Clone Name	rbart17b11
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_464146.1| Oryza sativa (japonica cultivar-group), mRNA	200	2e-48
2	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	200	2e-48
3	dbj|AP005288.3| Oryza sativa (japonica cultivar-group) genomic D...	200	2e-48
4	dbj|AK073620.1| Oryza sativa (japonica cultivar-group) cDNA clon...	200	2e-48
5	emb|Z21510.1|TATRINF4A T.aestivum translation initiation factor 4A	194	1e-46
6	dbj|AB046415.1| Oryza sativa eIF4A-2 gene for eukaryotic initiat...	176	3e-41
7	dbj|AB046414.1| Oryza sativa eIF4A-2 mRNA for eukaryotic initiat...	176	3e-41
8	gb|BT016643.1| Zea mays clone Contig476 mRNA sequence	170	2e-39
9	gb|AY109160.1| Zea mays PCO074340 mRNA sequence	170	2e-39
10	gb|AY104966.1| Zea mays PCO149753 mRNA sequence	170	2e-39
11	gb|BT017457.1| Zea mays clone EL01N0407C01.c mRNA sequence	163	5e-37
12	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	163	5e-37
13	dbj|AP003726.3| Oryza sativa (japonica cultivar-group) genomic D...	163	5e-37
14	dbj|AP004278.2| Oryza sativa (japonica cultivar-group) genomic D...	163	5e-37
15	dbj|AK119234.1| Oryza sativa (japonica cultivar-group) cDNA clon...	163	5e-37
16	dbj|AK105454.1| Oryza sativa (japonica cultivar-group) cDNA clon...	163	5e-37
17	dbj|AK099927.1| Oryza sativa (japonica cultivar-group) cDNA clon...	163	5e-37
18	dbj|AK065230.1| Oryza sativa (japonica cultivar-group) cDNA clon...	163	5e-37
19	dbj|AK061696.1| Oryza sativa (japonica cultivar-group) cDNA clon...	163	5e-37
20	gb|AF079782.1|AF079782 Zea mays translation initiation factor 4A...	163	5e-37
21	dbj|D12627.1|RICEIF4A Oryza sativa (japonica cultivar-group) mRN...	163	5e-37
22	dbj|AB046416.1| Oryza sativa eIF4A-1 gene for eukaryotic initiat...	163	5e-37
23	gb|AF007580.1|AF007580 Zea mays translation initiation factor (e...	155	1e-34
24	gb|DQ013263.1| Pennisetum glaucum eukaryotic initiation factor 4...	151	2e-33
25	gb|U17979.1|ZMU17979 Zea mays translation initiation factor eIF-...	147	3e-32
26	gb|BT016640.1| Zea mays clone Contig473 mRNA sequence	123	4e-25
27	gb|U73459.1|ZMU73459 Zea mays translational initiation factor eI...	115	1e-22
28	ref|NM_112246.2| Arabidopsis thaliana EIF4A1; ATP-dependent heli...	88	2e-14
29	emb|X65052.1|ATTIF4A1 A.thaliana mRNA for eukaryotic translation...	88	2e-14
30	gb|BT000655.1| Arabidopsis thaliana clone RAFL07-07-D14 (R10830)...	88	2e-14
31	gb|AY091304.1| Arabidopsis thaliana putative eukaryotic initiati...	88	2e-14
32	gb|AY050957.1| Arabidopsis thaliana putative Eukaryotic initiati...	88	2e-14
33	emb|AJ298137.1|ATH298137 Arabidopsis thaliana eIF-4A1 gene for t...	88	2e-14
34	gb|AY139981.1| Arabidopsis thaliana unknown protein mRNA, comple...	88	2e-14
35	gb|AY098962.1| Arabidopsis thaliana AT3g13920/MDC16_4 mRNA, comp...	88	2e-14
36	gb|AY081287.1| Arabidopsis thaliana eukaryotic translation initi...	88	2e-14
37	gb|AY052344.1| Arabidopsis thaliana AT3g13920/MDC16_4 mRNA, comp...	88	2e-14
38	emb|BX825413.1|CNS0A6HS Arabidopsis thaliana Full-length cDNA Co...	88	2e-14
39	emb|BX826218.1|CNS0A6AB Arabidopsis thaliana Full-length cDNA Co...	88	2e-14
40	gb|AY086907.1| Arabidopsis thaliana clone 29310 mRNA, complete s...	88	2e-14
41	dbj|AB019229.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	88	2e-14
42	emb|AJ298138.1|ATH298138 Arabidopsis thaliana mRNA for translati...	88	2e-14
43	gb|BT013166.1| Lycopersicon esculentum clone 134229F, mRNA sequence	84	4e-13
44	emb|X79138.1|NT4A15 N.tabacum NeIF-4A15 mRNA	84	4e-13
45	emb|X79135.1|NT4A9 N.tabacum NeIF-4A9 mRNA	84	4e-13
46	gb|AY040227.1| Elaeis oleifera eukaryotic translation initiation...	70	6e-09
47	ref|NM_001035616.1| Arabidopsis thaliana EIF4A1; ATP-dependent h...	68	2e-08
48	gb|AY167670.1| Pisum sativum DEAD box RNA helicase mRNA, complet...	64	4e-07
49	gb|AY513583.1| Pisum sativum DEAD box RNA helicase gene, complet...	64	4e-07
50	emb|X79009.1|NTEIF4A1 N.tabacum eIF-4A10 mRNA	64	4e-07
51	emb|X79008.1|NTEIF4A1D N.tabacum eIF-4A10 gene	64	4e-07
52	emb|X79139.1|NT4A6 N.tabacum NeIF-4A6 mRNA	60	6e-06
53	gb|AC174465.2| Medicago truncatula chromosome 2 BAC clone mth2-1...	60	6e-06
54	ref|XM_743008.1| Aspergillus fumigatus Af293 DEAD/DEAH box helic...	58	2e-05
55	ref|XM_459136.1| Debaryomyces hansenii CBS767 hypothetical prote...	54	3e-04
56	gb|U13876.3| Caenorhabditis elegans cosmid F57B9, complete sequence	54	3e-04
57	emb|Z12116.1|CEEIF4AM C.elegans mRNA for eIF-4A homologue	54	3e-04
58	emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS...	54	3e-04
59	emb|AJ320155.1|TGO320155 Toxoplasma gondii mRNA for eukaryotic t...	54	3e-04
60	dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102	54	3e-04
61	ref|NM_001027453.1| Caenorhabditis elegans INitiation Factor fam...	54	3e-04
62	ref|NM_001027452.1| Caenorhabditis elegans INitiation Factor fam...	54	3e-04
63	ref|XM_749705.1| Aspergillus fumigatus Af293 eukaryotic translat...	52	0.001
64	gb|AC166553.2| Nectria haematococca clone JGIAYWI-9O2, complete ...	52	0.001
65	ref|XM_501158.1| Yarrowia lipolytica CLIB122, YALI0B20922g predi...	52	0.001
66	emb|X79136.1|NT4A11 N.tabacum NeIF-4A11 mRNA	52	0.001
67	emb|X79137.1|NT4A7 N.tabacum NeIF-4A7 mRNA	52	0.001
68	dbj|AB224877.1| Aspergillus oryzae cDNA, contig sequence: AoEST1727	52	0.001
69	dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005	52	0.001
70	gb|AY158704.1| Apium graveolens var. dulce translation initition...	52	0.001
71	gb|AF180356.1|AF180356 Brassica oleracea isolate B265 EIF4A prot...	52	0.001
72	emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1...	52	0.001
73	emb|X61205.1|NPNEIF4A2 N. plumbaginifolia NeIF-4A2 mRNA for nico...	48	0.021
74	ref|XM_953328.1| Neurospora crassa OR74A EUKARYOTIC INITIATION F...	46	0.084
75	ref|XM_327705.1| Neurospora crassa OR74A EUKARYOTIC INITIATION F...	46	0.084
76	ref|XM_713323.1| Candida albicans SC5314 putative translation in...	46	0.084
77	ref|XM_713054.1| Candida albicans SC5314 putative translation in...	46	0.084
78	gb|AY428601.1| Helianthus annuus clone HA24-15A initiation facto...	46	0.084
79	emb|AJ245475.1|PCY245475 Plasmodium cynomolgi gene for RNA helic...	46	0.084
80	emb|BX053338.1|CNS09DBI Single read from an extremity of a full-...	46	0.084
81	emb|BX020719.1|CNS08O5F Single read from an extremity of a full-...	46	0.084
82	emb|BX072009.1|CNS09RQ5 Single read from an extremity of a full-...	46	0.084
83	emb|BX071180.1|CNS09R34 Single read from an extremity of a full-...	46	0.084
84	emb|BX069140.1|CNS09PIG Single read from an extremity of a full-...	46	0.084
85	emb|BX068966.1|CNS09PDM Single read from an extremity of a full-...	46	0.084
86	emb|BX065544.1|CNS09MQK Single read from an extremity of a full-...	46	0.084
87	emb|BX065406.1|CNS09MMQ Single read from an extremity of a full-...	46	0.084
88	emb|BX064751.1|CNS09M4J Single read from an extremity of a full-...	46	0.084
89	emb|BX063777.1|CNS09LDH Single read from an extremity of a full-...	46	0.084
90	emb|BX063717.1|CNS09LBT Single read from an extremity of a full-...	46	0.084
91	emb|BX062174.1|CNS09K4Y Single read from an extremity of a full-...	46	0.084
92	emb|BX060629.1|CNS09IY1 Single read from an extremity of a full-...	46	0.084
93	emb|BX059812.1|CNS09IBC Single read from an extremity of a full-...	46	0.084
94	emb|BX059694.1|CNS09I82 Single read from an extremity of a full-...	46	0.084
95	emb|BX059458.1|CNS09I1I Single read from an extremity of a full-...	46	0.084
96	emb|BX059457.1|CNS09I1H Single read from an extremity of a full-...	46	0.084
97	emb|BX059385.1|CNS09HZH Single read from an extremity of a full-...	46	0.084
98	emb|BX056724.1|CNS09FXK Single read from an extremity of a full-...	46	0.084
99	emb|BX057426.1|CNS09GH2 Single read from an extremity of a full-...	46	0.084
100	emb|BX057122.1|CNS09G8M Single read from an extremity of a full-...	46	0.084
101	emb|BX056400.1|CNS09FOK Single read from an extremity of a full-...	46	0.084
102	emb|BX055630.1|CNS09F36 Single read from an extremity of a full-...	46	0.084
103	emb|BX053169.1|CNS09D6T Single read from an extremity of a full-...	46	0.084
104	emb|BX053903.1|CNS09DR7 Single read from an extremity of a full-...	46	0.084
105	emb|BX052194.1|CNS09CFQ Single read from an extremity of a full-...	46	0.084
106	emb|BX031051.1|CNS08W4F Single read from an extremity of a full-...	46	0.084
107	emb|BX048647.1|CNS099P7 Single read from an extremity of a full-...	46	0.084
108	emb|BX046371.1|CNS097XZ Single read from an extremity of a full-...	46	0.084
109	emb|BX046370.1|CNS097XY Single read from an extremity of a full-...	46	0.084
110	emb|BX044775.1|CNS096PN Single read from an extremity of a full-...	46	0.084
111	emb|BX043299.1|CNS095KN Single read from an extremity of a full-...	46	0.084
112	emb|BX042604.1|CNS0951C Single read from an extremity of a full-...	46	0.084
113	emb|BX042533.1|CNS094ZD Single read from an extremity of a full-...	46	0.084
114	emb|BX039496.1|CNS092N0 Single read from an extremity of a full-...	46	0.084
115	emb|BX037324.1|CNS090YO Single read from an extremity of a full-...	46	0.084
116	emb|BX037318.1|CNS090YI Single read from an extremity of a full-...	46	0.084
117	emb|BX036647.1|CNS090FV Single read from an extremity of a full-...	46	0.084
118	emb|BX036646.1|CNS090FU Single read from an extremity of a full-...	46	0.084
119	emb|BX036940.1|CNS090O0 Single read from an extremity of a full-...	46	0.084
120	emb|BX036785.1|CNS090JP Single read from an extremity of a full-...	46	0.084
