2|AC005994 Homo sapiens PAC clone RP6-116J24 from 14... 42 1.1
267emb|CT573324.3| CH251-10E6, complete sequence 42 1.1
268gb|AC008160.11|AC008160 Mus musculus, clone 187_J_17, complete s... 42 1.1
269gb|AC104894.14| Mus musculus chromosome 1, clone RP23-290I22, co... 42 1.1
270gb|AC155075.10| Mus musculus chromosome 5, clone RP24-82B9, comp... 42 1.1
271gb|AC156271.5| Mus musculus 10 BAC RP24-317L8 (Roswell Park Canc... 42 1.1
272emb|CT030723.18| Mouse DNA sequence from clone RP23-33L24 on chr... 42 1.1
273emb|AL049778.3|CNS00004 Human chromosome 14 DNA sequence BAC R-6... 42 1.1
274gb|AC113936.16| Mus musculus chromosome 10, clone RP23-9F21, com... 42 1.1
275gb|AC108415.10| Mus musculus chromosome 15, clone RP23-341K14, c... 42 1.1
276gb|AC105159.15| Mus musculus chromosome 18, clone RP24-503L15, c... 42 1.1
277dbj|AP001591.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 1.1
278dbj|AP000879.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 1.1
279emb|CR956638.22| Pig DNA sequence from clone CH242-204B8 on chro... 42 1.1
280gb|AC005803.1|AC005803 Homo sapiens chromosome 17, clone hRPK.21... 42 1.1
281emb|CT030149.9| Mouse DNA sequence from clone RP24-394D13 on chr... 42 1.1
282emb|AL845521.9| Mouse DNA sequence from clone RP23-359C5 on chro... 42 1.1
283gb|AC154415.3| Mus musculus BAC clone RP24-232A21 from chromosom... 42 1.1
284gb|AC005244.1|AC005244 Homo sapiens chromosome 17, clone hRPK.47... 42 1.1
285emb|AL512310.4|CNS07EF1 Human chromosome 14 DNA sequence BAC R-5... 42 1.1
286gb|AC005266.1|AC005266 Homo sapiens chromosome 19, cosmid F23465... 42 1.1
287emb|AL355543.13| Human DNA sequence from clone RP11-86E10 on chr... 42 1.1
288gb|AC127263.4| Mus musculus BAC clone RP24-328P2 from 6, complet... 42 1.1
289gb|AC134843.4| Mus musculus BAC clone RP24-388C21 from 3, comple... 42 1.1
290gb|AC140791.4| Gallus gallus BAC clone TAM33-20G4 from chromosom... 42 1.1
291gb|AC132482.4| Mus musculus BAC clone RP23-27C11 from 12, comple... 42 1.1
292gb|AC130532.3| Mus musculus BAC clone RP23-189G24 from 7, comple... 42 1.1
293gb|AC140220.4| Mus musculus BAC clone RP23-279P6 from 5, complet... 42 1.1
294gb|AC122223.4| Mus musculus BAC clone RP23-130K20 from 1, comple... 42 1.1
295gb|AC147096.3| Mus musculus BAC clone RP23-448H3 from 14, comple... 42 1.1
296emb|AL840627.7| Zebrafish DNA sequence from clone CH211-278B16 i... 42 1.1
297gb|AC151478.1| Mus musculus BAC clone RP23-83K12 from 19, comple... 42 1.1
298gb|AC153819.5| Mus musculus 6 BAC RP23-445H14 (Roswell Park Canc... 42 1.1
299emb|AL356802.5|CNS05TDK Human chromosome 14 DNA sequence BAC C-2... 42 1.1
300gb|AC166825.3| Mus musculus BAC clone RP23-368D12 from chromosom... 42 1.1
301emb|AL929600.3|CNS08CCF Human chromosome 14 DNA sequence BAC R-2... 42 1.1
302emb|AL928739.5| Mouse DNA sequence from clone RP23-409L24 on chr... 42 1.1
303emb|AL929015.3| Mouse DNA sequence from clone RP23-412F11 on chr... 42 1.1
304emb|AL671854.14| Mouse DNA sequence from clone RP23-89M15 on chr... 42 1.1
305emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chr... 42 1.1
306emb|AL671269.11| Mouse DNA sequence from clone RP23-143P22 on ch... 42 1.1
307emb|AL845313.9| Mouse DNA sequence from clone RP23-202C2 on chro... 42 1.1
308emb|AL805969.13| Mouse DNA sequence from clone RP23-40L1 on chro... 42 1.1
309emb|AL645586.9| Mouse DNA sequence from clone RP23-302O5 on chro... 42 1.1
310emb|AL592422.11| Mouse DNA sequence from clone RP23-218O16 on ch... 42 1.1
311gb|AC166098.3| Mus musculus BAC clone RP24-316F13 from chromosom... 42 1.1
312dbj|AP000534.1| Homo sapiens genomic DNA, chromosome 22q11.2, Ca... 42 1.1
313emb|AL845505.3| Mouse DNA sequence from clone RP23-115D12 on chr... 42 1.1
314emb|AL845417.3| Mouse DNA sequence from clone RP23-20I9 on chrom... 42 1.1
315emb|AL844534.4| Mouse DNA sequence from clone RP23-59M10 on chro... 42 1.1
316emb|AL683891.11| Mouse DNA sequence from clone RP23-435E7 on chr... 42 1.1
317gb|AC115067.7| Mus musculus chromosome 5, clone RP24-404B4, comp... 40 4.5
318gb|AC154052.1| Drosophila melanogaster clone BACR01B21, complete... 40 4.5
319gb|AC153740.3| Colobus guereza clone CH272-157M1, complete sequence 40 4.5
320gb|AC139037.10| Mus musculus chromosome 5, clone RP23-310J14, co... 40 4.5
321gb|AC119220.11| Mus musculus chromosome 1, clone RP24-201K16, co... 40 4.5
322gb|AC152958.1| Mus musculus 6 BAC RP23-301K21 (Roswell Park Canc... 40 4.5
323gb|AC124099.5| Mus musculus chromosome 3, clone RP24-125L17, com... 40 4.5
324gb|AC113446.10| Mus musculus chromosome 5, clone RP23-258C6, com... 40 4.5
325gb|AC157087.2| Mus musculus BAC clone RP23-287O24 from chromosom... 40 4.5
326gb|AC115972.13| Mus musculus chromosome 5, clone RP24-79A6, comp... 40 4.5
327gb|AC154815.2| Mus musculus BAC clone RP24-534C22 from chromosom... 40 4.5
328gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, co... 40 4.5
329gb|AC130671.7| Mus musculus chromosome 15, clone RP24-90K19, com... 40 4.5
330gb|AC121812.3| Mus musculus chromosome 7 clone RP23-454P17, comp... 40 4.5
331gb|AC166836.3| Mus musculus BAC clone RP23-17O23 from chromosome... 40 4.5
332gb|AC168116.3| Mus musculus BAC clone RP24-108N24 from chromosom... 40 4.5
333gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome... 40 4.5
334gb|AC164157.3| Mus musculus BAC clone RP24-297C1 from chromosome... 40 4.5
335gb|AC162799.4| Mus musculus BAC clone RP24-392E13 from chromosom... 40 4.5
336gb|AC166365.4| Mus musculus BAC clone RP24-428H14 from chromosom... 40 4.5
337gb|AC166830.3| Mus musculus BAC clone RP23-246O1 from chromosome... 40 4.5
338gb|AC157556.12| Mus musculus chromosome 1, clone RP24-267A19, co... 40 4.5
339ref|XM_477215.1| Oryza sativa (japonica cultivar-group), mRNA 40 4.5
340gb|AC158976.14| Mus musculus chromosome 15, clone RP24-71M3, com... 40 4.5
341gb|AY686596.1| Apis mellifera Dscam gene, complete cds, alternat... 40 4.5
342gb|AC115846.7| Mus musculus chromosome 1, clone RP24-245O4, comp... 40 4.5
343gb|AC115829.7| Mus musculus chromosome 5, clone RP24-93O11, comp... 40 4.5
344gb|AC101991.9| Mus musculus chromosome 1, clone RP24-372E16, com... 40 4.5
345gb|AC124083.14| Mus musculus chromosome 5, clone RP24-400H4, com... 40 4.5
346gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, c... 40 4.5
347gb|AC104743.28| Mus musculus chromosome 6, clone RP23-27D8, comp... 40 4.5
348gb|AC158793.4| Mus musculus chromosome 1, clone RP23-269P13, com... 40 4.5
349gb|AC157560.3| Mus musculus chromosome 15, clone RP24-270I3, com... 40 4.5
350gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 4.5
351gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 4.5
352gb|AY703940.1| Heteromyias albispecularis microsatellite GHRAAGG... 40 4.5
353gb|AF109905.1|MMHC213L3 Mus musculus major histocompatibility lo... 40 4.5
354gb|AF041006.1| Homo sapiens NACP/alpha-synuclein gene, allele A2... 40 4.5
355gb|AF513237.1| Oligosoma grande microsatellite Oligr13 sequence 40 4.5
356gb|AC004776.1| Homo sapiens chromosome 5, BAC clone 173m17 (LBNL... 40 4.5
357gb|AC099045.21| Trypanosoma brucei chromosome 8 clone RPCI93-29O... 40 4.5
358gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence 40 4.5
359gb|AC157554.7| Mus musculus chromosome 15, clone RP24-324P21, co... 40 4.5
360gb|AC102661.7| Mus musculus chromosome 3, clone RP23-114K16, com... 40 4.5
361gb|AC108393.10| Mus musculus chromosome 3, clone RP23-388A19, co... 40 4.5
362gb|AC102499.10| Mus musculus chromosome 1, clone RP24-151M13, co... 40 4.5
363gb|AC130561.11| Rattus norvegicus BAC CH230-161F3 (Children's H... 40 4.5
364gb|AC154431.2| Mus musculus BAC clone RP23-174B22 from chromosom... 40 4.5
365gb|AC147705.3| Papio anubis clone RP41-472D10, complete sequence 40 4.5
366gb|AC165358.3| Mus musculus BAC clone RP23-122F14 from chromosom... 40 4.5
367gb|AC165245.2| Mus musculus BAC clone RP24-376N22 from chromosom... 40 4.5
368gb|AC115937.14| Mus musculus chromosome 5, clone RP24-547J21, co... 40 4.5
369gb|AC130481.11| Mus musculus chromosome 1, clone RP24-125E22, co... 40 4.5
370gb|AC116712.11| Mus musculus chromosome 1, clone RP23-105A17, co... 40 4.5
371gb|AC113092.25| Mus musculus chromosome 6, clone RP23-309N11, co... 40 4.5
372gb|AC113989.6| Mus musculus chromosome 3, clone RP24-130I14, com... 40 4.5
373gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Can... 40 4.5
374gb|AC134411.7| Mus musculus chromosome 5, clone RP24-369N6, comp... 40 4.5
375gb|AC105164.12| Mus musculus chromosome 6, clone RP24-296I7, com... 40 4.5
376gb|AC003067.59| Mus musculus Chromosome 16 BAC Clone tbx3 Synten... 40 4.5
377gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's ... 40 4.5
378gb|AC116075.5| Rattus norvegicus 6 BAC CH230-139H23 (Children's ... 40 4.5
379gb|AC112330.5| Rattus norvegicus 15 BAC CH230-185E8 (Children's ... 40 4.5
380gb|AC095999.8| Rattus norvegicus 4 BAC CH230-12B2 (Children's Ho... 40 4.5
381ref|XM_413874.1| PREDICTED: Gallus gallus similar to A-kinase an... 40 4.5
382gb|AC109140.6| Mus musculus chromosome 5, clone RP23-153N23, com... 40 4.5
383gb|AC114678.20| Mus musculus chromosome 10, clone RP24-213L12, c... 40 4.5
