>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07,
             complete sequence
          Length = 164477

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%), Gaps = 5/58 (8%)
 Strand = Plus / Plus

                                                                       
Query: 16    tctcttttaccagttcaaaggagccctgcttggcctattggccagttgcaaatgttga 73
             ||||||||||||||||||||||||     || ||| ||||||||||||||||| ||||
Sbjct: 37937 tctcttttaccagttcaaaggagc-----tttgccaattggccagttgcaaatcttga 37989

>gb|AC108504.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1654_B10,
              complete sequence
          Length = 140282

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%), Gaps = 5/58 (8%)
 Strand = Plus / Plus

                                                                        
Query: 16     tctcttttaccagttcaaaggagccctgcttggcctattggccagttgcaaatgttga 73
              ||||||||||||||||||||||||     || ||| ||||||||||||||||| ||||
Sbjct: 105956 tctcttttaccagttcaaaggagc-----tttgccaattggccagttgcaaatcttga 106008

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%), Gaps = 5/58 (8%)
 Strand = Plus / Plus

                                                                        
Query: 16     tctcttttaccagttcaaaggagccctgcttggcctattggccagttgcaaatgttga 73
              ||||||||||||||||||||||||     || ||| ||||||||||||||||| ||||
Sbjct: 833514 tctcttttaccagttcaaaggagc-----tttgccaattggccagttgcaaatcttga 833566

>gb|AC093498.3| Drosophila melanogaster 3L BAC RP98-15O8 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 160931

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 305   gagtgtggggggtgtatggagg 326
             ||||||||||||||||||||||
Sbjct: 98838 gagtgtggggggtgtatggagg 98817

>gb|AE003538.4| Drosophila melanogaster chromosome 3L, section 47 of 83 of the complete
              sequence
          Length = 303314

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 305    gagtgtggggggtgtatggagg 326
              ||||||||||||||||||||||
Sbjct: 129516 gagtgtggggggtgtatggagg 129537

>dbj|AK136000.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420445D06 product:hypothetical
           protein, full insert sequence
          Length = 2383

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 208 gggaaggatcaagggctttta 228
           |||||||||||||||||||||
Sbjct: 348 gggaaggatcaagggctttta 368

>emb|AL929165.9| Mouse DNA sequence from clone RP23-446D4 on chromosome 2, complete
             sequence
          Length = 181326

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 208   gggaaggatcaagggctttta 228
             |||||||||||||||||||||
Sbjct: 84355 gggaaggatcaagggctttta 84335

>gb|AC162857.5| Mus musculus chromosome 15, clone RP23-333C11, complete sequence
          Length = 224913

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 373    ttactgcacaaaacatgatc 392
              ||||||||||||||||||||
Sbjct: 149648 ttactgcacaaaacatgatc 149667

>gb|AC108151.6| Homo sapiens BAC clone RP11-507K3 from 4, complete sequence
          Length = 63955

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 267  ggaaatgatacagtagaagtgaca 290
            ||||||||||||||||| ||||||
Sbjct: 6096 ggaaatgatacagtagaggtgaca 6119

>ref|XM_396618.2| PREDICTED: Apis mellifera similar to ENSANGP00000010836 (LOC413167),
            mRNA
          Length = 2990

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 122  taatactgttacatcggcga 141
            ||||||||||||||||||||
Sbjct: 1613 taatactgttacatcggcga 1594

>gb|AC102408.10| Mus musculus chromosome 15, clone RP24-351C14, complete sequence
          Length = 190773

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 373    ttactgcacaaaacatgatc 392
              ||||||||||||||||||||
Sbjct: 135603 ttactgcacaaaacatgatc 135584

>gb|AC134454.4| Mus musculus BAC clone RP24-286K15 from 3, complete sequence
          Length = 160740

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 307   gtgtggggggtgtatggagg 326
             ||||||||||||||||||||
Sbjct: 64479 gtgtggggggtgtatggagg 64498


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,934,712
Number of Sequences: 3902068
Number of extensions: 2934712
Number of successful extensions: 45283
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45236
Number of HSP's gapped (non-prelim): 47
length of query: 400
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 378
effective length of database: 17,147,199,772
effective search space: 6481641513816
effective search space used: 6481641513816
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)