121	emb|BX036205.1|CNS0903L Single read from an extremity of a full-...	46	0.084
122	emb|BX034459.1|CNS08YR3 Single read from an extremity of a full-...	46	0.084
123	emb|BX034458.1|CNS08YR2 Single read from an extremity of a full-...	46	0.084
124	emb|BX033621.1|CNS08Y3T Single read from an extremity of a full-...	46	0.084
125	emb|BX033102.1|CNS08XPE Single read from an extremity of a full-...	46	0.084
126	emb|BX032924.1|CNS08XKG Single read from an extremity of a full-...	46	0.084
127	emb|BX032131.1|CNS08WYF Single read from an extremity of a full-...	46	0.084
128	emb|BX031809.1|CNS08WPH Single read from an extremity of a full-...	46	0.084
129	emb|BX031808.1|CNS08WPG Single read from an extremity of a full-...	46	0.084
130	emb|BX030042.1|CNS08VCE Single read from an extremity of a full-...	46	0.084
131	emb|BX029879.1|CNS08V7V Single read from an extremity of a full-...	46	0.084
132	emb|BX029861.1|CNS08V7D Single read from an extremity of a full-...	46	0.084
133	emb|BX029784.1|CNS08V58 Single read from an extremity of a full-...	46	0.084
134	emb|BX028816.1|CNS08UEC Single read from an extremity of a full-...	46	0.084
135	emb|BX022396.1|CNS08PG0 Single read from an extremity of a full-...	46	0.084
136	emb|BX027810.1|CNS08TME Single read from an extremity of a full-...	46	0.084
137	emb|BX027601.1|CNS08TGL Single read from an extremity of a full-...	46	0.084
138	emb|BX027600.1|CNS08TGK Single read from an extremity of a full-...	46	0.084
139	emb|BX027436.1|CNS08TC0 Single read from an extremity of a full-...	46	0.084
140	emb|BX027282.1|CNS08T7Q Single read from an extremity of a full-...	46	0.084
141	emb|BX027281.1|CNS08T7P Single read from an extremity of a full-...	46	0.084
142	emb|BX026858.1|CNS08SVY Single read from an extremity of a full-...	46	0.084
143	emb|BX026427.1|CNS08SJZ Single read from an extremity of a full-...	46	0.084
144	emb|BX025947.1|CNS08S6N Single read from an extremity of a full-...	46	0.084
145	emb|BX025946.1|CNS08S6M Single read from an extremity of a full-...	46	0.084
146	emb|BX025156.1|CNS08RKO Single read from an extremity of a full-...	46	0.084
147	emb|BX025018.1|CNS08RGU Single read from an extremity of a full-...	46	0.084
148	emb|BX022818.1|CNS08PRQ Single read from an extremity of a full-...	46	0.084
149	emb|BX022573.1|CNS08PKX Single read from an extremity of a full-...	46	0.084
150	emb|BX022178.1|CNS08P9Y Single read from an extremity of a full-...	46	0.084
151	emb|BX021274.1|CNS08OKU Single read from an extremity of a full-...	46	0.084
152	emb|BX020936.1|CNS08OBG Single read from an extremity of a full-...	46	0.084
153	emb|BX020450.1|CNS08NXY Single read from an extremity of a full-...	46	0.084
154	emb|BX020352.1|CNS08NV8 Single read from an extremity of a full-...	46	0.084
155	emb|BX019825.1|CNS08NGL Single read from an extremity of a full-...	46	0.084
156	emb|BX019528.1|CNS08N8C Single read from an extremity of a full-...	46	0.084
157	emb|BX018864.1|CNS08MPW Single read from an extremity of a full-...	46	0.084
158	emb|BX017199.1|CNS08LFN Single read from an extremity of a full-...	46	0.084
159	emb|BX016787.1|CNS08L47 Single read from an extremity of a full-...	46	0.084
160	emb|BX016260.1|CNS08KPK Single read from an extremity of a full-...	46	0.084
161	emb|BX016088.1|CNS08KKS Single read from an extremity of a full-...	46	0.084
162	emb|BX014705.1|CNS08JID Single read from an extremity of a full-...	46	0.084
163	emb|BX014550.1|CNS08JE2 Single read from an extremity of a full-...	46	0.084
164	emb|BX014495.1|CNS08JCJ Single read from an extremity of a full-...	46	0.084
165	emb|BX013937.1|CNS08IX1 Single read from an extremity of a full-...	46	0.084
166	emb|BX012572.1|CNS08HV4 Single read from an extremity of a full-...	46	0.084
167	emb|BX012352.1|CNS08HP0 Single read from an extremity of a full-...	46	0.084
168	emb|BX011160.1|CNS08GRW Single read from an extremity of a full-...	46	0.084
169	emb|BX010574.1|CNS08GBM Single read from an extremity of a full-...	46	0.084
170	emb|BX008147.1|CNS08EG7 Single read from an extremity of a full-...	46	0.084
171	emb|BX008146.1|CNS08EG6 Single read from an extremity of a full-...	46	0.084
172	emb|BX007853.1|CNS08E81 Single read from an extremity of a full-...	46	0.084
173	emb|BX006955.1|CNS08DJ3 Single read from an extremity of a full-...	46	0.084
174	emb|BX006592.1|CNS08D90 Single read from an extremity of a full-...	46	0.084
175	emb|BX005821.1|CNS08CNL Single read from an extremity of a full-...	46	0.084
176	emb|BX005626.1|CNS08CI6 Single read from an extremity of a full-...	46	0.084
177	ref|XM_318978.2| Anopheles gambiae str. PEST ENSANGP00000014802 ...	46	0.084
178	ref|XM_318977.2| Anopheles gambiae str. PEST ENSANGP00000023201 ...	46	0.084
179	dbj|D84472.1| Candida albicans DNA for translation initiation fa...	46	0.084
180	ref|XM_361955.1| Magnaporthe grisea 70-15 hypothetical protein (...	44	0.33
181	ref|XM_387017.1| Gibberella zeae PH-1 chromosome 4 hypothetical ...	44	0.33
182	ref|XM_447438.1| Candida glabrata CBS138 hypothetical protein (C...	44	0.33
183	emb|CR733641.2|CNS0GSUW Tetraodon nigroviridis full-length cDNA	44	0.33
184	emb|CR732658.2|CNS0GS9J Tetraodon nigroviridis full-length cDNA	44	0.33
185	emb|CR729762.2|CNS0GQ14 Tetraodon nigroviridis full-length cDNA	44	0.33
186	emb|CR727356.2|CNS0GO6A Tetraodon nigroviridis full-length cDNA	44	0.33
187	emb|CR726855.2|CNS0GNSD Tetraodon nigroviridis full-length cDNA	44	0.33
188	emb|CR723590.2|CNS0GL9O Tetraodon nigroviridis full-length cDNA	44	0.33
189	emb|CR723240.2|CNS0GKZY Tetraodon nigroviridis full-length cDNA	44	0.33
190	emb|CR717586.2|CNS0GGMW Tetraodon nigroviridis full-length cDNA	44	0.33
191	emb|CR717504.2|CNS0GGKM Tetraodon nigroviridis full-length cDNA	44	0.33
192	emb|CR704662.1|CNS0G6O2 Tetraodon nigroviridis full-length cDNA	44	0.33
193	emb|CR695759.2|CNS0FZSR Tetraodon nigroviridis full-length cDNA	44	0.33
194	emb|CR694040.2|CNS0FYH0 Tetraodon nigroviridis full-length cDNA	44	0.33
195	emb|CR685642.2|CNS0FRZQ Tetraodon nigroviridis full-length cDNA	44	0.33
196	emb|CR680509.2|CNS0FO15 Tetraodon nigroviridis full-length cDNA	44	0.33
197	emb|CR680074.2|CNS0FNP2 Tetraodon nigroviridis full-length cDNA	44	0.33
198	emb|CR674054.2|CNS0FJ2K Tetraodon nigroviridis full-length cDNA	44	0.33
199	emb|CR670075.2|CNS0FG01 Tetraodon nigroviridis full-length cDNA	44	0.33
200	emb|CR667409.2|CNS0FDXZ Tetraodon nigroviridis full-length cDNA	44	0.33
201	emb|CR644829.2|CNS0EWIR Tetraodon nigroviridis full-length cDNA	44	0.33
202	emb|X79141.1|NT4A14 N.tabacum NeIF-4A14 mRNA	44	0.33
203	emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp...	44	0.33
204	gb|AC164399.4| Mus musculus chromosome 8, clone RP23-338K3, comp...	42	1.3
205	ref|XM_798681.1| Trypanosoma brucei TREU927 eukaryotic initiatio...	42	1.3
206	gb|AC099690.8| Mus musculus chromosome 8, clone RP23-73E9, compl...	42	1.3
207	emb|BX028053.1|CNS08TT5 Single read from an extremity of a full-...	42	1.3
208	emb|X87371.1|SCX731 S.cerevisiae DNA from chromosome X (cosmids ...	42	1.3
209	emb|X58099.1|SCYURI S.cerevisiae YURI gene (3' end), TIF2 gene f...	42	1.3
210	gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	42	1.3
211	ref|NM_209008.1| Eremothecium gossypii ACR253Cp (ACR253C), mRNA	42	1.3
212	emb|Z49413.1|SCYJL138C S.cerevisiae chromosome X reading frame O...	42	1.3
213	emb|Z28284.1|SCYKR059W S.cerevisiae chromosome XI reading frame ...	42	1.3
214	emb|X12814.1|SCTIF2 Yeast TIF2 gene	42	1.3
215	emb|X12813.1|SCTIF1 Yeast TIF1 gene	42	1.3
216	gb|AC109510.7| Mus musculus chromosome 8, clone RP23-23D6, compl...	42	1.3
217	gb|DQ331786.1| Synthetic construct Saccharomyces cerevisiae clon...	42	1.3
218	gb|AY432777.1| Aedes aegypti ASAP ID: 34063 translation initiati...	40	5.2
219	gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome	40	5.2
220	gb|AE006526.1| Streptococcus pyogenes M1 GAS, section 55 of 167 ...	40	5.2
221	gb|DQ440212.1| Aedes aegypti clone AET-2104 initiation factor EI...	40	5.2
222	gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome	40	5.2
223	ref|XM_451255.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A05731g ...	40	5.2
224	emb|CR696590.1|CNS0G0FU Tetraodon nigroviridis full-length cDNA	40	5.2
225	emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on ch...	40	5.2
226	emb|BX066433.1|CNS09NF9 Single read from an extremity of a full-...	40	5.2
227	emb|BX066432.1|CNS09NF8 Single read from an extremity of a full-...	40	5.2
228	emb|BX047039.1|CNS098GJ Single read from an extremity of a full-...	40	5.2
229	emb|BX032724.1|CNS08XEW Single read from an extremity of a full-...	40	5.2
230	emb|BX026915.1|CNS08SXJ Single read from an extremity of a full-...	40	5.2
231	emb|BX021814.1|CNS08OZU Single read from an extremity of a full-...	40	5.2
232	emb|BX021194.1|CNS08OIM Single read from an extremity of a full-...	40	5.2
233	emb|BX009925.1|CNS08FTL Single read from an extremity of a full-...	40	5.2
234	emb|BX009165.1|CNS08F8H Single read from an extremity of a full-...	40	5.2
235	emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	40	5.2
236	emb|CR938203.1| Single read from an extremity of a full-length c...	40	5.2
237	gb|AC005334.1|AC005334 Drosophila melanogaster DNA sequence (P1s...	40	5.2
238	gb|CP000219.1| Drosophila melanogaster genomic scaffold 21100002...	40	5.2
239	gb|AC002107.1|AC002107 Genomic sequence from Human 9q34, complet...	40	5.2
240	gb|AC002106.1|AC002106 Genomic sequence from Human 9q34, complet...	40	5.2