384gb|AC139060.5| Mus musculus chromosome 16, clone RP23-58G17, com... 40 4.5
385gb|AC134468.4| Mus musculus BAC clone RP23-97J21 from chromosome... 40 4.5
386gb|AC115301.7| Mus musculus BAC clone RP24-83E2 from chromosome ... 40 4.5
387gb|AC142145.3| Mus musculus BAC clone RP24-69D13 from chromosome... 40 4.5
388gb|AC107732.11| Mus musculus chromosome 7, clone RP23-424E6, com... 40 4.5
389gb|AC163741.3| Pan troglodytes BAC clone CH251-406E22 from chrom... 40 4.5
390gb|AC185978.2| Pan troglodytes BAC clone CH251-508B17 from chrom... 40 4.5
391gb|AC165242.6| Mus musculus chromosome 3, clone RP24-98F15, comp... 40 4.5
392gb|AC166251.6| Mus musculus BAC RP23-298H20 (Roswell Park Cance... 40 4.5
393gb|AC148021.2| Mus musculus BAC clone RP23-9A7 from chromosome 1... 40 4.5
394gb|AC121317.7| Mus musculus chromosome 6, clone RP24-343J20, com... 40 4.5
395gb|AC146000.4| Pan troglodytes BAC clone RP43-147L18 from 7, com... 40 4.5
396gb|AC146138.2| Pan troglodytes BAC clone RP43-3D14 from 7, compl... 40 4.5
397ref|NG_000016.1| Homo sapiens protocadherin alpha cluster (PCDHA... 40 4.5
398gb|AC144768.2| Mus musculus BAC clone RP23-24K24 from chromosome... 40 4.5
399gb|AC145589.3| Mus musculus BAC clone RP24-174M10 from chromosom... 40 4.5
400gb|AC147621.3| Mus musculus BAC clone RP24-315M14 from chromosom... 40 4.5
401gb|AC125151.4| Mus musculus BAC clone RP24-355K8 from chromosome... 40 4.5
402gb|AC134908.5| Mus musculus BAC clone RP23-377L13 from chromosom... 40 4.5
403gb|AC090972.5| Canis familiaris clone RP81-391L22, complete sequ... 40 4.5
404gb|AC162793.8| Mus musculus chromosome 3, clone RP24-347H11, com... 40 4.5
405gb|AC118546.80| Mus musculus strain C57BL/6J clone rp23-346h22 m... 40 4.5
406gb|AC164536.5| Mus musculus chromosome 18, clone RP23-425H1, com... 40 4.5
407gb|AC114539.8| Mus musculus chromosome 19, clone RP23-62I23, com... 40 4.5
408gb|AC161000.5| Mus musculus BAC clone RP23-51A9 from chromosome ... 40 4.5
409gb|AC099594.6| Mus musculus chromosome 15, clone RP23-458G7, com... 40 4.5
410gb|AC157597.4| Mus musculus BAC clone RP23-231O9 from chromosome... 40 4.5
411gb|AC124978.19| Mus musculus chromosome 5, clone RP24-107D19, co... 40 4.5
412gb|AC140051.10| Mus musculus chromosome 12, clone RP23-296J15, c... 40 4.5
413gb|AC121301.8| Mus musculus chromosome 7, clone RP23-432H1, comp... 40 4.5
414gb|AC116515.11| Mus musculus chromosome 7, clone RP24-331B9, com... 40 4.5
415gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, compl... 40 4.5
416gb|AC167719.2| Mus musculus BAC clone RP24-285I8 from chromosome... 40 4.5
417gb|AC142167.4| Mus musculus BAC clone RP24-117F4 from chromosome... 40 4.5
418gb|AC155732.21| Mus musculus 6 BAC RP24-235I13 (Roswell Park Can... 40 4.5
419gb|AC102676.16| Mus musculus chromosome 14, clone RP23-266L19, c... 40 4.5
420gb|AC113495.15| Mus musculus chromosome 9, clone RP23-361O11, co... 40 4.5
421gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome... 40 4.5
422gb|AC164405.4| Mus musculus chromosome 3, clone RP24-286C1, comp... 40 4.5
423gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 4.5
424gb|AY663414.1| Homo sapiens voucher Coriell Cell Repository DNA ... 40 4.5
425gb|AY663413.1| Homo sapiens voucher Coriell Cell Repository DNA ... 40 4.5
426gb|AY663411.1| Homo sapiens voucher Coriell Cell Repository DNA ... 40 4.5
427gb|AY663408.1| Homo sapiens voucher Coriell Cell Repository DNA ... 40 4.5
428gb|AY663406.1| Homo sapiens voucher Coriell Cell Repository DNA ... 40 4.5
429gb|AY663405.1| Homo sapiens voucher Coriell Cell Repository DNA ... 40 4.5
430gb|AY663401.1| Pan troglodytes voucher Coriell Cell Repository D... 40 4.5
431gb|AY663400.1| Homo sapiens voucher Coriell Cell Repository DNA ... 40 4.5
432gb|AY663396.1| Homo sapiens voucher Coriell Cell Repository DNA ... 40 4.5
433gb|AY663395.1| Homo sapiens voucher Coriell Cell Repository DNA ... 40 4.5
434gb|AC161170.7| Mus musculus chromosome 1, clone RP23-307G23, com... 40 4.5
435gb|AC165154.2| Mus musculus BAC clone RP23-302C3 from chromosome... 40 4.5
436gb|AC158616.8| Mus musculus 10 BAC RP23-227E23 (Roswell Park Can... 40 4.5
437gb|AC162936.3| Mus musculus BAC clone RP23-108K5 from chromosome... 40 4.5
438gb|AC161758.3| Mus musculus BAC clone RP23-455F6 from chromosome... 40 4.5
439gb|AC102000.14| Mus musculus chromosome 15, clone RP24-467P24, c... 40 4.5
440gb|AC163898.5| Mus musculus chromosome 7, clone RP24-108A5, comp... 40 4.5
441gb|AC165293.2| Mus musculus BAC clone RP23-268A5 from chromosome... 40 4.5
442gb|AC158136.11| Mus musculus chromosome 7, clone RP23-58I15, com... 40 4.5
443gb|AC164156.2| Mus musculus BAC clone RP24-549I8 from chromosome... 40 4.5
444gb|AC153600.8| Mus musculus 6 BAC RP23-380C10 (Roswell Park Canc... 40 4.5
445gb|AC183385.3| Pan troglodytes BAC clone CH251-277F20 from chrom... 40 4.5
446gb|AC182749.2| Mus musculus BAC clone RP23-464D14 from chromosom... 40 4.5
447gb|AC133488.30| Mus musculus strain C57BL/6J clone rp23-432e14, ... 40 4.5
448gb|AC121992.3| Mus musculus BAC clone RP24-300I17 from chromosom... 40 4.5
449gb|AC092508.3| Mus musculus strain C57BL6/J chromosome 5 clone R... 40 4.5
450gb|AC006334.3| Homo sapiens BAC clone RP11-421B22 from 7, comple... 40 4.5
451gb|AC006976.2| Homo sapiens PAC clone RP5-1047E14 from 7, comple... 40 4.5
452gb|AC107798.10| Mus musculus chromosome 8, clone RP23-4D24, comp... 40 4.5
453gb|AC132429.2| Mus musculus BAC clone RP23-203O20 from chromosom... 40 4.5
454gb|AC135292.2| Mus musculus BAC clone RP23-153N21 from chromosom... 40 4.5
455gb|AC134870.4| Mus musculus BAC clone RP23-166E8 from chromosome... 40 4.5
456gb|AC140298.3| Mus musculus BAC clone RP24-319I6 from chromosome... 40 4.5
457gb|AC132944.3| Mus musculus BAC clone RP24-284N8 from chromosome... 40 4.5
458gb|AC132292.3| Mus musculus BAC clone RP24-319L4 from chromosome... 40 4.5
459gb|AC124368.5| Mus musculus BAC clone RP24-546J13 from chromosom... 40 4.5
460gb|AC124751.4| Mus musculus BAC clone RP23-274P18 from chromosom... 40 4.5
461gb|DQ483909.1| Gymnogyps californianus clone 75G microsatellite ... 40 4.5
462emb|CT025604.10| Mouse DNA sequence from clone RP23-332P8 on chr... 40 4.5
463emb|CR974572.21| Pig DNA sequence from clone CH242-200F24 on chr... 40 4.5
464gb|AC107454.12| Mus musculus chromosome 3, clone RP23-339P23, co... 40 4.5
465ref|XM_567810.1| Cryptococcus neoformans var. neoformans JEC21 D... 40 4.5
466gb|AC126031.2| Mus musculus BAC clone RP24-84F17 from chromosome... 40 4.5
467gb|AC122000.3| Mus musculus BAC clone RP24-328N20 from chromosom... 40 4.5
468gb|AC126021.3| Mus musculus BAC clone RP24-386D8 from chromosome... 40 4.5
469gb|AC141867.4| Mus musculus BAC clone RP24-424E17 from chromosom... 40 4.5
470gb|AC121895.3| Mus musculus BAC clone RP24-157P5 from chromosome... 40 4.5
471gb|AC124716.4| Mus musculus BAC clone RP24-144K17 from chromosom... 40 4.5
472gb|AC127363.3| Mus musculus BAC clone RP23-1D23 from chromosome ... 40 4.5
473gb|AC124560.4| Mus musculus BAC clone RP23-166O22 from chromosom... 40 4.5
474gb|AC123867.4| Mus musculus BAC clone RP23-127O13 from chromosom... 40 4.5
475gb|AC122214.4| Mus musculus BAC clone RP23-104J10 from chromosom... 40 4.5
476gb|AC002287.1|HUAC002287 Homo sapiens Chromosome 16 BAC clone CI... 40 4.5
477gb|AC140723.16| Mus musculus chromosome 16, clone RP23-346N4, co... 40 4.5
478gb|AC129305.4| Mus musculus BAC clone RP24-472F1 from chromosome... 40 4.5
479gb|AC124363.3| Mus musculus BAC clone RP24-531A9 from chromosome... 40 4.5
480gb|AC121939.3| Mus musculus BAC clone RP24-208M2 from chromosome... 40 4.5
481gb|AC122796.3| Mus musculus BAC clone RP24-347J6 from chromosome... 40 4.5
482gb|AC122519.4| Mus musculus BAC clone RP24-462C10 from chromosom... 40 4.5
483gb|AC015909.14| Homo sapiens chromosome 17, clone RP11-893F2, co... 40 4.5
484gb|AC125176.4| Mus musculus BAC clone RP24-574O24 from chromosom... 40 4.5
485gb|AC125069.4| Mus musculus BAC clone RP23-436E5 from chromosome... 40 4.5
486gb|AC121810.3| Mus musculus BAC clone RP23-453G13 from chromosom... 40 4.5
487gb|AC112271.4| Mus musculus BAC clone RP24-121H20 from chromosom... 40 4.5
488gb|AC126611.3| Mus musculus BAC clone RP23-316N22 from chromosom... 40 4.5
489gb|AC121882.3| Mus musculus BAC clone RP24-135M19 from chromosom... 40 4.5
490emb|CR354429.17| Zebrafish DNA sequence from clone CH211-150F22 ... 40 4.5
491gb|AC122358.2| Mus musculus BAC clone RP23-406B6 from chromosome... 40 4.5
492gb|AC126263.4| Mus musculus BAC clone RP23-359P12 from chromosom... 40 4.5
493gb|AC122890.4| Mus musculus BAC clone RP23-63O14 from 8, complet... 40 4.5
494gb|AC122891.4| Mus musculus BAC clone RP23-66J6 from 12, complet... 40 4.5
495gb|AC127332.3| Mus musculus BAC clone RP23-136I1 from 5, complet... 40 4.5
496gb|AC112147.5| Mus musculus BAC clone RP23-175E16 from 9, comple... 40 4.5
497gb|AC124578.4| Mus musculus BAC clone RP23-166C2 from 18, comple... 40 4.5
498emb|CR848708.12| Wallaby DNA sequence from clone MEKBa-201B9, co... 40 4.5
499gb|AC125195.4| Mus musculus BAC clone RP23-246M2 from 2, complet... 40 4.5
500gb|AC125183.4| Mus musculus BAC clone RP23-297M4 from 5, complet... 40 4.5

