| Clone Name | rbart17b09 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | ref|XM_529433.1| PREDICTED: Pan troglodytes LOC451457 (LOC451457... | 40 | 1.3 | 2 | gb|CP000282.1| Saccharophagus degradans 2-40, complete genome | 40 | 1.3 |
|---|
>ref|XM_529433.1| PREDICTED: Pan troglodytes LOC451457 (LOC451457), mRNA Length = 600 Score = 40.1 bits (20), Expect = 1.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 45 acaacctcttcggccaccaa 64 |||||||||||||||||||| Sbjct: 35 acaacctcttcggccaccaa 16
>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome Length = 5057531 Score = 40.1 bits (20), Expect = 1.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 acggccattacaacctcttc 55 |||||||||||||||||||| Sbjct: 3195693 acggccattacaacctcttc 3195712 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 650,027 Number of Sequences: 3902068 Number of extensions: 650027 Number of successful extensions: 28963 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 28948 Number of HSP's gapped (non-prelim): 15 length of query: 110 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 89 effective length of database: 17,151,101,840 effective search space: 1526448063760 effective search space used: 1526448063760 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)