---

>ref|XM_464146.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1715

 Score =  200 bits (101), Expect = 2e-48
 Identities = 143/157 (91%)
 Strand = Plus / Minus

                                                                        
Query: 230  ataatctagagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaac 289
            ||||||||||||||||| ||||| |||||||| |||||||| |||  ||| |||||||||
Sbjct: 1444 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtcacattgtagaac 1385

                                                                        
Query: 290  ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 349
             |||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||
Sbjct: 1384 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagttaatggcaactccc 1325

                                                 
Query: 350  ttcctcccgaaccgaccactacgaccaatgcgatgga 386
            ||||| || ||||||||||||||||||||||||||||
Sbjct: 1324 ttcctgccaaaccgaccactacgaccaatgcgatgga 1288

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  200 bits (101), Expect = 2e-48
 Identities = 143/157 (91%)
 Strand = Plus / Minus

                                                                           
Query: 230     ataatctagagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaac 289
               ||||||||||||||||| ||||| |||||||| |||||||| |||  ||| |||||||||
Sbjct: 2560740 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtcacattgtagaac 2560681

                                                                           
Query: 290     ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 349
                |||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||
Sbjct: 2560680 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagttaatggcaactccc 2560621

                                                    
Query: 350     ttcctcccgaaccgaccactacgaccaatgcgatgga 386
               ||||| || ||||||||||||||||||||||||||||
Sbjct: 2560620 ttcctgccaaaccgaccactacgaccaatgcgatgga 2560584

---

>dbj|AP005288.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1008_C03
          Length = 103297

 Score =  200 bits (101), Expect = 2e-48
 Identities = 143/157 (91%)
 Strand = Plus / Minus

                                                                         
Query: 230   ataatctagagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaac 289
             ||||||||||||||||| ||||| |||||||| |||||||| |||  ||| |||||||||
Sbjct: 39523 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtcacattgtagaac 39464

                                                                         
Query: 290   ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 349
              |||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||
Sbjct: 39463 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagttaatggcaactccc 39404

                                                  
Query: 350   ttcctcccgaaccgaccactacgaccaatgcgatgga 386
             ||||| || ||||||||||||||||||||||||||||
Sbjct: 39403 ttcctgccaaaccgaccactacgaccaatgcgatgga 39367

---

>dbj|AK073620.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048E24, full
            insert sequence
          Length = 1714

 Score =  200 bits (101), Expect = 2e-48
 Identities = 143/157 (91%)
 Strand = Plus / Minus

                                                                        
Query: 230  ataatctagagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaac 289
            ||||||||||||||||| ||||| |||||||| |||||||| |||  ||| |||||||||
Sbjct: 1443 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtcacattgtagaac 1384

                                                                        
Query: 290  ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 349
             |||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||
Sbjct: 1383 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagttaatggcaactccc 1324

                                                 
Query: 350  ttcctcccgaaccgaccactacgaccaatgcgatgga 386
            ||||| || ||||||||||||||||||||||||||||
Sbjct: 1323 ttcctgccaaaccgaccactacgaccaatgcgatgga 1287

---

>emb|Z21510.1|TATRINF4A T.aestivum translation initiation factor 4A
          Length = 1715

 Score =  194 bits (98), Expect = 1e-46
 Identities = 134/146 (91%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            ||||||||||| || ||||| |||||||| ||||| ||||||||||||||||||||||||
Sbjct: 1376 agaaggtcggcaacgttggctgggagctcttcaatcaccacgttgtagaacttctggatg 1317

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || |||||||||||||||||||||||||| || ||||||||||| || ||||||||||||
Sbjct: 1316 tcaaacagcatcctctcatcttcacgggtcacaaagttgatggccacacccttcctcccg 1257

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            |||||||||||||| || ||||||||
Sbjct: 1256 aaccgaccactacgcccgatgcgatg 1231

---

>dbj|AB046415.1| Oryza sativa eIF4A-2 gene for eukaryotic initiation factor 4A,
            complete cds
          Length = 6767

 Score =  176 bits (89), Expect = 3e-41
 Identities = 140/157 (89%)
 Strand = Plus / Minus

                                                                        
Query: 230  ataatctagagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaac 289
            ||||||||||||||||| ||||| |||||||| |||||||| |||    | |||||||||
Sbjct: 5558 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtgccattgtagaac 5499

                                                                        
Query: 290  ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 349
             |||||||||||||||||||||||||||| || |||||||| ||| | ||||||||||||
Sbjct: 5498 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagataatggcaactccc 5439

                                                 
Query: 350  ttcctcccgaaccgaccactacgaccaatgcgatgga 386
            ||||| || ||||||||||||||||||||||||||||
Sbjct: 5438 ttcctgccaaaccgaccactacgaccaatgcgatgga 5402

---

>dbj|AB046414.1| Oryza sativa eIF4A-2 mRNA for eukaryotic initiation factor 4A,
            complete cds
          Length = 1705

 Score =  176 bits (89), Expect = 3e-41
 Identities = 140/157 (89%)
 Strand = Plus / Minus

                                                                        
Query: 230  ataatctagagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaac 289
            ||||||||||||||||| ||||| |||||||| |||||||| |||    | |||||||||
Sbjct: 1438 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtgccattgtagaac 1379

                                                                        
Query: 290  ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 349
             |||||||||||||||||||||||||||| || |||||||| ||| | ||||||||||||
Sbjct: 1378 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagataatggcaactccc 1319

                                                 
Query: 350  ttcctcccgaaccgaccactacgaccaatgcgatgga 386
            ||||| || ||||||||||||||||||||||||||||
Sbjct: 1318 ttcctgccaaaccgaccactacgaccaatgcgatgga 1282

---

>gb|BT016643.1| Zea mays clone Contig476 mRNA sequence
          Length = 1758

 Score =  170 bits (86), Expect = 2e-39
 Identities = 131/146 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| ||||| || ||||||||||| | ||||||||||||||||||||||
Sbjct: 1360 agaaggtcagcgacgttggcaggcagctcctcaatcaacacgttgtagaacttctggatg 1301

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            ||||||||||||| ||| || || ||||| || |||||||||||||| |||||||| |||
Sbjct: 1300 tcgaacagcatccgctcgtcgtcgcgggtcacaaagttgatggcaacacccttcctaccg 1241

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 1240 aaacgaccactacgaccaatgcgatg 1215

---

>gb|AY109160.1| Zea mays PCO074340 mRNA sequence
          Length = 1609

 Score =  170 bits (86), Expect = 2e-39
 Identities = 137/154 (88%)
 Strand = Plus / Minus

                                                                        
Query: 233  atctagagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttc 292
            ||||||||||||||||||||||||||||| |||||||||| |  ||||||||||||| ||
Sbjct: 1351 atctagagaaggtcggcgacattggccggcagctcctcaacggtcacgttgtagaacctc 1292

                                                                        
Query: 293  tggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttc 352
            |||||||| |||||||| | ||| || || ||||||||||||||||||||||| ||||||
Sbjct: 1291 tggatgtcaaacagcattcgctcgtcgtcgcgggtgacgaagttgatggcaacacccttc 1232

                                              
Query: 353  ctcccgaaccgaccactacgaccaatgcgatgga 386
            || || |||||||||||||| || ||||| ||||
Sbjct: 1231 cttccaaaccgaccactacggccgatgcggtgga 1198

---

>gb|AY104966.1| Zea mays PCO149753 mRNA sequence
          Length = 1929

 Score =  170 bits (86), Expect = 2e-39
 Identities = 131/146 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| ||||| || ||||||||||| | ||||||||||||||||||||||
Sbjct: 1517 agaaggtcagcgacgttggcaggcagctcctcaatcaacacgttgtagaacttctggatg 1458

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            ||||||||||||| ||| || || ||||| || |||||||||||||| |||||||| |||
Sbjct: 1457 tcgaacagcatccgctcgtcgtcgcgggtcacaaagttgatggcaacacccttcctaccg 1398

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 1397 aaacgaccactacgaccaatgcgatg 1372

---

>gb|BT017457.1| Zea mays clone EL01N0407C01.c mRNA sequence
          Length = 645

 Score =  163 bits (82), Expect = 5e-37
 Identities = 136/154 (88%)
 Strand = Plus / Minus

                                                                       
Query: 233 atctagagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttc 292
           ||||||||||||||||||||||||||||| |||||||||| |  ||||||||||||| ||
Sbjct: 416 atctagagaaggtcggcgacattggccggcagctcctcaacggtcacgttgtagaacctc 357

                                                                       
Query: 293 tggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttc 352
           |||||||| |||||||||| ||  || || ||||||||||||||||||||||| || |||
Sbjct: 356 tggatgtcaaacagcatccgcttgtcgtcgcgggtgacgaagttgatggcaacacctttc 297

                                             
Query: 353 ctcccgaaccgaccactacgaccaatgcgatgga 386
           || || |||||||||||||| || ||||| ||||
Sbjct: 296 cttccaaaccgaccactacggccgatgcggtgga 263

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Plus

                                                                            
Query: 239      agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
                |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 28988291 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 28988350

                                                                            
Query: 299      tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
                || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 28988351 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 28988410

                                          
Query: 359      aaccgaccactacgaccaatgcgatg 384
                || |||||||||||||||||||||||
Sbjct: 28988411 aaacgaccactacgaccaatgcgatg 28988436

---

>dbj|AP003726.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0596H10
          Length = 166570

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Plus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 3278 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 3337

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 3338 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 3397

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 3398 aaacgaccactacgaccaatgcgatg 3423

---

>dbj|AP004278.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0468G03
          Length = 143918

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Plus

                                                                          
Query: 239    agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
              |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 138335 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 138394

                                                                          
Query: 299    tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
              || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 138395 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 138454

                                        
Query: 359    aaccgaccactacgaccaatgcgatg 384
              || |||||||||||||||||||||||
Sbjct: 138455 aaacgaccactacgaccaatgcgatg 138480

---

>dbj|AK119234.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-H08, full
            insert sequence
          Length = 1754

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 1378 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 1319

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 1318 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 1259

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 1258 aaacgaccactacgaccaatgcgatg 1233

---

>dbj|AK105454.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-D03, full
            insert sequence
          Length = 1677

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 1380 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 1321

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 1320 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 1261

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 1260 aaacgaccactacgaccaatgcgatg 1235

---

>dbj|AK099927.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116O09, full
            insert sequence
          Length = 1672

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 1374 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 1315

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 1314 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 1255

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 1254 aaacgaccactacgaccaatgcgatg 1229

---

>dbj|AK065230.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H10, full
            insert sequence
          Length = 1676

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 1379 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 1320

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 1319 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 1260

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 1259 aaacgaccactacgaccaatgcgatg 1234

---

>dbj|AK061696.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-C12, full
            insert sequence
          Length = 1498

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 1201 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 1142

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 1141 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 1082

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 1081 aaacgaccactacgaccaatgcgatg 1056

---

>gb|AF079782.1|AF079782 Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial
           cds
          Length = 844

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Minus

                                                                       
Query: 239 agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
           |||||||| ||||| ||||| || ||||||||||| | ||||||||||||||||||||||
Sbjct: 644 agaaggtcagcgacgttggcaggcagctcctcaatcaacacgttgtagaacttctggatg 585