>gb|BT009444.1| Triticum aestivum clone wlmk8.pk0004.f6:fis, full insert mRNA
            sequence
          Length = 1858

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 149/183 (81%), Gaps = 20/183 (10%)
 Strand = Plus / Minus

                                                                        
Query: 90   aaaaacctcctcggacagcacagggggccgaggagtttgattataag----atctacaga 145
            |||||||||||| | ||||||||||| ||||||| ||||||||||||    |||||||||
Sbjct: 1785 aaaaacctcctcaggcagcacaggggcccgagga-tttgattataagtaagatctacaga 1727

                                                                        
Query: 146  --------cgcaaacatgtatcgatcgaaaacttaacaagacacgaaggtttactaaatt 197
                    |||||||||||    |||| ||||||||||||||| |||| |||||||||||
Sbjct: 1726 cggggtggcgcaaacatgt----atcggaaacttaacaagacatgaagatttactaaatt 1671

                                                                        
Query: 198  tttatgcccgggcgaggaactgttgttgatgcttctcctgcaaaacgcaaactataaaga 257
             ||||| ||| | ||| ||    ||| |||||||||||||||||| ||||||||||||||
Sbjct: 1670 cttatggccgagagagaaa---atgtggatgcttctcctgcaaaatgcaaactataaaga 1614

               
Query: 258  atg 260
            |||
Sbjct: 1613 atg 1611



to top

>gb|AC127951.4| Rattus norvegicus 18 BAC CH230-150D9 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 164101

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 291  cttccttccttccttcccctgccttcctg 319
            |||||||||||||||||||||||| ||||
Sbjct: 7911 cttccttccttccttcccctgcctccctg 7883



to top

>emb|AL031737.2|HS8B22 Human DNA sequence from clone RP1-8B22 on chromosome 1p35.1-36.21
             Contains a dynein, cytoplasmic light chain 1 (DNCL1)
             pseudogene, complete sequence
          Length = 133760

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||||||||||||||||| |||||||
Sbjct: 90774 tcttccttccttccttccccttccttcct 90802



to top

>emb|BX000479.11| Mouse DNA sequence from clone RP23-139I16 on chromosome X, complete
             sequence
          Length = 145084

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||||||||||||||||| |||||||
Sbjct: 84734 tcttccttccttccttccccttccttcct 84762



to top

>gb|AC139131.19| Mus musculus chromosome 7, clone RP23-301N20, complete sequence
          Length = 230772

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 117679 cttccttccttccttccccttccttcct 117706



to top

>gb|AC170188.2| Mus musculus BAC clone RP24-195M20 from chromosome 13, complete
             sequence
          Length = 165687

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||| |||||||||
Sbjct: 63103 cttccttccttccttcccttgccttcct 63130



to top

>gb|AC161574.8| Mus musculus chromosome 1, clone RP23-352D14, complete sequence
          Length = 187614

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 103107 cttccttccttccttcccctcccttcct 103080



to top

>gb|AC102938.20| Mus musculus chromosome 1, clone RP24-187H3, complete sequence
          Length = 197114

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 291  cttccttccttccttcccctgccttcct 318
            |||||||||||||||||||| |||||||
Sbjct: 1729 cttccttccttccttcccctcccttcct 1756



to top

>gb|AC004643.1| Homo sapiens chromosome 16, cosmid clone 363E3 (LANL), complete
            sequence
          Length = 43411

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 291  cttccttccttccttcccctgccttcct 318
            |||||||||||||||||||| |||||||
Sbjct: 6068 cttccttccttccttccccttccttcct 6041



to top

>gb|AC183807.3| Pan troglodytes BAC clone CH251-65H22 from chromosome 9, complete
             sequence
          Length = 171193

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 20827 cttccttccttccttccccttccttcct 20854



to top

>gb|AC149221.2| Mus musculus BAC clone RP23-402P22 from chromosome 7, complete sequence
          Length = 202580

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 27459 cttccttccttccttccccttccttcct 27432



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             |||||||| |||||||||||| |||||||
Sbjct: 27400 tcttcctttcttccttccccttccttcct 27372



to top

>gb|AC161612.5| Pan troglodytes BAC clone CH251-703C23 from chromosome 7, complete
             sequence
          Length = 187270

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 19077 cttccttccttccttccccttccttcct 19050



to top

>gb|AC099704.7| Mus musculus chromosome 15, clone RP23-256A2, complete sequence
          Length = 204704

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 127305 cttccttccttccttccccttccttcct 127332



 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 286   ctcatcttccttccttccttcc 307
             ||||||||||||||||||||||
Sbjct: 11854 ctcatcttccttccttccttcc 11833



to top

>gb|AC126940.4| Mus musculus BAC clone RP23-77E4 from chromosome 19, complete sequence
          Length = 256476

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 102255 cttccttccttccttcccctcccttcct 102228



to top

>gb|AC134603.4| Mus musculus BAC clone RP23-246L24 from chromosome 7, complete sequence
          Length = 229312

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 191174 cttccttccttccttccccttccttcct 191147



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 290    tcttccttccttccttcccctgccttcct 318
              |||||||| |||||||||||| |||||||
Sbjct: 191115 tcttcctttcttccttccccttccttcct 191087



to top

>gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosome 15, complete
             sequence
          Length = 168423

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 12082 cttccttccttccttccccttccttcct 12055



 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 286    ctcatcttccttccttccttcc 307
              ||||||||||||||||||||||
Sbjct: 127528 ctcatcttccttccttccttcc 127549



to top

>gb|AC091092.3| Papio anubis clone RP41-191D8, complete sequence
          Length = 167732

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 22349 cttccttccttccttccccttccttcct 22322



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 22327 cttccttccttccttccccttccttcct 22300



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 22293 cttccttccttccttccccttccttcct 22266



to top

>gb|AC145964.3| Pan troglodytes BAC clone RP43-12F2 from 7, complete sequence
          Length = 184675

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 183630 cttccttccttccttccccttccttcct 183657



to top

>gb|AC006974.2| Homo sapiens PAC clone RP5-958B11 from 7, complete sequence
          Length = 90241

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 35755 cttccttccttccttccccttccttcct 35782



to top

>emb|X12918.1|HSATPI16 Human Na+,K+ ATPase gene part of intron XVI (alpha III isoform)
          Length = 2926

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 291  cttccttccttccttcccctgccttcct 318
            |||||||||||||||||||| |||||||
Sbjct: 1715 cttccttccttccttccccttccttcct 1742



to top

>emb|AL929401.8| Human DNA sequence from clone RP11-366E13 on chromosome X Contains the
              gene for a novel protein similar to 40S ribosomal protein
              S26 (RPS26) and two CpG islands, complete sequence
          Length = 194095

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 184917 cttccttccttccttccccttccttcct 184944



to top

>emb|AL449403.11| Human DNA sequence from clone RP11-569G13 on chromosome 9 Contains a
             eukaryotic translation initiation factor 4B (EIF4B)
             pseudogene and part of a novel gene, complete sequence
          Length = 173916

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 56063 cttccttccttccttccccttccttcct 56090



to top

>emb|AL445463.8| Human DNA sequence from clone RP11-264H19 on chromosome 10 Contains
             part of the BTRC gene for beta-transducin repeat
             containing, complete sequence
          Length = 143078

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 82962 cttccttccttccttccccttccttcct 82989



to top

>emb|AL158827.27| Human DNA sequence from clone RP11-330M2 on chromosome 9 Contains a
             pseudogene similar to part of a zinc finger protein, two
             novel pseudogenes, a novel gene similar to DKFZP434I1117,
             a novel pseudogene (FLJ23476), two novel gene, a novel
             gene similar to MGC12954 and four CpG islands, complete
             sequence
          Length = 186108

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 85434 cttccttccttccttccccttccttcct 85461



to top

>emb|AL133551.13| Human DNA sequence from clone RP11-57G10 on chromosome 10 Contains a
             ribosomal protein L21 (RPL21) pseudogene, the gene for
             J-domain containing protein 1 (JDP1), a ribosomal protein
             L12 (RPL12) pseudogene, a novel pseudogene, the SIRT1 gene
             for sirtuin (silent mating type information regulation 2
             homolog) 1 (S. cerevisiae), the 3' end of the gene for a
             novel protein (KIAA0032) and two CpG island, complete
             sequence
          Length = 175940

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 67648 cttccttccttccttccccttccttcct 67621



to top

>emb|AL009172.1|HS212G6 Human DNA sequence from clone RP1-212G6 on chromosome Xp11.3-11.4
            Contains the 5'end of the SYN1 gene for synapsin I, the
            PFC gene for properdin P factor (complement), the ELK1
            member of the ETS oncogene family, the UTX gene for
            ubiquitously-expressed transcript, an SMS (spermine
            synthase) pseudogene, a novel gene (LOC286403) and three
            CpG islands, complete sequence
          Length = 156601

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 291  cttccttccttccttcccctgccttcct 318
            |||||||||||||||||||| |||||||
Sbjct: 4448 cttccttccttccttccccttccttcct 4421



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 294  ccttccttccttcccctgccttcct 318
            ||||||||||||||||| |||||||
Sbjct: 4431 ccttccttccttccccttccttcct 4407



to top

>emb|AL645990.14| Mouse DNA sequence from clone RP23-403C12 on chromosome 11 Contains a
              novel gene and the 5' end of the Mmd gene for monocyte to
              macrophage differentiation-associated, complete sequence
          Length = 134303

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 105168 cttccttccttccttccccttccttcct 105141



to top

>gb|AC123900.2| Homo sapiens chromosome 3 clone RP11-640D6, complete sequence
          Length = 166485

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 122301 cttccttccttccttccccttccttcct 122328



to top

>emb|AJ229043.1| Homo sapiens 959 kb contig between AML1 and CBR1 on chromosome 21q22,
             segment 3/3
          Length = 288002

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 69377 cttccttccttccttcccctcccttcct 69350



to top

>gb|AC117530.2| Homo sapiens chromosome 5 clone RP11-294P1, complete sequence
          Length = 172442

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 70718 cttccttccttccttccccttccttcct 70691



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             ||||||||||||||||| || |||||||
Sbjct: 70700 cttccttccttccttcctcttccttcct 70673



to top

>gb|AC018695.6| Homo sapiens BAC clone RP11-568J23 from 16, complete sequence
          Length = 211001

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 154173 cttccttccttccttccccttccttcct 154200



to top

>gb|AC158760.4| Mus musculus chromosome 5, clone RP23-319E24, complete sequence
          Length = 191682

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 93131 cttccttccttccttccccttccttcct 93158



to top

>gb|AC010411.7| Homo sapiens chromosome 5 clone CTD-2165P17, complete sequence
          Length = 177807

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 33244 cttccttccttccttccccttccttcct 33271



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             ||||||||||||||||| || |||||||
Sbjct: 33262 cttccttccttccttcctcttccttcct 33289



to top

>gb|AC008856.6|AC008856 Homo sapiens chromosome 5 clone CTD-2178N20, complete sequence
          Length = 154229

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 50830 cttccttccttccttccccttccttcct 50857



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             ||||||||||||||||| || |||||||
Sbjct: 50848 cttccttccttccttcctcttccttcct 50875



to top

>gb|AC026385.19|AC026385 Mus musculus 17 BAC RP23-413K14 complete sequence
          Length = 222610

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 146800 cttccttccttccttcccctcccttcct 146827



to top

>gb|AC148713.1| Macaca mulatta Major Histocompatibility Complex BAC MMU457F04, complete
              sequence
          Length = 149331

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 114415 cttccttccttccttccccttccttcct 114442



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 294    ccttccttccttcccctgccttcct 318
              ||||||||||||||||| |||||||
Sbjct: 114432 ccttccttccttccccttccttcct 114456



to top

>gb|AC148678.1| Macaca mulatta Major Histocompatibility Complex BAC MMU125A15, complete
             sequence
          Length = 172875

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 73010 cttccttccttccttccccttccttcct 73037



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 294   ccttccttccttcccctgccttcct 318
             ||||||||||||||||| |||||||
Sbjct: 73027 ccttccttccttccccttccttcct 73051



to top

>gb|AC010616.5|AC010616 Homo sapiens chromosome 19 clone CTD-2575K13, complete sequence
          Length = 171849

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 134111 cttccttccttccttccccttccttcct 134084



to top

>gb|AF015262.2|AF015262 Homo sapiens chromosome 21 clone Pac 255P7 map 21q-AML, complete sequence
          Length = 250598

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 218626 cttccttccttccttcccctcccttcct 218653



to top

>gb|AC108134.3| Homo sapiens chromosome 16 clone RP11-473M20, complete sequence
          Length = 180354

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 46201 cttccttccttccttccccttccttcct 46228



to top

>gb|AC079818.56| Mus musculus strain C57BL/6J chromosome 10 clone rp23-362c8, complete
              sequence
          Length = 238658

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 101734 cttccttccttccttccccttccttcct 101761



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 101704 cttccttccttccttccccttccttcct 101731



to top

>gb|AC154463.2| Mus musculus BAC clone RP24-144A20 from chromosome 9, complete sequence
          Length = 147232

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 93321 cttccttccttccttccccttccttcct 93348



to top

>gb|AC008738.7| Homo sapiens chromosome 19 clone CTD-2540B15, complete sequence
          Length = 219821

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 15599 cttccttccttccttccccttccttcct 15626



to top

>gb|AC105287.5| Homo sapiens BAC clone RP11-313M11 from 4, complete sequence
          Length = 105001

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 42829 cttccttccttccttccccttccttcct 42856



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             ||||||||||||||| |||| |||||||
Sbjct: 42811 cttccttccttcctttcccttccttcct 42838



to top

>gb|AC008521.5|AC008521 Homo sapiens chromosome 19 clone CTC-461H2, complete sequence
          Length = 147514

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 129740 cttccttccttccttccccttccttcct 129767



to top

>emb|AL163267.2|HS21C067 Homo sapiens chromosome 21 segment HS21C067
          Length = 340000

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 120700 cttccttccttccttcccctcccttcct 120727



to top

>gb|AC006120.1|AC006120 Homo sapiens chromosome 17, clone hRPK.346_K_10, complete sequence
          Length = 168753

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 42086 cttccttccttccttccccttccttcct 42113



to top

>gb|AC111107.18| Mus musculus chromosome 5, clone RP23-195P3, complete sequence
          Length = 203785

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 31050 cttccttccttccttccccttccttcct 31023



to top

>gb|AC079082.39| Mus musculus strain C57BL/6J chromosome 10 clone rp23-161b11,
           complete sequence
          Length = 205621

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 291 cttccttccttccttcccctgccttcct 318
           |||||||||||||||||||| |||||||
Sbjct: 848 cttccttccttccttccccttccttcct 821



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 291 cttccttccttccttcccctgccttcct 318
           |||||||||||||||||||| |||||||
Sbjct: 818 cttccttccttccttccccttccttcct 791



to top

>emb|AL845418.17| Mouse DNA sequence from clone RP23-207F4 on chromosome 2, complete
              sequence
          Length = 165376

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 164965 cttccttccttccttccccttccttcct 164992



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 164907 cttccttccttccttccccttccttcct 164934



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 164865 cttccttccttccttccccttccttcct 164892



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 164835 cttccttccttccttccccttccttcct 164862



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 294    ccttccttccttcccctgccttcct 318
              ||||||||||||||||| |||||||
Sbjct: 164800 ccttccttccttccccttccttcct 164824



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 291    cttccttccttccttcccct 310
              ||||||||||||||||||||
Sbjct: 164755 cttccttccttccttcccct 164774



to top

>emb|CT025760.12| Mouse DNA sequence from clone RP23-351E9 on chromosome 17, complete
              sequence
          Length = 128479

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              |||||||||||||||||||| |||||||
Sbjct: 108383 cttccttccttccttcccctcccttcct 108410



to top

>gb|AC161288.2| Pan troglodytes BAC clone CH251-280I4 from chromosome 7, complete
            sequence
          Length = 165590

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 291  cttccttccttccttcccctgccttcct 318
            |||||||||||||||||||| |||||||
Sbjct: 6532 cttccttccttccttccccttccttcct 6505



to top

>gb|AC005187.1|AC005187 Homo sapiens chromosome 4 clone B153K6 map 4q25, complete sequence
          Length = 114621

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 50939 cttccttccttccttccccttccttcct 50912



to top

>emb|AL954351.10| Mouse DNA sequence from clone RP23-109H4 on chromosome 2, complete
            sequence
          Length = 23167

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 291  cttccttccttccttcccctgccttcct 318
            |||||||||||||||||||| |||||||
Sbjct: 1589 cttccttccttccttccccttccttcct 1616



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 291  cttccttccttccttcccctgccttcct 318
            |||||||||||||||||||| |||||||
Sbjct: 1531 cttccttccttccttccccttccttcct 1558



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 291  cttccttccttccttcccctgccttcct 318
            |||||||||||||||||||| |||||||
Sbjct: 1489 cttccttccttccttccccttccttcct 1516



 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 291  cttccttccttccttcccctgccttcct 318
            |||||||||||||||||||| |||||||
Sbjct: 1459 cttccttccttccttccccttccttcct 1486



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 294  ccttccttccttcccctgccttcct 318
            ||||||||||||||||| |||||||
Sbjct: 1424 ccttccttccttccccttccttcct 1448



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 291  cttccttccttccttcccct 310
            ||||||||||||||||||||
Sbjct: 1379 cttccttccttccttcccct 1398



to top

>gb|AC169811.2| Rhesus Macaque CHR7 BAC CH250-119C16 (Children's Hospital Oakland
             Research Institute Rhesus macaque Adult Male BAC Library)
             complete sequence
          Length = 166377

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 39133 cttccttccttccttccccttccttcct 39106



to top

>emb|AL773580.11| Mouse DNA sequence from clone RP23-26G3 on chromosome X, complete
             sequence
          Length = 210533

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||||||| |||||||
Sbjct: 64655 cttccttccttccttccccttccttcct 64628



to top

>emb|AL662823.12| Mouse DNA sequence from clone RP23-243E17 on chromosome 3, complete
            sequence
          Length = 215241

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 291  cttccttccttccttcccctgcct 314
            ||||||||||||||||||||||||
Sbjct: 1029 cttccttccttccttcccctgcct 1006



to top

>emb|AL645753.11| Mouse DNA sequence from clone CT7-315N12 on chromosome 3, complete
              sequence
          Length = 145594

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 291    cttccttccttccttcccctgcct 314
              ||||||||||||||||||||||||
Sbjct: 105890 cttccttccttccttcccctgcct 105867



to top

>emb|AL691425.6| Mouse DNA sequence from clone RP23-232E4 on chromosome 3, complete
             sequence
          Length = 42679

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 291   cttccttccttccttcccctgcct 314
             ||||||||||||||||||||||||
Sbjct: 41708 cttccttccttccttcccctgcct 41685



to top

>gb|AC183761.3| Pan troglodytes BAC clone CH251-710C5 from chromosome 7, complete
             sequence
          Length = 205916

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 292   ttccttccttccttcccctgccttcct 318
             ||||||||||||||||||| |||||||
Sbjct: 29174 ttccttccttccttccccttccttcct 29200



to top

>gb|AC129295.4| Mus musculus BAC clone RP24-560M23 from chromosome 1, complete sequence
          Length = 121538

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 290   tcttccttccttccttcccctgc 312
             |||||||||||||||||||||||
Sbjct: 64389 tcttccttccttccttcccctgc 64411



to top

>gb|AC025540.7| Homo sapiens BAC clone RP11-295N22 from 7, complete sequence
          Length = 160896

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 291   cttccttccttccttcccctgccttcc 317
             |||||||||||||||||||| ||||||
Sbjct: 38998 cttccttccttccttccccttccttcc 39024



to top

>gb|AC006013.3| Homo sapiens PAC clone RP5-945F2 from 7, complete sequence
          Length = 159002

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 292   ttccttccttccttcccctgccttcct 318
             ||||||||||||||||||| |||||||
Sbjct: 38007 ttccttccttccttccccttccttcct 38033



to top

>gb|AC159647.2| Mus musculus BAC clone RP23-66A14 from chromosome 12, complete sequence
          Length = 213946

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 291    cttccttccttccttcccctgccttcc 317
              |||||||||||||||||||| ||||||
Sbjct: 145453 cttccttccttccttcccctcccttcc 145479



to top

>emb|AL360232.24| Human DNA sequence from clone RP11-374I18 on chromosome 6, complete
              sequence
          Length = 157784

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 285    gctcatcttccttccttccttcc 307
              |||||||||||||||||||||||
Sbjct: 120766 gctcatcttccttccttccttcc 120788



to top

>emb|AL109659.20|HSJ1024N4 Human DNA sequence from clone RP5-1024N4 on chromosome 1p32.1-33
             Contains two novel genes, a novel pseudogene, a novel gene
             (LOC200010), a novel gene similar to connexin and one CpG
             island, complete sequence
          Length = 181678

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 292   ttccttccttccttcccctgccttcct 318
             ||||||||||||||||||| |||||||
Sbjct: 50451 ttccttccttccttccccttccttcct 50477



to top

>gb|AC158128.3| Mus musculus chromosome 15, clone RP24-310D6, complete sequence
          Length = 158257

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 291   cttccttccttccttcccctgccttcc 317
             |||||||||||||||||||| ||||||
Sbjct: 81927 cttccttccttccttccccttccttcc 81901



to top

>gb|AC007688.15| Homo sapiens 12 BAC RPCI11-392P7 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 161577

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 292   ttccttccttccttcccctgccttcct 318
             ||||||||||||||||||| |||||||
Sbjct: 51118 ttccttccttccttccccttccttcct 51092



to top

>emb|AL589737.11| Mouse DNA sequence from clone RP23-43L14 on chromosome 13, complete
             sequence
          Length = 202855

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 291   cttccttccttccttcccctgcc 313
             |||||||||||||||||||||||
Sbjct: 19400 cttccttccttccttcccctgcc 19422



to top

>gb|AC154282.1| Mus musculus BAC clone RP24-273O7 from chromosome 12, complete sequence
          Length = 166781

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 30/31 (96%), Gaps = 1/31 (3%)
 Strand = Plus / Plus

                                             
Query: 291    cttccttccttccttcc-cctgccttcctgc 320
              ||||||||||||||||| |||||||||||||
Sbjct: 141752 cttccttccttccttcctcctgccttcctgc 141782



to top

>gb|AC157823.2| Mus musculus BAC clone RP23-382L21 from chromosome 12, complete sequence
          Length = 203726

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 30/31 (96%), Gaps = 1/31 (3%)
 Strand = Plus / Minus

                                             
Query: 291    cttccttccttccttcc-cctgccttcctgc 320
              ||||||||||||||||| |||||||||||||
Sbjct: 185041 cttccttccttccttcctcctgccttcctgc 185011



to top

>gb|AC157660.2| Mus musculus BAC clone RP23-263I16 from chromosome 1, complete sequence
          Length = 192026

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 290   tcttccttccttccttcccctgc 312
             |||||||||||||||||||||||
Sbjct: 35663 tcttccttccttccttcccctgc 35641



to top

>dbj|BS000126.1| Pan troglodytes chromosome 22 clone:PTB-128A24, map 22, complete
             sequences
          Length = 207747

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 291   cttccttccttccttcccctgccttcc 317
             |||||||||||||||||||| ||||||
Sbjct: 22420 cttccttccttccttccccttccttcc 22446



to top

>gb|AC112957.14| Mus musculus chromosome 15, clone RP23-418C6, complete sequence
          Length = 186051

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 291    cttccttccttccttcccctgccttcc 317
              |||||||||||||||||||| ||||||
Sbjct: 132570 cttccttccttccttccccttccttcc 132596



to top

>gb|AC006070.1|AC006070 Homo sapiens chromosome 17, clone hRPK.206_C_20, complete sequence
          Length = 161987

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 292   ttccttccttccttcccctgccttcct 318
             ||||||||||||||||||| |||||||
Sbjct: 43847 ttccttccttccttccccttccttcct 43873



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 291   cttccttccttccttcccct 310
             ||||||||||||||||||||
Sbjct: 59555 cttccttccttccttcccct 59574



to top

>gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, complete sequence
          Length = 181287

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 291   cttccttccttccttcccctgccttcc 317
             |||||||||||||||||||| ||||||
Sbjct: 75004 cttccttccttccttccccttccttcc 75030



 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 291   cttccttccttccttcccctgccttcc 317
             |||||||||||||||||||| ||||||
Sbjct: 74956 cttccttccttccttccccttccttcc 74982



to top

>gb|AC134590.5| Mus musculus BAC clone RP23-368K22 from 9, complete sequence
          Length = 180271