                                                                       
Query: 299 tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
           ||||||||||||| ||| || || ||||| || |||||||||||||| |||||||| |||
Sbjct: 584 tcgaacagcatccgctcgtcgtcgcgggtcacaaagttgatggcaacacccttcctaccg 525

                                     
Query: 359 aaccgaccactacgaccaatgcgatg 384
           || ||||||||||||||||| |||||
Sbjct: 524 aaacgaccactacgaccaattcgatg 499

---

>dbj|D12627.1|RICEIF4A Oryza sativa (japonica cultivar-group) mRNA for eukaryotic initiation
            factor 4A, complete cds
          Length = 1549

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 1249 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 1190

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 1189 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 1130

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 1129 aaacgaccactacgaccaatgcgatg 1104

---

>dbj|AB046416.1| Oryza sativa eIF4A-1 gene for eukaryotic initiation factor 4A,
            complete cds
          Length = 6250

 Score =  163 bits (82), Expect = 5e-37
 Identities = 130/146 (89%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||| ||||||||
Sbjct: 5870 agaaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatg 5811

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || 
Sbjct: 5810 tcaaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctacca 5751

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 5750 aaacgaccactacgaccaatgcgatg 5725

---

>gb|AF007580.1|AF007580 Zea mays translation initiation factor (eIF-4A) mRNA, complete cds
          Length = 1752

 Score =  155 bits (78), Expect = 1e-34
 Identities = 129/146 (88%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| ||||| ||||| || ||||||||||| | ||||||||||||||||||||||
Sbjct: 1353 agaaggtcagcgacgttggcaggcagctcctcaatcaacacgttgtagaacttctggatg 1294

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            |||||||  |||| ||| || || ||||| || |||||||||||||| |||||||| |||
Sbjct: 1293 tcgaacacgatccgctcgtcgtcgcgggtcacaaagttgatggcaacacccttcctaccg 1234

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || |||||||||||||||||||||||
Sbjct: 1233 aaacgaccactacgaccaatgcgatg 1208

---

>gb|DQ013263.1| Pennisetum glaucum eukaryotic initiation factor 4A (eIF4A) mRNA,
            complete cds
          Length = 1245

 Score =  151 bits (76), Expect = 2e-33
 Identities = 130/148 (87%)
 Strand = Plus / Minus

                                                                        
Query: 237  agagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctgga 296
            |||||||||| || || |||| ||| ||||||||||| |||||| |||||||| ||||||
Sbjct: 1243 agagaaggtcagcaacgttggtcggcagctcctcaatcaccacgctgtagaacctctgga 1184

                                                                        
Query: 297  tgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcc 356
            |||| ||| ||||||| ||||| |||||||| || ||||| |||||||| |||||||| |
Sbjct: 1183 tgtcaaactgcatcctgtcatcatcacgggtcacaaagtttatggcaacacccttcctac 1124

                                        
Query: 357  cgaaccgaccactacgaccaatgcgatg 384
            |||| |||||||||||||||||||||||
Sbjct: 1123 cgaaacgaccactacgaccaatgcgatg 1096

---

>gb|U17979.1|ZMU17979 Zea mays translation initiation factor eIF-4A mRNA, complete cds
          Length = 1441

 Score =  147 bits (74), Expect = 3e-32
 Identities = 134/154 (87%)
 Strand = Plus / Minus

                                                                        
Query: 233  atctagagaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttc 292
            ||||||||||||||||||||||||||||| |||||||||| |  ||||||||||||| ||
Sbjct: 1312 atctagagaaggtcggcgacattggccggcagctcctcaacggtcacgttgtagaacctc 1253

                                                                        
Query: 293  tggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttc 352
            |||| ||| ||||  || | ||| || || ||||||||||||||||||||||| ||||||
Sbjct: 1252 tggacgtcaaacacgattcgctcgtcgtcgcgggtgacgaagttgatggcaacacccttc 1193

                                              
Query: 353  ctcccgaaccgaccactacgaccaatgcgatgga 386
            || || |||||||||||||| || ||||| ||||
Sbjct: 1192 cttccaaaccgaccactacggccgatgcggtgga 1159

---

>gb|BT016640.1| Zea mays clone Contig473 mRNA sequence
          Length = 1804

 Score =  123 bits (62), Expect = 4e-25
 Identities = 125/146 (85%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| || |||||||| || ||||||||||| | |||||||||||||||||| |||
Sbjct: 1369 agaaggtcagcaacattggcaggcagctcctcaatcaacacgttgtagaacttctgaatg 1310

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || |||||||| |  || || || ||||| || |||||||||||||| |||||||| || 
Sbjct: 1309 tcaaacagcatacgttcgtcgtcgcgggtcacaaagttgatggcaacacccttcctacca 1250

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || ||||||||||||||||| |||||
Sbjct: 1249 aaacgaccactacgaccaatacgatg 1224

---

>gb|U73459.1|ZMU73459 Zea mays translational initiation factor eIF-4A (tif-4A3) mRNA,
            complete cds
          Length = 1714

 Score =  115 bits (58), Expect = 1e-22
 Identities = 124/146 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            |||||||| || |||||||| || ||||||||||| | |||||||||||||||||| |||
Sbjct: 1349 agaaggtcagcaacattggcaggcagctcctcaatcaacacgttgtagaacttctgaatg 1290

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || |||||||| |  || |  || ||||| || |||||||||||||| |||||||| || 
Sbjct: 1289 tcaaacagcatacgttcgttgtcgcgggtcacaaagttgatggcaacacccttcctacca 1230

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || ||||||||||||||||| |||||
Sbjct: 1229 aaacgaccactacgaccaatacgatg 1204

---

>ref|NM_112246.2| Arabidopsis thaliana EIF4A1; ATP-dependent helicase AT3G13920
            (EIF4A1) transcript variant AT3G13920.1 mRNA, complete
            cds
          Length = 1761

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1342 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1283

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1282 ttgatcgcaacaccctttctcccgaacc 1255

---

>emb|X65052.1|ATTIF4A1 A.thaliana mRNA for eukaryotic translation initiation factor 4A-1
          Length = 1736

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1348 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1289

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1288 ttgatcgcaacaccctttctcccgaacc 1261

---

>gb|BT000655.1| Arabidopsis thaliana clone RAFL07-07-D14 (R10830) putative eukaryotic
            initiation factor 4A (At3g13920) mRNA, complete cds
          Length = 1702

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1342 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1283

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1282 ttgatcgcaacaccctttctcccgaacc 1255

---

>gb|AY091304.1| Arabidopsis thaliana putative eukaryotic initiation factor 4A
            (At3g13920) mRNA, complete cds
          Length = 1270

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1199 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1140

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1139 ttgatcgcaacaccctttctcccgaacc 1112

---

>gb|AY050957.1| Arabidopsis thaliana putative Eukaryotic initiation factor 4A
            (At3g13920) mRNA, complete cds
          Length = 1713

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1335 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1276

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1275 ttgatcgcaacaccctttctcccgaacc 1248

---

>emb|AJ298137.1|ATH298137 Arabidopsis thaliana eIF-4A1 gene for translation initiation factor
            eIF-4A1, exons 1-5 and gus gene for beta-glucuronidase
          Length = 11509

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 3171 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 3112

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 3111 ttgatcgcaacaccctttctcccgaacc 3084

---

>gb|AY139981.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 1713

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1341 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1282

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1281 ttgatcgcaacaccctttctcccgaacc 1254

---

>gb|AY098962.1| Arabidopsis thaliana AT3g13920/MDC16_4 mRNA, complete cds
          Length = 1239

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1199 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1140

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1139 ttgatcgcaacaccctttctcccgaacc 1112

---

>gb|AY081287.1| Arabidopsis thaliana eukaryotic translation initiation factor
            (At3g13920) mRNA, complete cds
          Length = 1611

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1342 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1283

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1282 ttgatcgcaacaccctttctcccgaacc 1255

---

>gb|AY052344.1| Arabidopsis thaliana AT3g13920/MDC16_4 mRNA, complete cds
          Length = 1620

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1331 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1272

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1271 ttgatcgcaacaccctttctcccgaacc 1244

---

>emb|BX825413.1|CNS0A6HS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL35ZD12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 620

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 275 accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
           ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 273 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 214

                                       
Query: 335 ttgatggcaactcccttcctcccgaacc 362
           ||||| ||||| ||||| ||||||||||
Sbjct: 213 ttgatcgcaacaccctttctcccgaacc 186

---

>emb|BX826218.1|CNS0A6AB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL91ZF06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 965

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 275 accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
           ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 594 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 535

                                       
Query: 335 ttgatggcaactcccttcctcccgaacc 362
           ||||| ||||| ||||| ||||||||||
Sbjct: 534 ttgatcgcaacaccctttctcccgaacc 507

---

>gb|AY086907.1| Arabidopsis thaliana clone 29310 mRNA, complete sequence
          Length = 1613

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1342 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1283

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1282 ttgatcgcaacaccctttctcccgaacc 1255

---

>dbj|AB019229.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC16
          Length = 84294

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Plus

                                                                         
Query: 275   accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
             ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 17985 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 18044

                                         
Query: 335   ttgatggcaactcccttcctcccgaacc 362
             ||||| ||||| ||||| ||||||||||
Sbjct: 18045 ttgatcgcaacaccctttctcccgaacc 18072

---

>emb|AJ298138.1|ATH298138 Arabidopsis thaliana mRNA for translation initiation factor eIF-4A1
            (eIF-4A1 gene)
          Length = 1709

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                        
Query: 275  accacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 334
            ||||| |||||||| ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1325 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1266

                                        
Query: 335  ttgatggcaactcccttcctcccgaacc 362
            ||||| ||||| ||||| ||||||||||
Sbjct: 1265 ttgatcgcaacaccctttctcccgaacc 1238

---

>gb|BT013166.1| Lycopersicon esculentum clone 134229F, mRNA sequence
          Length = 1603

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 251  acattggccgggagctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatc 310
            |||||||| ||||||||||| || || |||||||| ||||| || ||||| || ||||||
Sbjct: 1363 acattggctgggagctcctcgattacgacgttgtaaaacttttgaatgtcaaaaagcatc 1304

                                                                        
Query: 311  ctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccacta 370
            || ||||| ||   ||| || |||||||| ||||| |||||||| || || || ||||||
Sbjct: 1303 ctttcatcatccttggtaacaaagttgatagcaacacccttccttccaaatcgtccacta 1244

                          
Query: 371  cgaccaatgcgatg 384
            |||||||| |||||
Sbjct: 1243 cgaccaatacgatg 1230

---

>emb|X79138.1|NT4A15 N.tabacum NeIF-4A15 mRNA
          Length = 1644

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                        
Query: 263  agctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatcctctcatcttca 322
            ||||||||||| || |||||||| ||| |||| || ||  |||||||||||||||| || 
Sbjct: 1293 agctcctcaataacaacgttgtaaaacctctgaatatcagacagcatcctctcatcatcc 1234

                                                                        
Query: 323  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 382
               || |||||||||||||| || |||||||| || ||||| |||||||| |||||||||
Sbjct: 1233 tttgtaacgaagttgatggccacacccttcctaccaaaccgtccactacgtccaatgcga 1174

              
Query: 383  tg 384
            ||
Sbjct: 1173 tg 1172

---

>emb|X79135.1|NT4A9 N.tabacum NeIF-4A9 mRNA
          Length = 1598

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 251  acattggccgggagctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatc 310
            ||||| || |||||||||||||| ||||| ||||| ||| |||| |||||  ||||||| 
Sbjct: 1314 acatttgctgggagctcctcaatcaccacattgtaaaacctctgaatgtcagacagcatt 1255