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 292   ttccttccttccttcccctgccttcct 318
             ||||||||||||||||||| |||||||
Sbjct: 77455 ttccttccttccttccccttccttcct 77429



to top

>emb|AL669981.11| Mouse DNA sequence from clone RP23-335B9 on chromosome 4, complete
              sequence
          Length = 222981

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 292    ttccttccttccttcccctgccttcct 318
              ||||||||||||||||||| |||||||
Sbjct: 150842 ttccttccttccttccccttccttcct 150868



to top

>emb|AL731783.10| Mouse DNA sequence from clone RP23-124E18 on chromosome 2, complete
             sequence
          Length = 207209

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 290   tcttccttccttccttcccctgccttcctgc 320
             |||||||||||| |||||||| |||||||||
Sbjct: 98713 tcttccttcctttcttccccttccttcctgc 98743



to top

>gb|AC093353.11| Mus musculus chromosome 10, clone RP23-19C22, complete sequence
          Length = 188921

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 286    ctcatcttccttccttccttcc 307
              ||||||||||||||||||||||
Sbjct: 161826 ctcatcttccttccttccttcc 161847



to top

>gb|AC125156.3| Mus musculus BAC clone RP24-386H5 from chromosome 18, complete sequence
          Length = 189554

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 286    ctcatcttccttccttccttcc 307
              ||||||||||||||||||||||
Sbjct: 188628 ctcatcttccttccttccttcc 188607



to top

>gb|AC133214.3| Mus musculus BAC clone RP23-72A15 from chromosome 10, complete sequence
          Length = 157067

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 286    ctcatcttccttccttccttcc 307
              ||||||||||||||||||||||
Sbjct: 143525 ctcatcttccttccttccttcc 143504



to top

>gb|AC122809.4| Mus musculus BAC clone RP23-272E5 from chromosome 7, complete sequence
          Length = 205725

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 286    ctcatcttccttccttccttcc 307
              ||||||||||||||||||||||
Sbjct: 139207 ctcatcttccttccttccttcc 139228



to top

>gb|AC124415.4| Mus musculus BAC clone RP24-298J2 from chromosome 10, complete sequence
          Length = 160137

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 286   ctcatcttccttccttccttcc 307
             ||||||||||||||||||||||
Sbjct: 78136 ctcatcttccttccttccttcc 78157



to top

>gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complete sequence
          Length = 196627

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 291   cttccttccttccttcccctgccttc 316
             |||||||||||||||||||| |||||
Sbjct: 98930 cttccttccttccttccccttccttc 98955



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 290   tcttccttccttccttcccct 310
             |||||||||||||||||||||
Sbjct: 17653 tcttccttccttccttcccct 17673



to top

>gb|AC126695.4| Mus musculus BAC clone RP23-313D2 from 18, complete sequence
          Length = 171427

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 286    ctcatcttccttccttccttcc 307
              ||||||||||||||||||||||
Sbjct: 149246 ctcatcttccttccttccttcc 149267



to top

>gb|AC102339.16| Mus musculus chromosome 18, clone RP24-573J7, complete sequence
          Length = 170154

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 291  cttccttccttccttcccctgccttc 316
            |||||||||||||||||||| |||||
Sbjct: 8763 cttccttccttccttcccctcccttc 8788



to top

>gb|AF549168.1| Homo sapiens exonuclease 1 (EXO1) gene, complete cds
          Length = 42822

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 287   tcatcttccttccttccttccc 308
             ||||||||||||||||||||||
Sbjct: 21663 tcatcttccttccttccttccc 21684



to top

>ref|NG_002793.1| Homo sapiens pelota/integrin, alpha 1 region (PELO/ITGA1@) on
             chromosome 5
          Length = 166541

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 293   tccttccttccttcccctgccttcct 318
             |||||||||||||||||| |||||||
Sbjct: 46955 tccttccttccttccccttccttcct 46930



to top

>gb|AC102675.9| Mus musculus, clone RP23-232O16, complete sequence
          Length = 208734

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 294   ccttccttccttcccctgcctt 315
             ||||||||||||||||||||||
Sbjct: 38913 ccttccttccttcccctgcctt 38934



to top

>emb|AL591022.6| Human DNA sequence from clone RP13-485J5 on chromosome Xq27.3-28,
             complete sequence
          Length = 89747

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 293   tccttccttccttcccctgccttcct 318
             |||||||||||||||| |||||||||
Sbjct: 66389 tccttccttccttcccttgccttcct 66414



to top

>emb|AL360269.21| Human DNA sequence from clone RP11-192I3 on chromosome 1 Contains the
             WNT9A gene for wingless-type MMTV integration site family,
             member 9A and a CpG island, complete sequence
          Length = 141703

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 286   ctcatcttccttccttccttcc 307
             ||||||||||||||||||||||
Sbjct: 77661 ctcatcttccttccttccttcc 77682



to top

>emb|AL365366.20| Human DNA sequence from clone RP11-553N16 on chromosome 1 Contains the
             3' end of the gene for a novel protein (FLJ16613), a
             ribosomal protein L6 (RPL6) pseudogene, the EXO1 gene for
             exonuclease 1, the 5' end of a ribosomal protein L23a
             (RPL23a) pseudogene and a CpG island, complete sequence
          Length = 143967

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 287   tcatcttccttccttccttccc 308
             ||||||||||||||||||||||
Sbjct: 97302 tcatcttccttccttccttccc 97323



to top

>emb|AL356125.13| Human DNA sequence from clone RP11-85G2 on chromosome 6 Contains part
            of a novel gene, complete sequence
          Length = 32328

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 286  ctcatcttccttccttccttcc 307
            ||||||||||||||||||||||
Sbjct: 7987 ctcatcttccttccttccttcc 7966



to top

>emb|AL161738.15| Human DNA sequence from clone RP11-549G1 on chromosome 1q31.2-32.1,
            complete sequence
          Length = 148844

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 292  ttccttccttccttcccctgccttcc 317
            ||||||||||||||||||| ||||||
Sbjct: 3294 ttccttccttccttccccttccttcc 3269



to top

>emb|AL096802.11|HSBG13C1 Human DNA sequence from clone GS1-13C1 on chromosome 1q25-31.1 Contains
             part of a novel gene, complete sequence
          Length = 75414

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 286   ctcatcttccttccttccttcc 307
             ||||||||||||||||||||||
Sbjct: 21881 ctcatcttccttccttccttcc 21902



to top

>emb|AL049736.10|HSDJ723E3 Human DNA sequence from clone RP4-723E3 on chromosome 20 Contains ESTs,
             STSs and GSSs, complete sequence
          Length = 73112

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 286   ctcatcttccttccttccttcc 307
             ||||||||||||||||||||||
Sbjct: 16351 ctcatcttccttccttccttcc 16372



to top

>gb|AC157581.2| Mus musculus chromosome 18, clone RP24-249P15, complete sequence
          Length = 176836

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 291    cttccttccttccttcccctgccttc 316
              |||||||||||||||||||| |||||
Sbjct: 142039 cttccttccttccttcccctcccttc 142014



to top

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 286   ctcatcttccttccttccttcc 307
             ||||||||||||||||||||||
Sbjct: 48938 ctcatcttccttccttccttcc 48959



to top

>gb|AC092897.6| Homo sapiens 3 BAC RP11-292P2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 127044

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 286   ctcatcttccttccttccttcc 307
             ||||||||||||||||||||||
Sbjct: 35761 ctcatcttccttccttccttcc 35782



to top

>gb|AC127702.2| Homo sapiens BAC clone RP11-1386H14 from UL, complete sequence
          Length = 176969

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 286   ctcatcttccttccttccttcc 307
             ||||||||||||||||||||||
Sbjct: 76769 ctcatcttccttccttccttcc 76748



to top

>gb|AC008427.9| Homo sapiens chromosome 5 clone CTC-307M15, complete sequence
          Length = 175501

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 31/33 (93%), Gaps = 2/33 (6%)
 Strand = Plus / Minus

                                               
Query: 290    tcttccttccttccttcc--cctgccttcctgc 320
              ||||||||||||||||||  |||||||||||||
Sbjct: 106634 tcttccttccttccttccttcctgccttcctgc 106602



to top

>gb|AC108206.3| Homo sapiens BAC clone RP11-203B7 from 4, complete sequence
          Length = 145500

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 287    tcatcttccttccttccttccc 308
              ||||||||||||||||||||||
Sbjct: 120808 tcatcttccttccttccttccc 120829



to top

>gb|AC027326.6| Homo sapiens chromosome 5 clone CTD-2072B24, complete sequence
          Length = 33744

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 293  tccttccttccttcccctgccttcct 318
            |||||||||||||||||| |||||||
Sbjct: 6165 tccttccttccttccccttccttcct 6140



to top

>gb|AC026230.5|AC026230 Homo sapiens chromosome 5 clone CTD-2288O8, complete sequence
          Length = 114802

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 293    tccttccttccttcccctgccttcct 318
              |||||||||||||||||| |||||||
Sbjct: 104987 tccttccttccttccccttccttcct 104962



to top

>dbj|AK042135.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630062G21 product:hypothetical protein,
           full insert sequence
          Length = 1160

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 286 ctcatcttccttccttccttcc 307
           ||||||||||||||||||||||
Sbjct: 540 ctcatcttccttccttccttcc 561



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 260     ggatatggtcaaactcaaacca 281
               ||||||||||||||||||||||
Sbjct: 3127148 ggatatggtcaaactcaaacca 3127169



to top

>gb|AC104081.2| Homo sapiens BAC clone RP11-559A1 from 2, complete sequence
          Length = 142118

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 286   ctcatcttccttccttccttcc 307
             ||||||||||||||||||||||
Sbjct: 22477 ctcatcttccttccttccttcc 22498



to top

>gb|AC010975.9| Homo sapiens BAC clone RP11-191H23 from 2, complete sequence
          Length = 171249

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 291    cttccttccttccttcccctgc 312
              ||||||||||||||||||||||
Sbjct: 104363 cttccttccttccttcccctgc 104384



to top

>gb|AC004916.2|AC004916 Homo sapiens PAC clone RP5-891L14 from 7p22, complete sequence
          Length = 129014

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 286    ctcatcttccttccttccttcc 307
              ||||||||||||||||||||||
Sbjct: 123908 ctcatcttccttccttccttcc 123887



to top

>gb|AC008910.5|AC008910 Homo sapiens chromosome 5 clone CTD-2267A1, complete sequence
          Length = 78303

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 293   tccttccttccttcccctgccttcct 318
             |||||||||||||||||| |||||||
Sbjct: 60911 tccttccttccttccccttccttcct 60886



to top

>gb|AC084357.23| Homo sapiens 12q BAC RP11-415I12 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 188527

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 293   tccttccttccttcccctgccttcct 318
             |||||||||||||||||| |||||||
Sbjct: 94500 tccttccttccttccccttccttcct 94525



to top

>dbj|BS000195.1| Pan troglodytes chromosome 22 clone:PTB-014E11, map 22, complete
              sequences
          Length = 251753

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 293    tccttccttccttcccctgccttcct 318
              |||||||||||||||||| |||||||
Sbjct: 149111 tccttccttccttcccctcccttcct 149136



to top

>dbj|AP003940.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1066_B03
          Length = 115339

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 260   ggatatggtcaaactcaaacca 281
             ||||||||||||||||||||||
Sbjct: 86632 ggatatggtcaaactcaaacca 86653



to top

>gb|AC153621.5| Mus musculus 6 BAC RP23-272K20 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 215547

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 294  ccttccttccttcccctgcctt 315
            ||||||||||||||||||||||
Sbjct: 9050 ccttccttccttcccctgcctt 9029



to top

>dbj|AP005714.3| Homo sapiens genomic DNA, chromosome 8q24, clone: KB857C2, complete
             sequence
          Length = 104612

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 293   tccttccttccttcccctgccttcct 318
             |||||||||||||||||| |||||||
Sbjct: 11886 tccttccttccttccccttccttcct 11911



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||||||||||||| ||| |||||||
Sbjct: 12221 cttccttccttccttctccttccttcct 12248



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 291   cttccttccttccttcccct 310
             ||||||||||||||||||||
Sbjct: 12012 cttccttccttccttcccct 12031



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 291   cttccttccttccttcccct 310
             ||||||||||||||||||||
Sbjct: 11968 cttccttccttccttcccct 11987



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             ||||| |||||||||||||| |||||||
Sbjct: 11950 cttccgtccttccttccccttccttcct 11977



to top

>gb|U39155.1|HSPDEA9 Human phosphodiesterase (PDEA) gene, intron 5, 5' end
          Length = 578

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 31/33 (93%), Gaps = 2/33 (6%)
 Strand = Plus / Plus

                                            
Query: 290 tcttccttccttccttcc--cctgccttcctgc 320
           ||||||||||||||||||  |||||||||||||
Sbjct: 268 tcttccttccttccttccttcctgccttcctgc 300



to top

>gb|AC002546.1|AC002546 Homo sapiens chromosome 17, clone 193h18, complete sequence
          Length = 106420

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 244   gcaaactataaagaatggatat 265
             ||||||||||||||||||||||
Sbjct: 30859 gcaaactataaagaatggatat 30838



to top

>emb|AL669950.11| Mouse DNA sequence from clone RP23-14C19 on chromosome X, complete
              sequence
          Length = 207256

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 31/33 (93%), Gaps = 2/33 (6%)
 Strand = Plus / Plus

                                               
Query: 290    tcttccttccttccttcc--cctgccttcctgc 320
              ||||||||||||||||||  |||||||||||||
Sbjct: 175034 tcttccttccttccttccttcctgccttcctgc 175066



to top

>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence
          Length = 186903

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 287  tcatcttccttccttccttcc 307
            |||||||||||||||||||||
Sbjct: 3913 tcatcttccttccttccttcc 3933



to top

>gb|AC102297.12| Mus musculus chromosome 1, clone RP24-392K18, complete sequence
          Length = 167248

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 149319 cttccttccttccttccttcctgccttcctgc 149350



to top

>gb|AC107645.28| Mus musculus chromosome 15, clone RP23-78J21, complete sequence
          Length = 240912

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             |||||||||||||||||| || |||||||
Sbjct: 99024 tcttccttccttccttcctcttccttcct 99052



to top

>gb|AC166111.4| Mus musculus BAC clone RP23-68O7 from chromosome 1, complete sequence
          Length = 185692

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 109505 tcatcttccttccttccttcc 109485



to top

>gb|AC117203.4| Mus musculus BAC clone RP23-251N4 from chromosome 10, complete sequence
          Length = 231532

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 36433 tcatcttccttccttccttcc 36413



to top

>gb|AC114667.12| Mus musculus chromosome 1, clone RP24-175L10, complete sequence
          Length = 171306

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 48669 tcatcttccttccttccttcc 48689



to top

>gb|AC147455.3| Atelerix albiventris clone LB4-341B4, complete sequence
          Length = 164065

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 290    tcttccttccttccttcccctgccttcct 318
              |||||||||||||||| |||| |||||||
Sbjct: 155284 tcttccttccttcctttcccttccttcct 155312



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 291    cttccttccttccttcccctgccttcct 318
              ||||||||||||||| |||| |||||||
Sbjct: 155315 cttccttccttcctttcccttccttcct 155342



to top

>gb|AC167971.3| Mus musculus BAC clone RP24-439I22 from chromosome 7, complete sequence
          Length = 198057

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 290    tcttccttccttccttcccctgccttcct 318
              |||| |||||||||||||||| |||||||
Sbjct: 181094 tctttcttccttccttccccttccttcct 181122



to top

>gb|AC124637.10| Mus musculus chromosome 15, clone RP23-458B6, complete sequence
          Length = 200607

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 172007 cttccttccttccttccttcctgccttcctgc 171976



to top

>gb|AC119856.13| Mus musculus chromosome 5, clone RP23-256B18, complete sequence
          Length = 218174

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 18464 tcatcttccttccttccttcc 18444



to top

>gb|AY703980.1| Ptilonorhynchus violaceus microsatellite SBBAAGG179 sequence
          Length = 521

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                           
Query: 291 cttccttccttccttcc--cctgccttcctgc 320
           |||||||||||||||||  |||||||||||||
Sbjct: 288 cttccttccttccttccttcctgccttcctgc 257



to top

>gb|AC113050.9| Mus musculus chromosome 1, clone RP23-250O14, complete sequence
          Length = 207359

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 288   catcttccttccttccttccc 308
             |||||||||||||||||||||
Sbjct: 68025 catcttccttccttccttccc 68045



to top

>gb|AC162902.4| Mus musculus BAC clone RP23-448D23 from chromosome 12, complete
            sequence
          Length = 190357

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 287  tcatcttccttccttccttcc 307
            |||||||||||||||||||||
Sbjct: 2651 tcatcttccttccttccttcc 2671



to top

>gb|AC120004.14| Mus musculus chromosome 5, clone RP24-150N15, complete sequence
          Length = 199229

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 164481 tcatcttccttccttccttcc 164461



to top

>gb|AC132833.10| Mus musculus chromosome 15, clone RP24-498G7, complete sequence
          Length = 154206

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||| ||||||||||||| |||||||
Sbjct: 88450 tcttcctcccttccttccccttccttcct 88422



to top

>gb|AC124103.5| Mus musculus chromosome 15, clone RP24-271M13, complete sequence
          Length = 177753

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 96687 tcatcttccttccttccttcc 96707



to top

>gb|AC132274.3| Mus musculus BAC clone RP24-341I21 from chromosome 3, complete sequence
          Length = 172883

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 24334 tcatcttccttccttccttcc 24354



to top

>gb|AC114342.12| Mus musculus chromosome 5, clone RP24-143H14, complete sequence
          Length = 171509

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 134649 tcatcttccttccttccttcc 134629



to top

>gb|AC147676.10| Canis Familiaris, clone XX-25H12, complete sequence
          Length = 203436

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 290  tcttccttccttccttcccct 310
            |||||||||||||||||||||
Sbjct: 8830 tcttccttccttccttcccct 8850



to top

>gb|AC118606.13| Mus musculus chromosome 5, clone RP24-69F9, complete sequence
          Length = 208384

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 129002 tcatcttccttccttccttcc 129022



to top

>gb|AC159980.10| Mus musculus chromosome 3, clone RP24-171D20, complete sequence
          Length = 153366

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                          
Query: 291   cttccttccttccttcc-cctgccttcct 318
             ||||||||||||||||| |||||||||||
Sbjct: 82256 cttccttccttccttcctcctgccttcct 82228



to top

>gb|AC148008.2| Mus musculus BAC clone RP23-253C14 from chromosome 18, complete
            sequence
          Length = 161965

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 290  tcttccttccttccttcccct 310
            |||||||||||||||||||||
Sbjct: 1905 tcttccttccttccttcccct 1885



to top

>gb|AC132332.2| Mus musculus BAC clone RP24-222H7 from chromosome 10, complete sequence
          Length = 155268

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 65228 cttccttccttccttcctgcctgccttcctgc 65197



to top

>gb|AC090046.10| Mus musculus chromosome 6, clone RP23-82P24, complete sequence
          Length = 179099

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 290    tcttccttccttccttcccctgccttcct 318
              |||||||||||||||| |||| |||||||
Sbjct: 143438 tcttccttccttcctttcccttccttcct 143410



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 291    cttccttccttccttcccct 310
              ||||||||||||||||||||
Sbjct: 143407 cttccttccttccttcccct 143388



to top

>gb|AC141886.3| Mus musculus BAC clone RP24-87G24 from chromosome 7, complete sequence
          Length = 173677

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 291   cttccttccttccttcccctgcctt 315
             |||||||||||||||||||| ||||
Sbjct: 61997 cttccttccttccttccccttcctt 61973



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 291   cttccttccttccttcccct 310
             ||||||||||||||||||||
Sbjct: 61778 cttccttccttccttcccct 61759



to top

>gb|AC135240.2| Mus musculus BAC clone RP24-63O24 from chromosome 5, complete sequence
          Length = 196371

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 142230 cttccttccttccttccttcctgccttcctgc 142199



to top

>gb|AC146594.3| Mus musculus BAC clone RP24-155O13 from chromosome 14, complete sequence
          Length = 172361

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 293    tccttccttccttcccctgccttcc 317
              |||||||||||||||||| ||||||
Sbjct: 136762 tccttccttccttccccttccttcc 136786



to top

>gb|AC144794.2| Mus musculus BAC clone RP24-463B6 from chromosome 18, complete sequence
          Length = 152588

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 290   tcttccttccttccttcccct 310
             |||||||||||||||||||||
Sbjct: 79530 tcttccttccttccttcccct 79510



to top

>gb|AC158925.4| Mus musculus chromosome 1, clone RP23-22I7, complete sequence
          Length = 181897

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 94871 cttccttccttccttccttcctgccttcctgc 94840



to top

>gb|AC158968.3| Mus musculus chromosome 1, clone RP23-411D16, complete sequence
          Length = 183663

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 290   tcttccttccttccttcccct 310
             |||||||||||||||||||||
Sbjct: 23807 tcttccttccttccttcccct 23827



to top

>gb|AC116503.17| Mus musculus chromosome 9, clone RP24-302M3, complete sequence
          Length = 199065

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 290  tcttccttccttccttcccct 310
            |||||||||||||||||||||
Sbjct: 7162 tcttccttccttccttcccct 7142



to top

>gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, complete sequence
          Length = 170056

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 288   catcttccttccttccttccc 308
             |||||||||||||||||||||
Sbjct: 67143 catcttccttccttccttccc 67123



to top

>gb|AC104868.8| Mus musculus chromosome 1, clone RP24-532K6, complete sequence
          Length = 182376

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 40653 cttccttccttccttccttcctgccttcctgc 40684



to top

>gb|AC163033.4| Mus musculus BAC clone RP23-432F6 from chromosome 12, complete sequence
          Length = 201510

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 195063 cttccttccttccttccttcctgccttcctgc 195094



to top

>gb|AC153007.4| Mus musculus BAC clone RP24-266E2 from chromosome 8, complete sequence
          Length = 174101

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 164553 tcatcttccttccttccttcc 164533



to top

>gb|AC165239.3| Mus musculus chromosome 19, clone RP24-73C2, complete sequence
          Length = 208461

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 168698 tcatcttccttccttccttcc 168718



to top

>gb|AC163025.3| Mus musculus chromosome 1, clone RP23-80N7, complete sequence
          Length = 174774

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 288  catcttccttccttccttccc 308
            |||||||||||||||||||||
Sbjct: 9000 catcttccttccttccttccc 9020



to top

>gb|AC137108.12| Mus musculus chromosome 9, clone RP23-277J20, complete sequence
          Length = 204108

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 131744 tcatcttccttccttccttcc 131724



to top

>gb|AC005102.1| Homo sapiens BAC clone CTA-356E1 from 7, complete sequence
          Length = 106508

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             |||||||| |||||||||||| |||||||
Sbjct: 73384 tcttcctttcttccttccccttccttcct 73412



to top

>gb|AC132624.3| Mus musculus BAC clone RP23-77B21 from chromosome 18, complete
            sequence
          Length = 161099

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 287  tcatcttccttccttccttcc 307
            |||||||||||||||||||||
Sbjct: 3051 tcatcttccttccttccttcc 3031



to top

>gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosome 7, complete sequence
          Length = 176244

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 120522 tcatcttccttccttccttcc 120542



to top

>gb|AC138457.3| Mus musculus BAC clone RP23-358E1 from chromosome 19, complete sequence
          Length = 237854

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 288    catcttccttccttccttccc 308
              |||||||||||||||||||||
Sbjct: 153204 catcttccttccttccttccc 153224



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 288    catcttccttccttccttcc 307
              ||||||||||||||||||||
Sbjct: 153227 catcttccttccttccttcc 153246



to top

>gb|AC133653.4| Mus musculus BAC clone RP24-320J12 from chromosome 7, complete sequence
          Length = 144233

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 134   aagatctacagacgcaaacat 154
             |||||||||||||||||||||
Sbjct: 66320 aagatctacagacgcaaacat 66340



to top

>gb|AC136915.14| Mus musculus chromosome 16, clone RP23-65O24, complete sequence
          Length = 140233

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 290   tcttccttccttccttcccct 310
             |||||||||||||||||||||
Sbjct: 75123 tcttccttccttccttcccct 75103



to top

>emb|CT009594.4| Mouse DNA sequence from clone RP23-146J6 on chromosome 17, complete
              sequence
          Length = 176432