                                                                        
Query: 311  ctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccacta 370
            |||||||| || | ||| ||||||||||| | ||| |||||||| || ||||  ||||||
Sbjct: 1254 ctctcatcgtcgctggttacgaagttgattgaaacacccttcctaccaaacctcccacta 1195

                          
Query: 371  cgaccaatgcgatg 384
            || ||||| |||||
Sbjct: 1194 cgtccaatacgatg 1181

---

>gb|AY040227.1| Elaeis oleifera eukaryotic translation initiation factor 4A-1 mRNA,
           partial cds
          Length = 785

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 gggagctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatcctctcatct 319
           ||||||||||| || ||||||||||| ||| |||| || || |||| |||||| ||||| 
Sbjct: 499 gggagctcctcgatcaccacgttgtaaaacctctgaatatcaaacaacatcctttcatca 440

                                              
Query: 320 tcacgggtgacgaagttgatggcaactcccttcct 354
           ||||| ||||| |||||||| || || ||||||||
Sbjct: 439 tcacgagtgacaaagttgatcgccacacccttcct 405

---

>ref|NM_001035616.1| Arabidopsis thaliana EIF4A1; ATP-dependent helicase AT3G13920
            (EIF4A1) transcript variant AT3G13920.2 mRNA, complete
            cds
          Length = 1764

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 305  agcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaacc 362
            |||||||||||||| |||||||| ||||| ||||| ||||| ||||| ||||||||||
Sbjct: 1355 agcatcctctcatcatcacgggtcacgaaattgatcgcaacaccctttctcccgaacc 1298

---

>gb|AY167670.1| Pisum sativum DEAD box RNA helicase mRNA, complete cds
          Length = 1646

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 101/124 (81%)
 Strand = Plus / Minus

                                                                        
Query: 263  agctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatcctctcatcttca 322
            ||||||||||| | ||| ||||||||||||||||||||   |||||| || ||||| || 
Sbjct: 1361 agctcctcaatcaacacattgtagaacttctggatgtcacccagcattctttcatcatcc 1302

                                                                        
Query: 323  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 382
               ||||| ||||| || ||||| || ||||| || ||||  |||||||||||||| |||
Sbjct: 1301 ttcgtgacaaagttaattgcaacacctttcctaccaaaccttccactacgaccaatacga 1242

                
Query: 383  tgga 386
            ||||
Sbjct: 1241 tgga 1238

---

>gb|AY513583.1| Pisum sativum DEAD box RNA helicase gene, complete cds
          Length = 2216

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 101/124 (81%)
 Strand = Plus / Minus

                                                                        
Query: 263  agctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatcctctcatcttca 322
            ||||||||||| | ||| ||||||||||||||||||||   |||||| || ||||| || 
Sbjct: 2188 agctcctcaatcaacacattgtagaacttctggatgtcacccagcattctttcatcatcc 2129

                                                                        
Query: 323  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 382
               ||||| ||||| || ||||| || ||||| || ||||  |||||||||||||| |||
Sbjct: 2128 ttcgtgacaaagttaattgcaacacctttcctaccaaaccttccactacgaccaatacga 2069

                
Query: 383  tgga 386
            ||||
Sbjct: 2068 tgga 2065

---

>emb|X79009.1|NTEIF4A1 N.tabacum eIF-4A10 mRNA
          Length = 1622

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 113/140 (80%)
 Strand = Plus / Minus

                                                                        
Query: 245  tcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatgtcgaac 304
            ||||| |||||||| || | |||||| ||||| || || || |||||||| |||||  | 
Sbjct: 1328 tcggccacattggctggcaactcctcgatgacaacattataaaacttctgaatgtcagaa 1269

                                                                        
Query: 305  agcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccga 364
            |||||||| ||||| ||    ||||| |||||||| ||||| |||||||| || || || 
Sbjct: 1268 agcatcctttcatcatcctttgtgacaaagttgatagcaacacccttccttccaaaacgt 1209

                                
Query: 365  ccactacgaccaatgcgatg 384
            |||||||||||||| |||||
Sbjct: 1208 ccactacgaccaatacgatg 1189

---

>emb|X79008.1|NTEIF4A1D N.tabacum eIF-4A10 gene
          Length = 4217

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 113/140 (80%)
 Strand = Plus / Minus

                                                                        
Query: 245  tcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatgtcgaac 304
            ||||| |||||||| || | |||||| ||||| || || || |||||||| |||||  | 
Sbjct: 3951 tcggccacattggctggcaactcctcgatgacaacattataaaacttctgaatgtcagaa 3892

                                                                        
Query: 305  agcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccga 364
            |||||||| ||||| ||    ||||| |||||||| ||||| |||||||| || || || 
Sbjct: 3891 agcatcctttcatcatcctttgtgacaaagttgatagcaacacccttccttccaaaacgt 3832

                                
Query: 365  ccactacgaccaatgcgatg 384
            |||||||||||||| |||||
Sbjct: 3831 ccactacgaccaatacgatg 3812

---

>emb|X79139.1|NT4A6 N.tabacum NeIF-4A6 mRNA
          Length = 760

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 108/134 (80%)
 Strand = Plus / Minus

                                                                       
Query: 251 acattggccgggagctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatc 310
           |||||||| || ||||||||||| || || || || ||||| || ||||| || ||||||
Sbjct: 749 acattggctggcagctcctcaatcacgacattataaaacttttgtatgtcaaaaagcatc 690

                                                                       
Query: 311 ctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccacta 370
           || || || ||   |||||| |||||||| | ||| |||||||| || || || ||||||
Sbjct: 689 ctttcgtcatccttggtgacaaagttgatagaaacacccttccttccaaatcggccacta 630

                         
Query: 371 cgaccaatgcgatg 384
           |||||||| |||||
Sbjct: 629 cgaccaatacgatg 616

---

>gb|AC174465.2| Medicago truncatula chromosome 2 BAC clone mth2-189f20, complete
             sequence
          Length = 90320

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 99/122 (81%)
 Strand = Plus / Plus

                                                                         
Query: 263   agctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatcctctcatcttca 322
             ||||||||||| | ||| ||||||||||||||||||||   |||||| || || || |||
Sbjct: 36810 agctcctcaatcaacacattgtagaacttctggatgtcactcagcattctttcgtcatca 36869

                                                                         
Query: 323   cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 382
                ||||| ||||| || ||||| || ||||| || ||||  |||||||||||||| |||
Sbjct: 36870 gttgtgacaaagttaatagcaacacctttccttccaaaccttccactacgaccaatacga 36929

               
Query: 383   tg 384
             ||
Sbjct: 36930 tg 36931

---

>ref|XM_743008.1| Aspergillus fumigatus Af293 DEAD/DEAH box helicase (Afu5g02410)
            partial mRNA
          Length = 1518

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 326  gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||||| || ||||| || ||||| |||||||| ||||||||
Sbjct: 1361 gtgacgaagttgatggcgacaccctttcttccgaaacgaccacttcgaccaat 1309

---

>ref|XM_459136.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0D16423g)
            partial mRNA
          Length = 1194

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 326  gtgacgaagttgatggcaactcccttcctcccgaaccgaccac 368
            |||||||||||||||||||| ||||| || ||||| |||||||
Sbjct: 1100 gtgacgaagttgatggcaacaccctttctaccgaaacgaccac 1058

---

>gb|U13876.3| Caenorhabditis elegans cosmid F57B9, complete sequence
          Length = 39112

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 325  ggtgacgaagttgatggcaactccctt 351
            |||||||||||||||||||||||||||
Sbjct: 7330 ggtgacgaagttgatggcaactccctt 7304

---

>emb|Z12116.1|CEEIF4AM C.elegans mRNA for eIF-4A homologue
          Length = 1611

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 325  ggtgacgaagttgatggcaactccctt 351
            |||||||||||||||||||||||||||
Sbjct: 1183 ggtgacgaagttgatggcaactccctt 1157

---

>emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS767 of Debaryomyces
               hansenii
          Length = 1602771

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                          
Query: 326     gtgacgaagttgatggcaactcccttcctcccgaaccgaccac 368
               |||||||||||||||||||| ||||| || ||||| |||||||
Sbjct: 1255568 gtgacgaagttgatggcaacaccctttctaccgaaacgaccac 1255610

---

>emb|AJ320155.1|TGO320155 Toxoplasma gondii mRNA for eukaryotic translation initiation factor
            4A (toif4A gene)
          Length = 2346

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 332  aagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            |||||||||||||| |||||||| ||||| ||||||  |||||||||
Sbjct: 1412 aagttgatggcaacacccttcctaccgaaacgaccagaacgaccaat 1366

---

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 329    acgaagttgatggcaactcccttcctcccgaaccgaccactacgacc 375
              |||||||||||||| || |||||||| ||||| ||||| ||||||||
Sbjct: 974129 acgaagttgatggcgacacccttccttccgaaacgaccgctacgacc 974175

---

>ref|NM_001027453.1| Caenorhabditis elegans INitiation Factor family member (inf-1)
            (inf-1) mRNA, complete cds
          Length = 1584

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 325  ggtgacgaagttgatggcaactccctt 351
            |||||||||||||||||||||||||||
Sbjct: 1171 ggtgacgaagttgatggcaactccctt 1145

---

>ref|NM_001027452.1| Caenorhabditis elegans INitiation Factor family member (inf-1)
            (inf-1) mRNA, complete cds
          Length = 1675

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 325  ggtgacgaagttgatggcaactccctt 351
            |||||||||||||||||||||||||||
Sbjct: 1217 ggtgacgaagttgatggcaactccctt 1191

---

>ref|XM_749705.1| Aspergillus fumigatus Af293 eukaryotic translation initiation factor
            eIF4A (Afu3g08160) partial mRNA
          Length = 1221

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 326  gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgacc 375
            |||||||||||||||||||| ||||| |  ||||| ||||||| ||||||
Sbjct: 1106 gtgacgaagttgatggcaacacccttacgaccgaaacgaccaccacgacc 1057

---

>gb|AC166553.2| Nectria haematococca clone JGIAYWI-9O2, complete sequence
          Length = 38247

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                   
Query: 325   ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
             |||||| |||||||||||||| ||||| |  ||||| ||||||| |||||||||
Sbjct: 11563 ggtgacaaagttgatggcaacgccctttcggccgaaacgaccaccacgaccaat 11510

---

>ref|XM_501158.1| Yarrowia lipolytica CLIB122, YALI0B20922g predicted mRNA
          Length = 1188

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 384
            ||||||||||||||||||||| ||||| |  ||||| || ||||  |||||||| |||||
Sbjct: 1098 ggtgacgaagttgatggcaacaccctttcggccgaatcgtccacctcgaccaattcgatg 1039

              
Query: 385  ga 386
            ||
Sbjct: 1038 ga 1037

---

>emb|X79136.1|NT4A11 N.tabacum NeIF-4A11 mRNA
          Length = 1573

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                        
Query: 263  agctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatcctctcatcttca 322
            ||||||||||| || || || || ||||| || ||||| || |||||||| ||||| || 
Sbjct: 1235 agctcctcaatcacgacattataaaacttttgtatgtcaaaaagcatcctttcatcatcc 1176

                                                                        
Query: 323  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 382
              |||||| |||||||| | ||| |||||||| || || || |||||| ||||||| |||
Sbjct: 1175 ttggtgacaaagttgatagaaacacccttccttccaaatcggccactatgaccaatacga 1116

              
Query: 383  tg 384
            ||
Sbjct: 1115 tg 1114

---

>emb|X79137.1|NT4A7 N.tabacum NeIF-4A7 mRNA
          Length = 1634

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                      
Query: 327  tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 384
            |||| |||||||| ||||| |||||||| || || || |||||||||||||| |||||
Sbjct: 1255 tgacaaagttgatagcaacacccttccttccaaatcgtccactacgaccaatacgatg 1198

---

>dbj|AB224877.1| Aspergillus oryzae cDNA, contig sequence: AoEST1727
          Length = 791

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 326 gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgacc 375
           |||||||||||||||||||| ||||| |  ||||| ||||||| ||||||
Sbjct: 178 gtgacgaagttgatggcaacacccttacgaccgaaacgaccaccacgacc 129

---

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                 
Query: 326     gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgacc 375
               |||||||||||||||||||| ||||| |  ||||| ||||||| ||||||
Sbjct: 3870276 gtgacgaagttgatggcaacacccttacgaccgaaacgaccaccacgacc 3870227

---

>gb|AY158704.1| Apium graveolens var. dulce translation initition factor eIF4A
           mRNA, partial cds
          Length = 539

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 251 acattggccgggagctcctcaatgaccacgttgtagaacttctggatgtcgaacagcatc 310
           |||||||| || | ||||||||  || || ||||| |||||||| ||||| |||||||||
Sbjct: 536 acattggctggcaactcctcaactactacattgtaaaacttctgtatgtcaaacagcatc 477

                                                                       
Query: 311 ctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccacta 370
           || ||||| ||   ||| || || || || ||||| || ||||| || || |||||||||
Sbjct: 476 ctatcatcatccttggtcacaaaattaattgcaacacctttccttccaaatcgaccacta 417

                         
Query: 371 cgaccaatgcgatg 384
           || ||||| |||||
Sbjct: 416 cgcccaatacgatg 403

---

>gb|AF180356.1|AF180356 Brassica oleracea isolate B265 EIF4A protein (EIF4A) gene, partial
            cds; putative protein gene, complete cds; and casein
            kinase I-like protein (CK1b) gene, partial cds
          Length = 6639

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 77/94 (81%)
 Strand = Plus / Minus

                                                                        
Query: 269  tcaatgaccacgttgtagaacttctggatgtcgaacagcatcctctcatcttcacgggtg 328
            |||| |||||| ||||| |||||||| || ||  ||| |||||||||||| |||   || 
Sbjct: 1326 tcaacgaccacattgtaaaacttctgaatatccgacaacatcctctcatcatcagttgtc 1267

                                              
Query: 329  acgaagttgatggcaactcccttcctcccgaacc 362
            | ||||||||| || |||||||||||||| ||||
Sbjct: 1266 atgaagttgatcgccactcccttcctcccaaacc 1233

---

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                           
Query: 325     ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 384
               ||||||||||||||||||||| ||||| |  ||||| || ||||  |||||||| |||||
Sbjct: 2754636 ggtgacgaagttgatggcaacaccctttcggccgaatcgtccacctcgaccaattcgatg 2754577

                 
Query: 385     ga 386
               ||
Sbjct: 2754576 ga 2754575

---

>emb|X61205.1|NPNEIF4A2 N. plumbaginifolia NeIF-4A2 mRNA for nicotiana eukaryotic translation
            initiation factor 4A
          Length = 1368

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 333  agttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 384
            ||||||| ||||| |||||||| || || || |||||||||||||| |||||
Sbjct: 1260 agttgatagcaacacccttccttccaaaacgtccactacgaccaatacgatg 1209

---

>ref|XM_953328.1| Neurospora crassa OR74A EUKARYOTIC INITIATION FACTOR 4A (EIF-4A)
            (EIF4A) (NCU07420.1) partial mRNA
          Length = 1278

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgacc 375
            ||||||||||||||| ||||| ||||| |  ||||| ||||||| ||||||
Sbjct: 1188 ggtgacgaagttgatcgcaacacccttacgaccgaaacgaccaccacgacc 1138

---

>ref|XM_327705.1| Neurospora crassa OR74A EUKARYOTIC INITIATION FACTOR 4A (EIF-4A)
            (EIF4A) (NCU07420.1) partial mRNA
          Length = 1278

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgacc 375
            ||||||||||||||| ||||| ||||| |  ||||| ||||||| ||||||
Sbjct: 1188 ggtgacgaagttgatcgcaacacccttacgaccgaaacgaccaccacgacc 1138

---

>ref|XM_713323.1| Candida albicans SC5314 putative translation initiation factor eIF4A
            subunit (CaO19_10834), mRNA
          Length = 1194

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 326  gtgacgaagttgatggcaactcccttcctcccgaaccgaccac 368
            ||||| |||||||||||||| ||||| || ||||| |||||||
Sbjct: 1100 gtgacaaagttgatggcaaccccctttctaccgaaacgaccac 1058

---

>ref|XM_713054.1| Candida albicans SC5314 putative translation initiation factor eIF4A
            subunit (CaO19_3324), mRNA
          Length = 1194

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 326  gtgacgaagttgatggcaactcccttcctcccgaaccgaccac 368
            ||||| |||||||||||||| ||||| || ||||| |||||||
Sbjct: 1100 gtgacaaagttgatggcaaccccctttctaccgaaacgaccac 1058

---

>gb|AY428601.1| Helianthus annuus clone HA24-15A initiation factor eIF4A-15 mRNA,
            complete cds
          Length = 1525

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 254  ttggccgggagctcctcaatgaccacgttgtagaacttctggatgtc 300
            |||| ||| |||||||||| ||| || ||||| ||||||||||||||
Sbjct: 1333 ttggacggcagctcctcaacgacaacattgtaaaacttctggatgtc 1287

---

>emb|AJ245475.1|PCY245475 Plasmodium cynomolgi gene for RNA helicase-1
          Length = 1753

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 325  ggtgacgaagttgatggcaactccctt 351
            |||||| ||||||||||||||||||||
Sbjct: 1521 ggtgacaaagttgatggcaactccctt 1495

---

>emb|BX053338.1|CNS09DBI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 194 ggtgacgaagttgatagcaactccctt 220

---

>emb|BX020719.1|CNS08O5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 464

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 379 ggtgacgaagttgatagcaactccctt 353

---

>emb|BX072009.1|CNS09RQ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 211 ggtgacgaagttgatagcaactccctt 237

---

>emb|BX071180.1|CNS09R34 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 566

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 205 ggtgacgaagttgatagcaactccctt 231

---

>emb|BX069140.1|CNS09PIG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 716 ggtgacgaagttgatagcaactccctt 690

---

>emb|BX068966.1|CNS09PDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 244 ggtgacgaagttgatagcaactccctt 270

---

>emb|BX065544.1|CNS09MQK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 201 ggtgacgaagttgatagcaactccctt 227

---

>emb|BX065406.1|CNS09MMQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 189 ggtgacgaagttgatagcaactccctt 215

---

>emb|BX064751.1|CNS09M4J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 416 ggtgacgaagttgatagcaactccctt 390

---

>emb|BX063777.1|CNS09LDH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 753 ggtgacgaagttgatagcaactccctt 779

---

>emb|BX063717.1|CNS09LBT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 149 ggtgacgaagttgatagcaactccctt 175

---

>emb|BX062174.1|CNS09K4Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 197 ggtgacgaagttgatagcaactccctt 223

---

>emb|BX060629.1|CNS09IY1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 196 ggtgacgaagttgatagcaactccctt 222

---

>emb|BX059812.1|CNS09IBC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 772 ggtgacgaagttgatagcaactccctt 798

---

>emb|BX059694.1|CNS09I82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 747 ggtgacgaagttgatagcaactccctt 773

---

>emb|BX059458.1|CNS09I1I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 844 ggtgacgaagttgatagcaactccctt 870

---

>emb|BX059457.1|CNS09I1H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 484 ggtgacgaagttgatagcaactccctt 458

---

>emb|BX059385.1|CNS09HZH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 210 ggtgacgaagttgatagcaactccctt 236

---

>emb|BX056724.1|CNS09FXK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 411

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 226 ggtgacgaagttgatagcaactccctt 252

---

>emb|BX057426.1|CNS09GH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 371

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 190 ggtgacgaagttgatagcaactccctt 216

---

>emb|BX057122.1|CNS09G8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 485

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 202 ggtgacgaagttgatagcaactccctt 228

---

>emb|BX056400.1|CNS09FOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 225 ggtgacgaagttgatagcaactccctt 251

---

>emb|BX055630.1|CNS09F36 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 461

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 128 ggtgacgaagttgatagcaactccctt 102

---

>emb|BX053169.1|CNS09D6T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 442

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 197 ggtgacgaagttgatagcaactccctt 223

---

>emb|BX053903.1|CNS09DR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 224 ggtgacgaagttgatagcaactccctt 250

---

>emb|BX052194.1|CNS09CFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 74  ggtgacgaagttgatagcaactccctt 48

---

>emb|BX031051.1|CNS08W4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 216 ggtgacgaagttgatagcaactccctt 242

---

>emb|BX048647.1|CNS099P7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 606

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 194 ggtgacgaagttgatagcaactccctt 220

---

>emb|BX046371.1|CNS097XZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 838 ggtgacgaagttgatagcaactccctt 864

---

>emb|BX046370.1|CNS097XY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 485 ggtgacgaagttgatagcaactccctt 459

---

>emb|BX044775.1|CNS096PN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 102 ggtgacgaagttgatagcaactccctt 76

---

>emb|BX043299.1|CNS095KN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 760 ggtgacgaagttgatagcaactccctt 786

---

>emb|BX042604.1|CNS0951C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 530

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 190 ggtgacgaagttgatagcaactccctt 216

---

>emb|BX042533.1|CNS094ZD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 562

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 208 ggtgacgaagttgatagcaactccctt 234

---

>emb|BX039496.1|CNS092N0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC1BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 868 ggtgacgaagttgatagcaactccctt 894

---

>emb|BX037324.1|CNS090YO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 190 ggtgacgaagttgatagcaactccctt 216

---

>emb|BX037318.1|CNS090YI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 213 ggtgacgaagttgatagcaactccctt 239

---

>emb|BX036647.1|CNS090FV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 204 ggtgacgaagttgatagcaactccctt 230

---

>emb|BX036646.1|CNS090FU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 827 ggtgacgaagttgatagcaactccctt 801

---

>emb|BX036940.1|CNS090O0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 199 ggtgacgaagttgatagcaactccctt 225

---

>emb|BX036785.1|CNS090JP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 825 ggtgacgaagttgatagcaactccctt 799

---

>emb|BX036205.1|CNS0903L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 220 ggtgacgaagttgatagcaactccctt 246

---

>emb|BX034459.1|CNS08YR3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 196 ggtgacgaagttgatagcaactccctt 222

---

>emb|BX034458.1|CNS08YR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 980 ggtgacgaagttgatagcaactccctt 954

---

>emb|BX033621.1|CNS08Y3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 195 ggtgacgaagttgatagcaactccctt 221

---

>emb|BX033102.1|CNS08XPE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 199 ggtgacgaagttgatagcaactccctt 225

---

>emb|BX032924.1|CNS08XKG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 205 ggtgacgaagttgatagcaactccctt 231

---

>emb|BX032131.1|CNS08WYF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 187 ggtgacgaagttgatagcaactccctt 213

---

>emb|BX031809.1|CNS08WPH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 757 ggtgacgaagttgatagcaactccctt 783

---

>emb|BX031808.1|CNS08WPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 700 ggtgacgaagttgatagcaactccctt 674

---

>emb|BX030042.1|CNS08VCE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 199 ggtgacgaagttgatagcaactccctt 225

---

>emb|BX029879.1|CNS08V7V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 537 ggtgacgaagttgatagcaactccctt 563

---

>emb|BX029861.1|CNS08V7D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 203 ggtgacgaagttgatagcaactccctt 229

---

>emb|BX029784.1|CNS08V58 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 196 ggtgacgaagttgatagcaactccctt 222

---

>emb|BX028816.1|CNS08UEC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 194 ggtgacgaagttgatagcaactccctt 220

---

>emb|BX022396.1|CNS08PG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 199 ggtgacgaagttgatagcaactccctt 225