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 148176 tcatcttccttccttccttcc 148156



to top

>gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosome 7, complete sequence
          Length = 152908

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 291   cttccttccttccttcccctg 311
             |||||||||||||||||||||
Sbjct: 98034 cttccttccttccttcccctg 98054



to top

>gb|AC135963.3| Mus musculus BAC clone RP23-346N11 from chromosome 7, complete sequence
          Length = 202404

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             |||||||||||||||||| || |||||||
Sbjct: 98459 tcttccttccttccttcctcttccttcct 98487



to top

>gb|AC129598.4| Mus musculus BAC clone RP23-283O5 from chromosome 18, complete sequence
          Length = 213381

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 88782 cttccttccttccttccttcctgccttcctgc 88813



to top

>gb|AC132395.3| Mus musculus BAC clone RP23-391F17 from chromosome 18, complete
            sequence
          Length = 212786

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 287  tcatcttccttccttccttcc 307
            |||||||||||||||||||||
Sbjct: 2800 tcatcttccttccttccttcc 2820



to top

>gb|AC004787.1|HUAC004787 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-952F10, complete
             sequence
          Length = 216021

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 291   cttccttccttccttcccctgcctt 315
             |||||||||||||||||||| ||||
Sbjct: 42953 cttccttccttccttccccttcctt 42929



to top

>gb|AC122466.2| Mus musculus BAC clone RP24-304N8 from chromosome 5, complete sequence
          Length = 196687

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 159532 tcatcttccttccttccttcc 159512



to top

>gb|AC124485.3| Mus musculus BAC clone RP23-450J12 from chromosome 8, complete sequence
          Length = 198254

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 146521 tcatcttccttccttccttcc 146501



to top

>gb|AC116999.2| Mus musculus BAC clone RP23-28L10 from 19, complete sequence
          Length = 209671

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 58498 cttccttccttccttccttcctgccttcctgc 58529



to top

>gb|AC117243.3| Mus musculus BAC clone RP24-198D9 from 9, complete sequence
          Length = 168127

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 165644 tcatcttccttccttccttcc 165624



to top

>gb|AC117255.3| Mus musculus BAC clone RP24-481E4 from 3, complete sequence
          Length = 209706

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 114893 cttccttccttccttccttcctgccttcctgc 114924



to top

>gb|AC122823.2| Mus musculus BAC clone RP23-205I22 from 18, complete sequence
          Length = 203725

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 90262 tcatcttccttccttccttcc 90242



to top

>gb|AC003076.2| Homo sapiens PAC clone RP5-1008B19 from 7, complete sequence
          Length = 15699

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 12231 cttccttccttccttccttcctgccttcctgc 12262



to top

>gb|AC005377.2| Homo sapiens PAC clone RP5-1136G2 from 7, complete sequence
          Length = 102311

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 290    tcttccttccttccttcccct 310
              |||||||||||||||||||||
Sbjct: 100413 tcttccttccttccttcccct 100433



to top

>gb|AC107756.9| Mus musculus chromosome 18, clone RP23-214K19, complete sequence
          Length = 216911

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 211314 cttccttccttccttccttcctgccttcctgc 211283



to top

>gb|AC116468.13| Mus musculus chromosome 16, clone RP23-166G21, complete sequence
          Length = 193206

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 290    tcttccttccttccttcccct 310
              |||||||||||||||||||||
Sbjct: 156313 tcttccttccttccttcccct 156293



to top

>gb|AC116713.8| Mus musculus chromosome 9, clone RP23-118M23, complete sequence
          Length = 275731

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 291    cttccttccttccttcccctgcctt 315
              ||||||||||||||||| |||||||
Sbjct: 113685 cttccttccttccttcctctgcctt 113709



to top

>gb|AC109213.6| Mus musculus chromosome 16, clone RP23-345L20, complete sequence
          Length = 244558

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 86133 tcatcttccttccttccttcc 86113



to top

>gb|AC163283.3| Mus musculus BAC clone RP23-405A16 from chromosome 12, complete sequence
          Length = 197540

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 183673 tcatcttccttccttccttcc 183693



to top

>gb|AC142328.1| Pan troglodytes BAC clone RP43-24E4 from 7, complete sequence
          Length = 192006

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 149232 cttccttccttccttccttcctgccttcctgc 149263



to top

>gb|AC107801.14| Mus musculus, clone RP23-29M6, complete sequence
          Length = 283075

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 170846 tcatcttccttccttccttcc 170866



to top

>emb|AL732423.12| Human DNA sequence from clone RP11-345L8 on chromosome X Contains the 3'
              end of the SH3KBP1 gene for SH3-domain kinase binding
              protein 1 (CIN85) and the 5' end of the gene for a novel
              protein similar to mitogen-activated protein kinase kinase
              kinase 5 (MAP3K5), complete sequence
          Length = 173520

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 290    tcttccttccttccttcccctgccttcct 318
              ||||||| ||||||| |||||||||||||
Sbjct: 134867 tcttcctcccttcctccccctgccttcct 134839



to top

>emb|AL513007.5| Human DNA sequence from clone CTD-2530H13 on chromosome X Contains the
             RNF12 gene for ring finger protein 12, a cytoplasmic
             poly(A) binding protein (PABPC) pseudogene and a CpG
             island, complete sequence
          Length = 90105

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 87280 cttccttccttccttccttcctgccttcctgc 87311



to top

>emb|AL354736.10| Human DNA sequence from clone RP11-205B18 on chromosome 13 Contains the
             5' end of a novel gene (FLJ32909), complete sequence
          Length = 158460

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 80461 cttccttccttccttccttcctgccttcctgc 80430



to top

>emb|AL161742.7| Human DNA sequence from clone RP4-597J3 on chromosome 1p32.1-32.3
             Contains the 5' end of the ROR1 gene for receptor tyrosine
             kinase-like orphan receptor 1, a ribosomal protein L19
             (RPL19) pseudogene, a cofilin 1 (non-muscle) (CFL1)
             pseudogene and a CpG island, complete sequence
          Length = 114409

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 38688 cttccttccttccttccttcctgccttcctgc 38719



to top

>emb|AL139344.24| Human DNA sequence from clone RP1-223H12 on chromosome 1q25.1-25.3
             Contains the GLUL gene for glutamate-ammonia ligase
             (glutamine synthase), the gene for putative membrane
             protein HE9 (HE9), a novel gene (LOC388719), a  membrane
             protein family pseudogene, the RGSL2 gene for regulator of
             G-protein signalling like 2, the 5' end of the RGSL1 gene
             for regulator of G-protein signalling like 1 and a CpG
             island, complete sequence
          Length = 152057

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 289   atcttccttccttccttcccc 309
             |||||||||||||||||||||
Sbjct: 18659 atcttccttccttccttcccc 18639



to top

>gb|AC108679.6| Homo sapiens 3 BAC RP11-485G4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 151450

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 291   cttccttccttccttcccctgcctt 315
             |||||||||||||||||||| ||||
Sbjct: 44271 cttccttccttccttccccttcctt 44295



to top

>emb|AL031118.22|HS153G14 Human DNA sequence from clone RP1-153G14 on chromosome 6p21.3-22.2
             Contains the 3' end of the ZNF184 gene for Kruppel-like
             zinc finger protein 184, a gene for a possible CA binding
             protein similar to NEFA, part of a gene for a novel C2H2
             type Zinc Finger protein, ESTs, STSs, GSSs, 2 CpG islands,
             atag and ca repeat polymorphisms, complete sequence
          Length = 82456

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             |||| |||||||||||||||| |||||||
Sbjct: 65128 tctttcttccttccttccccttccttcct 65156



to top

>emb|AL034349.3|HS86D1 Human DNA sequence from clone RP1-86D1 on chromosome 6q22.2-23.1
             Contains two novel genes and the 5' end of the PTPRK gene
             for protein tyrosine phosphatase, receptor type K
             (R-PTP-KAPPA) and a CpG island, complete sequence
          Length = 112604

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 26526 cttccttccttccttccttcctgccttcctgc 26495



to top

>gb|AC158961.3| Mus musculus chromosome 1, clone RP23-316E20, complete sequence
          Length = 202205

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 290  tcttccttccttccttcccctgcct 314
            |||| ||||||||||||||||||||
Sbjct: 3443 tctttcttccttccttcccctgcct 3467



to top

>gb|AC158781.4| Mus musculus chromosome 7, clone RP23-264H19, complete sequence
          Length = 208419

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 134    aagatctacagacgcaaacat 154
              |||||||||||||||||||||
Sbjct: 109110 aagatctacagacgcaaacat 109130



to top

>gb|AC096039.7| Rattus norvegicus 4 BAC CH230-29I22 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 224101

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 57632 cttccttccttccttccttcctgccttcctgc 57601



to top

>gb|AC166109.1| Mus musculus BAC clone RP23-152E23 from chromosome 16, complete
            sequence
          Length = 207676

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 294  ccttccttccttcccctgccttcct 318
            ||||||||||||||||| |||||||
Sbjct: 9021 ccttccttccttccccttccttcct 8997



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 295  cttccttccttcccctgccttcct 318
            |||||||||||||||| |||||||
Sbjct: 9034 cttccttccttccccttccttcct 9011



to top

>emb|AJ000511.1|MSXDERIV Megaselia scalaris DNA for unknown gene, clones pMSW735 and pMSW736
          Length = 1833

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 21  ttctggaggaatttcagcaaa 41
           |||||||||||||||||||||
Sbjct: 287 ttctggaggaatttcagcaaa 267



to top

>gb|AC026898.8| Homo sapiens chromosome 18, clone RP11-767C4, complete sequence
          Length = 187295

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 291    cttccttccttccttcccctg 311
              |||||||||||||||||||||
Sbjct: 144408 cttccttccttccttcccctg 144388



to top

>emb|AL928857.15| Mouse DNA sequence from clone RP24-499A8 on chromosome 11 Contains the
             5' end of the Gemin5 gene for gem (nuclear organelle)
             associated protein 5,  a novel gene, a interferon gamma
             inducible protein (Ifi47) pseudogene, the Igtp gene for
             interferon gamma induced GTPase, the Gtpi-pending gene for
             interferon-g induced GTPase, a novel gene and one CpG
             island, complete sequence
          Length = 133633

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||||||||| ||||||| |||||||
Sbjct: 29423 tcttccttccttctttccccttccttcct 29451



to top

>gb|AC119566.11| Homo sapiens 12 BAC RP11-41H6 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 70009

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 294  ccttccttccttcccctgccttcct 318
            ||||||||||||||||| |||||||
Sbjct: 1579 ccttccttccttccccttccttcct 1603



to top

>emb|AL589744.18| Mouse DNA sequence from clone RP23-80C18 on chromosome 13 Contains a
             nove gene, a ribosomal protein large p1 (Rplp1) pseudogene
             and the Cmah gene for CMP-N-Acetylneuraminic acid
             hydroxylase, complete sequence
          Length = 216800

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 290   tcttccttccttccttcccct 310
             |||||||||||||||||||||
Sbjct: 46534 tcttccttccttccttcccct 46554



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 291    cttccttccttccttcccct 310
              ||||||||||||||||||||
Sbjct: 138087 cttccttccttccttcccct 138068



to top

>gb|AC113985.11| Mus musculus chromosome 6, clone RP24-103E20, complete sequence
          Length = 169187

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 290    tcttccttccttccttcccctgccttcct 318
              |||||||||||||||| |||| |||||||
Sbjct: 143047 tcttccttccttcctttcccttccttcct 143075



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 291    cttccttccttccttcccct 310
              ||||||||||||||||||||
Sbjct: 143078 cttccttccttccttcccct 143097



to top

>emb|CR753179.6| Opossum DNA sequence from clone XX-529L22, complete sequence
          Length = 135380

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||| ||||||||||||| |||||||
Sbjct: 13845 tcttcctcccttccttcccctcccttcct 13873



to top

>gb|AC022276.35| Homo sapiens 12 BAC RP11-161A14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 177505

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||||||||||||| ||| |||||||
Sbjct: 21286 tcttccttccttccttctccttccttcct 21314



to top

>emb|CR631130.1| Human DNA sequence from clone XX-NCIH2171_2B12, complete sequence
          Length = 135770

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 31964 cttccttccttccttccttcctgccttcctgc 31995



to top

>gb|AC079766.7| Homo sapiens BAC clone RP11-188P17 from 4, complete sequence
          Length = 129874

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 119600 cttccttccttccttccttcctgccttcctgc 119569



to top

>gb|AC022023.7| Homo sapiens chromosome 10 clone RP11-411P18, complete sequence
          Length = 160420

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 94851 cttccttccttccttccttcctgccttcctgc 94882



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 94819 cttccttccttccttccttcctgccttcctgc 94850



to top

>gb|AC108681.2| Homo sapiens 3q BAC RP11-30O15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 29347

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 12935 tcatcttccttccttccttcc 12915



to top

>gb|AC103974.6| Homo sapiens chromosome 11, clone RP11-1081L13, complete sequence
          Length = 189230

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 72836 cttccttccttccttccttcctgccttcctgc 72805



to top

>gb|AC084361.19| Homo sapiens 12 BAC RP11-364C11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 172853

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 125668 cttccttccttccttccttcctgccttcctgc 125637



to top

>gb|AC156278.8| Mus musculus 6 BAC RP24-249N9 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 162919

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 160354 cttccttccttccttccttcctgccttcctgc 160323



to top

>gb|AC026790.5| Homo sapiens chromosome 5 clone CTD-2228A4, complete sequence
          Length = 102424

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 55044 cttccttccttccttccttcctgccttcctgc 55075



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             |||||||||||||||||| || |||||||
Sbjct: 33214 tcttccttccttccttcctcttccttcct 33242



to top

>gb|AC096760.3| Homo sapiens BAC clone RP11-577B11 from 4, complete sequence
          Length = 99511

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 21573 cttccttccttccttccttcctgccttcctgc 21542



to top

>gb|AC098677.2| Homo sapiens BAC clone RP11-416E16 from 4, complete sequence
          Length = 169063

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 290    tcttccttccttccttcccct 310
              |||||||||||||||||||||
Sbjct: 123032 tcttccttccttccttcccct 123012



to top

>gb|AC091878.2| Homo sapiens chromosome 5 clone CTD-3065A13, complete sequence
          Length = 132444

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 34816 cttccttccttccttccttcctgccttcctgc 34847



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             |||||||||||||||||| || |||||||
Sbjct: 12986 tcttccttccttccttcctcttccttcct 13014



to top

>gb|AC182430.2| Pan troglodytes BAC clone CH251-398I16 from chromosome 4, complete
              sequence
          Length = 145600

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 101637 cttccttccttccttccttcctgccttcctgc 101668



to top

>gb|AC009335.10| Homo sapiens chromosome 17, clone RP11-20O2, complete sequence
          Length = 159611

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 294   ccttccttccttcccctgccttcct 318
             ||||||||||||||||| |||||||
Sbjct: 39859 ccttccttccttccccttccttcct 39883



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 291   cttccttccttccttcccctgccttcct 318
             |||||| ||||||||||||| |||||||
Sbjct: 39842 cttcctcccttccttccccttccttcct 39869



to top

>gb|AC027271.7| Homo sapiens BAC clone RP11-365H22 from 4, complete sequence
          Length = 177985

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||||||||||||| ||| |||||||
Sbjct: 45230 tcttccttccttccttctccttccttcct 45202



to top

>gb|AC074139.4| Homo sapiens chromosome 19 clone LLNLF-144G11, complete sequence
          Length = 40229

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 16914 cttccttccttccttccttcctgccttcctgc 16883



to top

>gb|AC068254.6| Homo sapiens chromosome 18, clone RP11-543H23, complete sequence
          Length = 219260

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 140720 tcatcttccttccttccttcc 140700



to top

>gb|AC015726.8| Homo sapiens chromosome , clone RP11-78O7, complete sequence
          Length = 134680

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 290    tcttccttccttccttcccctgccttcct 318
              ||||||||||||||||||| | |||||||
Sbjct: 116122 tcttccttccttccttccctttccttcct 116150



to top

>gb|AC128031.4| Rattus norvegicus  BAC CH230-418E23 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 176784

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 46570 tcatcttccttccttccttcc 46550



to top

>gb|AC155312.2| Mus musculus BAC clone RP23-411F11 from chromosome 12, complete
             sequence
          Length = 197795

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 90216 tcatcttccttccttccttcc 90236



to top

>dbj|AK171904.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830018L06 product:Protein phosphatase 3
            catalytic subunit beta3 (EC 3.1.3.16) (Serine/threonine
            protein phosphatase) homolog [Homo sapiens], full insert
            sequence
          Length = 3509

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 293  tccttccttccttcccctgccttcc 317
            |||||||||||||||||| ||||||
Sbjct: 1946 tccttccttccttccccttccttcc 1970



to top

>gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold
          Length = 2136267

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 290     tcttccttccttccttcccctgccttcct 318
               |||||||||||||||| |||| |||||||
Sbjct: 1085840 tcttccttccttcctttcccttccttcct 1085868



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 291     cttccttccttccttcccctgccttcct 318
               ||||||||||||||| |||| |||||||
Sbjct: 1085871 cttccttccttcctttcccttccttcct 1085898



to top

>gb|AC156033.6| Mus musculus BAC clone RP23-377G8 from chromosome 12, complete sequence
          Length = 216718

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 187481 tcatcttccttccttccttcc 187461



to top

>gb|AC152161.4| Mus musculus chromosome 19, clone RP23-162O21, complete sequence
          Length = 194652

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 88479 tcatcttccttccttccttcc 88499



to top

>emb|AL391686.10| Human DNA sequence from clone CTB-BR164I22 on chromosome 10, complete
             sequence
          Length = 59938

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||||||||||||||| | |||||||
Sbjct: 37199 tcttccttccttccttcccttcccttcct 37227



to top

>gb|AC096975.5| Rattus norvegicus 2 BAC CH230-203P11 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 213875

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 287  tcatcttccttccttccttcc 307
            |||||||||||||||||||||
Sbjct: 4789 tcatcttccttccttccttcc 4809



to top

>emb|CR383656.1| Human chromosome 14 DNA sequence BAC R-536C10 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 184906

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 291   cttccttccttccttcccctg 311
             |||||||||||||||||||||
Sbjct: 99790 cttccttccttccttcccctg 99770



to top

>gb|AC159279.2| Mus musculus BAC clone RP23-342D8 from chromosome 12, complete sequence
          Length = 206464

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 291   cttccttccttccttcccctgcctt 315
             |||||||||||||||||||| ||||
Sbjct: 84408 cttccttccttccttccccttcctt 84384



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 291   cttccttccttccttcccctgcctt 315
             |||||||||||||||||||| ||||
Sbjct: 84249 cttccttccttccttccccttcctt 84225



to top

>gb|AC160246.2| Mus musculus BAC clone RP24-465F1 from chromosome 9, complete sequence
          Length = 157105

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 82283 cttccttccttccttccttcctgccttcctgc 82252



to top

>gb|AC158544.1| Mus musculus 10 BAC RP24-212P21 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 152222

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 115304 cttccttccttccttcctgcctgccttcctgc 115273



to top

>gb|AC087104.2|AC087104 Danio rerio clone 20A7, complete sequence
          Length = 76922

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 73116 tcatcttccttccttccttcc 73136



to top

>gb|AC127185.3| Rattus norvegicus  BAC CH230-28E5 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 233648

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Minus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 107880 cttccttccttccttccttcctgccttcctgc 107849



to top

>gb|AC159987.5| Mus musculus 10 BAC RP23-475N14 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 172772

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 287    tcatcttccttccttccttcc 307
              |||||||||||||||||||||
Sbjct: 120758 tcatcttccttccttccttcc 120738



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 290      tcttccttccttccttcccct 310
                |||||||||||||||||||||
Sbjct: 33741826 tcttccttccttccttcccct 33741806



to top

>gb|AC025750.10| Homo sapiens BAC clone RP11-804P20 from 2, complete sequence
          Length = 151367

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 291   cttccttccttccttcccctgcctt 315
             |||||||||||||||||||| ||||
Sbjct: 89391 cttccttccttccttccccttcctt 89415



to top

>gb|AC154214.1| Mus musculus BAC clone RP24-129M18 from chromosome 17, complete sequence
          Length = 176792

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 291    cttccttccttccttcccctg 311
              |||||||||||||||||||||
Sbjct: 164506 cttccttccttccttcccctg 164526



to top

>gb|AC154576.2| Mus musculus BAC clone RP23-372B6 from chromosome 14, complete sequence
          Length = 152380

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 120    aggagtttgattataagatct 140
              |||||||||||||||||||||
Sbjct: 113205 aggagtttgattataagatct 113225



to top

>gb|AC149590.5| Mus musculus BAC clone RP23-348L9 from chromosome 5, complete sequence
          Length = 196662

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 41914 tcatcttccttccttccttcc 41894



to top

>gb|AC153575.5| Mus musculus 6 BAC RP23-157O3 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 215023

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 214214 cttccttccttccttccttcctgccttcctgc 214245



to top

>gb|AC092141.4| Homo sapiens chromosome 16 clone RP11-478K1, complete sequence
          Length = 98984

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||||||||||||| ||| |||||||
Sbjct: 76577 tcttccttccttccttctccttccttcct 76605



to top

>gb|AC017088.8| Homo sapiens BAC clone RP11-496P1 from 2, complete sequence
          Length = 200440

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   tcatcttccttccttccttcc 307
             |||||||||||||||||||||
Sbjct: 26222 tcatcttccttccttccttcc 26242



to top

>gb|AC009058.10| Homo sapiens chromosome 16 clone RP11-292B23, complete sequence
          Length = 164844

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 291    cttccttccttccttcccctgcctt 315
              |||||||||||||||||||| ||||
Sbjct: 102317 cttccttccttccttccccttcctt 102293



to top

>gb|AC073539.3|AC073539 Homo sapiens chromosome 19 clone RP11-157B13, complete sequence
          Length = 184213

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                             
Query: 291   cttccttccttccttcc--cctgccttcctgc 320
             |||||||||||||||||  |||||||||||||
Sbjct: 65524 cttccttccttccttccttcctgccttcctgc 65555



to top

>gb|AC016543.6|AC016543 Homo sapiens chromosome 14q24.3 clone RP11-516J2 containing hERRB2 gene,
              partial cds, complete sequence
          Length = 196784

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/32 (93%), Gaps = 2/32 (6%)
 Strand = Plus / Plus

                                              
Query: 291    cttccttccttccttcc--cctgccttcctgc 320
              |||||||||||||||||  |||||||||||||
Sbjct: 135485 cttccttccttccttcctgcctgccttcctgc 135516



to top

>gb|AC093769.3| Homo sapiens BAC clone RP11-114I18 from 2, complete sequence
          Length = 58221

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 290   tcttccttccttccttcccctgccttcct 318
             ||||||| ||||||||||||| |||||||
Sbjct: 29686 tcttcctcccttccttcccctcccttcct 29658



to top

>gb|AC068538.8| Homo sapiens BAC clone RP11-141G4 from 2, complete sequence
          Length = 173169

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 294    ccttccttccttcccctgccttcct 318
              ||||||||||||||||| |||||||
Sbjct: 158796 ccttccttccttccccttccttcct 158820



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 291    cttccttccttccttcccct 310
              ||||||||||||||||||||
Sbjct: 154701 cttccttccttccttcccct 154720



to top

>gb|AC129664.7| Homo sapiens BAC clone RP11-237A9 from 4, complete sequence
          Length = 183495

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 290    tcttccttccttccttcccctgccttcct 318
              |||||||||||||||||| || |||||||
Sbjct: 162492 tcttccttccttccttcctctcccttcct 162520


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,610,460
Number of Sequences: 3902068
Number of extensions: 4610460
Number of successful extensions: 708657
Number of sequences better than 10.0: 1045
Number of HSP's better than 10.0 without gapping: 976
Number of HSP's successfully gapped in prelim test: 69
Number of HSP's that attempted gapping in prelim test: 678896
Number of HSP's gapped (non-prelim): 30103
length of query: 339
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 317
effective length of database: 17,147,199,772
effective search space: 5435662327724
effective search space used: 5435662327724
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top