---

>emb|BX027810.1|CNS08TME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 804 ggtgacgaagttgatagcaactccctt 830

---

>emb|BX027601.1|CNS08TGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 204 ggtgacgaagttgatagcaactccctt 230

---

>emb|BX027600.1|CNS08TGK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 901 ggtgacgaagttgatagcaactccctt 875

---

>emb|BX027436.1|CNS08TC0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 422

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 211 ggtgacgaagttgatagcaactccctt 237

---

>emb|BX027282.1|CNS08T7Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 909 ggtgacgaagttgatagcaactccctt 935

---

>emb|BX027281.1|CNS08T7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 779 ggtgacgaagttgatagcaactccctt 753

---

>emb|BX026858.1|CNS08SVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 207 ggtgacgaagttgatagcaactccctt 233

---

>emb|BX026427.1|CNS08SJZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 183 ggtgacgaagttgatagcaactccctt 209

---

>emb|BX025947.1|CNS08S6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 446 ggtgacgaagttgatagcaactccctt 472

---

>emb|BX025946.1|CNS08S6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 456 ggtgacgaagttgatagcaactccctt 430

---

>emb|BX025156.1|CNS08RKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 206 ggtgacgaagttgatagcaactccctt 232

---

>emb|BX025018.1|CNS08RGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 535

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 213 ggtgacgaagttgatagcaactccctt 239

---

>emb|BX022818.1|CNS08PRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 192 ggtgacgaagttgatagcaactccctt 218

---

>emb|BX022573.1|CNS08PKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 528

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 207 ggtgacgaagttgatagcaactccctt 233

---

>emb|BX022178.1|CNS08P9Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 789

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 200 ggtgacgaagttgatagcaactccctt 226

---

>emb|BX021274.1|CNS08OKU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 463 ggtgacgaagttgatagcaactccctt 437

---

>emb|BX020936.1|CNS08OBG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 116 ggtgacgaagttgatagcaactccctt 142

---

>emb|BX020450.1|CNS08NXY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 192 ggtgacgaagttgatagcaactccctt 218

---

>emb|BX020352.1|CNS08NV8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 200 ggtgacgaagttgatagcaactccctt 226

---

>emb|BX019825.1|CNS08NGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 206 ggtgacgaagttgatagcaactccctt 232

---

>emb|BX019528.1|CNS08N8C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 211 ggtgacgaagttgatagcaactccctt 237

---

>emb|BX018864.1|CNS08MPW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 197 ggtgacgaagttgatagcaactccctt 223

---

>emb|BX017199.1|CNS08LFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 201 ggtgacgaagttgatagcaactccctt 227

---

>emb|BX016787.1|CNS08L47 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 318

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 180 ggtgacgaagttgatagcaactccctt 206

---

>emb|BX016260.1|CNS08KPK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 778 ggtgacgaagttgatagcaactccctt 804

---

>emb|BX016088.1|CNS08KKS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 531 ggtgacgaagttgatagcaactccctt 557

---

>emb|BX014705.1|CNS08JID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 806 ggtgacgaagttgatagcaactccctt 832

---

>emb|BX014550.1|CNS08JE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 531 ggtgacgaagttgatagcaactccctt 557

---

>emb|BX014495.1|CNS08JCJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 212 ggtgacgaagttgatagcaactccctt 238

---

>emb|BX013937.1|CNS08IX1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20DG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 207 ggtgacgaagttgatagcaactccctt 233

---

>emb|BX012572.1|CNS08HV4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 209 ggtgacgaagttgatagcaactccctt 235

---

>emb|BX012352.1|CNS08HP0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 218 ggtgacgaagttgatagcaactccctt 244

---

>emb|BX011160.1|CNS08GRW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 212 ggtgacgaagttgatagcaactccctt 238

---

>emb|BX010574.1|CNS08GBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 929 ggtgacgaagttgatagcaactccctt 903

---

>emb|BX008147.1|CNS08EG7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 860 ggtgacgaagttgatagcaactccctt 886

---

>emb|BX008146.1|CNS08EG6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 879 ggtgacgaagttgatagcaactccctt 853

---

>emb|BX007853.1|CNS08E81 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 593

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 49  ggtgacgaagttgatagcaactccctt 23

---

>emb|BX006955.1|CNS08DJ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 202 ggtgacgaagttgatagcaactccctt 228

---

>emb|BX006592.1|CNS08D90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 202 ggtgacgaagttgatagcaactccctt 228

---

>emb|BX005821.1|CNS08CNL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 191 ggtgacgaagttgatagcaactccctt 217

---

>emb|BX005626.1|CNS08CI6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 260

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 325 ggtgacgaagttgatggcaactccctt 351
           ||||||||||||||| |||||||||||
Sbjct: 194 ggtgacgaagttgatagcaactccctt 220

---

>ref|XM_318978.2| Anopheles gambiae str. PEST ENSANGP00000014802 (ENSANGG00000012313),
            mRNA
          Length = 2046

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 325  ggtgacgaagttgatggcaactccctt 351
            ||||||||||||||| |||||||||||
Sbjct: 1168 ggtgacgaagttgatagcaactccctt 1142

---

>ref|XM_318977.2| Anopheles gambiae str. PEST ENSANGP00000023201 (ENSANGG00000012313),
            mRNA
          Length = 2088

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 325  ggtgacgaagttgatggcaactccctt 351
            ||||||||||||||| |||||||||||
Sbjct: 1210 ggtgacgaagttgatagcaactccctt 1184

---

>dbj|D84472.1| Candida albicans DNA for translation initiation factor, complete cds
          Length = 1901

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 326  gtgacgaagttgatggcaactcccttcctcccgaaccgaccac 368
            ||||| |||||||||||||| ||||| || ||||| |||||||
Sbjct: 1544 gtgacaaagttgatggcaaccccctttctaccgaaacgaccac 1502

---

>ref|XM_361955.1| Magnaporthe grisea 70-15 hypothetical protein (MG04400.4) partial cds
          Length = 1278

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            |||||||||||| ||||| || ||||| |  ||||| ||||||| |||||||||
Sbjct: 1188 ggtgacgaagttaatggcgacaccctttcggccgaaacgaccaccacgaccaat 1135

---

>ref|XM_387017.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG06841.1)
           partial mRNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 325 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
           |||||||||||| ||||| || ||||| |  ||||| ||||||| |||||||||
Sbjct: 660 ggtgacgaagttaatggcgacaccctttcggccgaaacgaccaccacgaccaat 607

---

>ref|XM_447438.1| Candida glabrata CBS138 hypothetical protein (CAGL0I04356g) partial
            mRNA
          Length = 1191

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 331  gaagttgatggcaactcccttcctcccgaaccgaccac 368
            ||||||||||||||| ||||| || ||||| |||||||
Sbjct: 1092 gaagttgatggcaacaccctttctaccgaaacgaccac 1055

---

>emb|CR733641.2|CNS0GSUW Tetraodon nigroviridis full-length cDNA
          Length = 1787

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1053 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1000

---

>emb|CR732658.2|CNS0GS9J Tetraodon nigroviridis full-length cDNA
          Length = 1892

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1158 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1105

---

>emb|CR729762.2|CNS0GQ14 Tetraodon nigroviridis full-length cDNA
          Length = 1530

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1169 ggtgacgaagttgatagcaacgcctttactgccaaaacgaccaccacgaccaat 1116

---

>emb|CR727356.2|CNS0GO6A Tetraodon nigroviridis full-length cDNA
          Length = 1907

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1173 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1120

---

>emb|CR726855.2|CNS0GNSD Tetraodon nigroviridis full-length cDNA
          Length = 1908

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1176 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1123

---

>emb|CR723590.2|CNS0GL9O Tetraodon nigroviridis full-length cDNA
          Length = 1909

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1174 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1121

---

>emb|CR723240.2|CNS0GKZY Tetraodon nigroviridis full-length cDNA
          Length = 1894

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1168 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1115

---

>emb|CR717586.2|CNS0GGMW Tetraodon nigroviridis full-length cDNA
          Length = 618

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 325 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
           ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 96  ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 43

---

>emb|CR717504.2|CNS0GGKM Tetraodon nigroviridis full-length cDNA
          Length = 1432

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1049 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 996

---

>emb|CR704662.1|CNS0G6O2 Tetraodon nigroviridis full-length cDNA
          Length = 1878

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1160 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1107

---

>emb|CR695759.2|CNS0FZSR Tetraodon nigroviridis full-length cDNA
          Length = 995

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 325 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
           ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 266 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 213

---

>emb|CR694040.2|CNS0FYH0 Tetraodon nigroviridis full-length cDNA
          Length = 1864

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1164 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1111

---

>emb|CR685642.2|CNS0FRZQ Tetraodon nigroviridis full-length cDNA
          Length = 1900

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1167 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1114

---

>emb|CR680509.2|CNS0FO15 Tetraodon nigroviridis full-length cDNA
          Length = 919

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 325 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
           ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 536 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 483

---

>emb|CR680074.2|CNS0FNP2 Tetraodon nigroviridis full-length cDNA
          Length = 1511

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1174 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1121

---

>emb|CR674054.2|CNS0FJ2K Tetraodon nigroviridis full-length cDNA
          Length = 1832

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1110 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1057

---

>emb|CR670075.2|CNS0FG01 Tetraodon nigroviridis full-length cDNA
          Length = 1419

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1047 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 994

---

>emb|CR667409.2|CNS0FDXZ Tetraodon nigroviridis full-length cDNA
          Length = 1556

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1174 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1121

---

>emb|CR644829.2|CNS0EWIR Tetraodon nigroviridis full-length cDNA
          Length = 1879

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            ||||||||||||||| ||||| || || || || || ||||||| |||||||||
Sbjct: 1157 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaat 1104

---

>emb|X79141.1|NT4A14 N.tabacum NeIF-4A14 mRNA
          Length = 1677

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 115/146 (78%)
 Strand = Plus / Minus

                                                                        
Query: 239  agaaggtcggcgacattggccgggagctcctcaatgaccacgttgtagaacttctggatg 298
            ||||| ||||| |||||||| || | |||||| || || || ||||| ||||| || |||
Sbjct: 1405 agaagatcggccacattggctggcaactcctcgattacaacattgtaaaacttttgaatg 1346

                                                                        
Query: 299  tcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccg 358
            || || |||||||| || || ||    ||||| |||||||| ||||| ||||| || || 
Sbjct: 1345 tcaaaaagcatcctttcgtcatcctttgtgacaaagttgatagcaacaccctttcttcca 1286

                                      
Query: 359  aaccgaccactacgaccaatgcgatg 384
            || || ||||||||||| || |||||
Sbjct: 1285 aatcgtccactacgaccgatacgatg 1260

---

>emb|CR380955.1| Candida glabrata strain CBS138 chromosome I complete sequence
          Length = 1089401

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 331    gaagttgatggcaactcccttcctcccgaaccgaccac 368
              ||||||||||||||| ||||| || ||||| |||||||
Sbjct: 390316 gaagttgatggcaacaccctttctaccgaaacgaccac 390279

---

>gb|AC164399.4| Mus musculus chromosome 8, clone RP23-338K3, complete sequence
          Length = 213363

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 164    actgagagttgggagatattcaaca 188
              ||||||| |||||||||||||||||
Sbjct: 207354 actgagacttgggagatattcaaca 207378

---

>ref|XM_798681.1| Trypanosoma brucei TREU927 eukaryotic initiation factor 4a
            (Tb09.160.3270) partial mRNA
          Length = 1215

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 326  gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaat 378
            |||||||||||||| || || ||||| |  ||| ||||||||| |||||||||
Sbjct: 1118 gtgacgaagttgattgccacacccttacgtccgtaccgaccaccacgaccaat 1066

---

>gb|AC099690.8| Mus musculus chromosome 8, clone RP23-73E9, complete sequence
          Length = 225655

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 164    actgagagttgggagatattcaaca 188
              ||||||| |||||||||||||||||
Sbjct: 107406 actgagacttgggagatattcaaca 107382

---

>emb|BX028053.1|CNS08TT5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 tgacgaagttgatggcaactccctt 351
           ||||||||||||| |||||||||||
Sbjct: 193 tgacgaagttgatagcaactccctt 217

---

>emb|X87371.1|SCX731 S.cerevisiae DNA from chromosome X (cosmids 7,31)
          Length = 40724

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 332   aagttgatggcaactcccttcctcccgaaccgaccac 368
             |||||||||||||| ||||| || ||||| |||||||
Sbjct: 22481 aagttgatggcaacaccctttctaccgaaacgaccac 22517

---

>emb|X58099.1|SCYURI S.cerevisiae YURI gene (3' end), TIF2 gene for eIF-4a, and RPB4
           gene for RNA polymerase II subunit 4
          Length = 3343

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 332 aagttgatggcaactcccttcctcccgaaccgaccac 368
           |||||||||||||| ||||| || ||||| |||||||
Sbjct: 170 aagttgatggcaacaccctttctaccgaaacgaccac 134

---

>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 332    aagttgatggcaactcccttcctcccgaaccgaccac 368
              |||||||||||||| ||||| || ||||| |||||||
Sbjct: 802336 aagttgatggcaacaccctttctaccgaaacgaccac 802372

---

>ref|NM_209008.1| Eremothecium gossypii ACR253Cp (ACR253C), mRNA
          Length = 1191

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 332  aagttgatggcaactcccttcctcccgaaccgaccac 368
            |||||||||||||| ||||| || ||||| |||||||
Sbjct: 1091 aagttgatggcaacaccctttctaccgaaacgaccac 1055

---

>emb|Z49413.1|SCYJL138C S.cerevisiae chromosome X reading frame ORF YJL138c
          Length = 1985

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 332 aagttgatggcaactcccttcctcccgaaccgaccac 368
           |||||||||||||| ||||| || ||||| |||||||
Sbjct: 605 aagttgatggcaacaccctttctaccgaaacgaccac 641

---

>emb|Z28284.1|SCYKR059W S.cerevisiae chromosome XI reading frame ORF YKR059w
          Length = 1897

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 332  aagttgatggcaactcccttcctcccgaaccgaccac 368
            |||||||||||||| ||||| || ||||| |||||||
Sbjct: 1454 aagttgatggcaacaccctttctaccgaaacgaccac 1418

---

>emb|X12814.1|SCTIF2 Yeast TIF2 gene
          Length = 1188

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 332  aagttgatggcaactcccttcctcccgaaccgaccac 368
            |||||||||||||| ||||| || ||||| |||||||
Sbjct: 1088 aagttgatggcaacaccctttctaccgaaacgaccac 1052

---

>emb|X12813.1|SCTIF1 Yeast TIF1 gene
          Length = 2363

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 332  aagttgatggcaactcccttcctcccgaaccgaccac 368
            |||||||||||||| ||||| || ||||| |||||||
Sbjct: 1684 aagttgatggcaacaccctttctaccgaaacgaccac 1648

---

>gb|AC109510.7| Mus musculus chromosome 8, clone RP23-23D6, complete sequence
          Length = 185866

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 164    actgagagttgggagatattcaaca 188
              ||||||| |||||||||||||||||
Sbjct: 119258 actgagacttgggagatattcaaca 119282

---

>gb|DQ331786.1| Synthetic construct Saccharomyces cerevisiae clone FLH202409.01X TIF1
            gene, complete sequence
          Length = 1188

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 332  aagttgatggcaactcccttcctcccgaaccgaccac 368
            |||||||||||||| ||||| || ||||| |||||||
Sbjct: 1088 aagttgatggcaacaccctttctaccgaaacgaccac 1052

---

>gb|AY432777.1| Aedes aegypti ASAP ID: 34063 translation initiation factor mRNA
            sequence
          Length = 1557

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 329  acgaagttgatggcaactcccttcctcccgaaccgaccac 368
            ||||||||||| ||||||||||| |  ||||| |||||||
Sbjct: 1189 acgaagttgattgcaactcccttacgaccgaaacgaccac 1150

---

>gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome
          Length = 1838554

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    tcaacaaaaacgaactttat 202
              ||||||||||||||||||||
Sbjct: 568207 tcaacaaaaacgaactttat 568188

---

>gb|AE006526.1| Streptococcus pyogenes M1 GAS, section 55 of 167 of the complete
            genome
          Length = 12393

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 183  tcaacaaaaacgaactttat 202
            ||||||||||||||||||||
Sbjct: 9134 tcaacaaaaacgaactttat 9115

---

>gb|DQ440212.1| Aedes aegypti clone AET-2104 initiation factor EIF-4A mRNA, complete
            cds
          Length = 1215

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 329  acgaagttgatggcaactcccttcctcccgaaccgaccac 368
            ||||||||||| ||||||||||| |  ||||| |||||||
Sbjct: 1121 acgaagttgattgcaactcccttacgaccgaaacgaccac 1082

---

>gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome
          Length = 1928252

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    tcaacaaaaacgaactttat 202
              ||||||||||||||||||||
Sbjct: 599188 tcaacaaaaacgaactttat 599169

---

>ref|XM_451255.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A05731g predicted mRNA
          Length = 1191

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccac 368
            ||||||||||||||| ||||  ||||| || ||||| |||||||
Sbjct: 1098 ggtgacgaagttgatagcaataccctttctaccgaaacgaccac 1055

---

>emb|CR696590.1|CNS0G0FU Tetraodon nigroviridis full-length cDNA
          Length = 1822

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 325  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgacca 376
            ||||||||||||||| ||||| || || || || || ||||||| |||||||
Sbjct: 1106 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgacca 1055

---

>emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on chromosome 9 Contains the
             5' end of the ABO gene for ABO blood group (transferase A
             alpha 1-3-N-acetylgalactosaminyltransferase; transferase B
             alpha 1-3-galactosyltransferase) pseudogene ABO-*O02
             allele, the gene for a novel protein similar to lipocalin
             1 (protein migrating faster than albumin tear prealbumin)
             (LCN1), a ribosomal protein L21 (RPL21) pseudogene, the
             RPL7A gene for ribosomal protein L7a, a novel gene
             (MGC43306), the XPMC2H gene for Xenopus prevents mitotic
             catastrophe 2 homolog, the 5' end of the ADAMTS13 gene for
             a disintegrin-like and metalloprotease (reprolysin type)
             with thrombospondin type 1 motif 13, the SURF1 gene for
             surfeit 1, the SURF2 gene for surfeit 2, the SURF4 gene
             for surfeit 4, the SURF5 gene for surfeit 5, the SURF6
             gene for surfeit 6 and eight CpG islands, complete
             sequence
          Length = 184513

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   aacagcatcctctcatcttc 321
             ||||||||||||||||||||
Sbjct: 58507 aacagcatcctctcatcttc 58488

---

>emb|BX066433.1|CNS09NF9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 676

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 327 tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 386
           |||| ||||| || ||||| ||||| | ||||||||||||   |||||| ||||||||||
Sbjct: 293 tgacaaagttaatagcaacacccttacgcccgaaccgacccgaacgaccgatgcgatgga 352

---

>emb|BX066432.1|CNS09NF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 770

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 327 tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 386
           |||| ||||| || ||||| ||||| | ||||||||||||   |||||| ||||||||||
Sbjct: 627 tgacaaagttaatagcaacacccttacgcccgaaccgacccgaacgaccgatgcgatgga 568

---

>emb|BX047039.1|CNS098GJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 191

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 327 tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 386
           |||| ||||| || ||||| ||||| | ||||||||||||   |||||| ||||||||||
Sbjct: 122 tgacaaagttaatagcaacacccttacgcccgaaccgacccgaacgaccgatgcgatgga 63

---

>emb|BX032724.1|CNS08XEW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 449

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 327 tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 386
           |||| ||||| || ||||| ||||| | ||||||||||||   |||||| ||||||||||
Sbjct: 289 tgacaaagttaatagcaacacccttacgcccgaaccgacccgaacgaccgatgcgatgga 348

---

>emb|BX026915.1|CNS08SXJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 327 tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 386
           |||| ||||| || ||||| ||||| | ||||||||||||   |||||| ||||||||||
Sbjct: 284 tgacaaagttaatagcaacacccttacgcccgaaccgacccgaacgaccgatgcgatgga 343

---

>emb|BX021814.1|CNS08OZU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 478

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 325 ggtgacgaagttgatggcaactcc 348
           ||||||||||||||| ||||||||
Sbjct: 88  ggtgacgaagttgatagcaactcc 65

---

>emb|BX021194.1|CNS08OIM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 591

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 327 tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 386
           |||| ||||| || ||||| ||||| | ||||||||||||   |||||| ||||||||||
Sbjct: 256 tgacaaagttaatagcaacacccttacgcccgaaccgacccgaacgaccgatgcgatgga 315

---

>emb|BX009925.1|CNS08FTL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 414

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 327 tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 386
           |||| ||||| || ||||| ||||| | ||||||||||||   |||||| ||||||||||
Sbjct: 266 tgacaaagttaatagcaacacccttacgcccgaaccgacccgaacgaccgatgcgatgga 325

---

>emb|BX009165.1|CNS08F8H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 327 tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 386
           |||| ||||| || ||||| ||||| | ||||||||||||   |||||| ||||||||||
Sbjct: 76  tgacaaagttaatagcaacacccttacgcccgaaccgacccgaacgaccgatgcgatgga 135

---

>emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome A of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1062590

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 325    ggtgacgaagttgatggcaactcccttcctcccgaaccgaccac 368
              ||||||||||||||| ||||  ||||| || ||||| |||||||
Sbjct: 537340 ggtgacgaagttgatagcaataccctttctaccgaaacgaccac 537297

---

>emb|CR938203.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YH04BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 596

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 329 acgaagttgatggcaactcccttcctcccgaaccgaccac 368
           ||||||||||| ||||||||||| |  ||||| |||||||
Sbjct: 487 acgaagttgattgcaactcccttacgaccgaagcgaccac 526

---

>gb|AC005334.1|AC005334 Drosophila melanogaster DNA sequence (P1s DS08221 (D130) and DS00738
            (D271)), complete sequence
          Length = 111448

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 131  gattcaaacagaaccagacc 150
            ||||||||||||||||||||
Sbjct: 5504 gattcaaacagaaccagacc 5485

---

>gb|CP000219.1| Drosophila melanogaster genomic scaffold 211000022280778
          Length = 150125

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 131    gattcaaacagaaccagacc 150
              ||||||||||||||||||||
Sbjct: 138194 gattcaaacagaaccagacc 138175

---

>gb|AC002107.1|AC002107 Genomic sequence from Human 9q34, complete sequence
          Length = 39265

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 302  aacagcatcctctcatcttc 321
            ||||||||||||||||||||
Sbjct: 5725 aacagcatcctctcatcttc 5706

---

>gb|AC002106.1|AC002106 Genomic sequence from Human 9q34, complete sequence
          Length = 40814

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   aacagcatcctctcatcttc 321
             ||||||||||||||||||||
Sbjct: 38431 aacagcatcctctcatcttc 38412


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,665,342
Number of Sequences: 3902068
Number of extensions: 2665342
Number of successful extensions: 44154
Number of sequences better than 10.0: 240
Number of HSP's better than 10.0 without gapping: 239
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 43803
Number of HSP's gapped (non-prelim): 342
length of query: 386
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 364
effective length of database: 17,147,199,772
effective search space: 6241580717008
effective search space used: 6241580717008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---