ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart16g11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC002990.1|HUAC002990 Human Chromosome 16 BAC clone CIT987SK-... 54 4e-04
2gb|AC073636.4| Homo sapiens BAC clone RP11-279N12 from 2, comple... 48 0.024
3emb|AJ606075.1| Gossypium hirsutum mRNA for peroxidase (pox gene... 46 0.096
4gb|AC005034.2| Homo sapiens BAC clone RP11-342K6 from 2, complet... 46 0.096
5gb|AC155819.2| Mus musculus BAC clone RP23-402F16 from chromosom... 44 0.38
6ref|XM_306325.2| Anopheles gambiae str. PEST ENSANGP00000015437 ... 44 0.38
7gb|AC155808.2| Mus musculus BAC clone RP24-267H3 from 12, comple... 44 0.38
8gb|AC005510.3|AC005510 Homo sapiens chromosome 4 clone B368A9 ma... 44 0.38
9ref|NM_126037.3| Arabidopsis thaliana peroxidase AT5G66390 mRNA,... 42 1.5
10ref|XM_479283.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.5
11gb|AY616754.1| Homo sapiens biliverdin reductase A (BLVRA) gene,... 42 1.5
12gb|AC122161.26| Medicago truncatula clone mth2-11l3, complete se... 42 1.5
13gb|AC158209.13| Medicago truncatula clone mth2-154h5, complete s... 42 1.5
14gb|AC122171.21| Medicago truncatula clone mth2-23b18, complete s... 42 1.5
15emb|Z70050.1|HSU83C4 Human DNA sequence from clone LL0XNC01-83C4... 42 1.5
16emb|AL392083.17| Human DNA sequence from clone RP11-29A19 on chr... 42 1.5
17emb|AL121996.15|HSG118G19 Human DNA sequence from clone GS1-118G... 42 1.5
18gb|BT008314.1| Arabidopsis thaliana At5g66390 gene, complete cds 42 1.5
19dbj|AB005745.1| Loligo bleekeri mitochondrial genomic DNA, 9kb f... 42 1.5
20dbj|AB240154.1| Sepioteuthis lessoniana mitochondrial DNA, compl... 42 1.5
21dbj|AB029616.1| Loligo bleekeri mitochondrial DNA, complete sequ... 42 1.5
22gb|AY965679.1| Eptatretus burgeri variable lymphocyte receptor B... 42 1.5
23gb|AC103798.2| Homo sapiens chromosome 11, clone RP11-159D8, com... 42 1.5
24gb|AC090538.6| Homo sapiens chromosome 11, clone RP5-1079I11, co... 42 1.5
25gb|AC023275.3|AC023275 Homo sapiens BAC clone RP11-375L10 from 1... 42 1.5
26dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
27emb|BX832751.1|CNS0A130 Arabidopsis thaliana Full-length cDNA Co... 42 1.5
28emb|BX832014.1|CNS0A146 Arabidopsis thaliana Full-length cDNA Co... 42 1.5
29dbj|AP005292.5| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
30dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 42 1.5
31dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.5
32dbj|AB075953.1| Carios capensis mitochondrial DNA, complete sequ... 42 1.5
33dbj|AK110555.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
34gb|AC004939.1|AC004939 Homo sapiens PAC clone RP5-974M14 from 7p... 42 1.5
35tpe|BN000637.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-gr... 42 1.5
36emb|AL845442.7| Mouse DNA sequence from clone RP23-392D9 on chro... 42 1.5
37gb|AC154046.1| Drosophila melanogaster clone BACR29O22, complete... 40 5.9
38gb|AC158357.4| Mus musculus BAC clone RP23-434L22 from chromosom... 40 5.9
39gb|AC124364.4| Mus musculus BAC clone RP24-538E16 from chromosom... 40 5.9
40gb|AC116999.2| Mus musculus BAC clone RP23-28L10 from 19, comple... 40 5.9
41gb|AC121988.2| Mus musculus BAC clone RP24-295B16 from 10, compl... 40 5.9
42emb|CR729961.2|CNS0GQ6N Tetraodon nigroviridis full-length cDNA 40 5.9
43gb|AC146122.2| Pan troglodytes BAC clone RP43-23C4 from 7, compl... 40 5.9
44gb|AC004917.2| Homo sapiens PAC clone RP5-892G19 from 7, complet... 40 5.9
45gb|AC149067.3| Mus musculus BAC clone RP23-56C20 from chromosome... 40 5.9
46emb|AL163283.2|HS21C083 Homo sapiens chromosome 21 segment HS21C083 40 5.9
47gb|AY321476.1| Tribolium castaneum Achaete-Scute complex gene cl... 40 5.9
48emb|AL589791.4| Human DNA sequence from clone RP11-505P2 on chro... 40 5.9
49emb|AL449266.17| Human DNA sequence from clone RP11-475E11 on ch... 40 5.9
50emb|AL359390.14| Human DNA sequence from clone RP11-139E24 on ch... 40 5.9
51emb|AL139185.9| Human DNA sequence from clone RP11-75E6 on chrom... 40 5.9
52emb|AL050315.11|HS1173K17 Human DNA sequence from clone RP5-1173... 40 5.9
53emb|AL035251.11|HS705O1 Human DNA sequence from clone RP4-705O1 ... 40 5.9
54emb|CR385039.8| Zebrafish DNA sequence from clone DKEYP-31D1 in ... 40 5.9
55emb|AL669928.8| Mouse DNA sequence from clone RP23-76F22 on chro... 40 5.9
56emb|AL954236.1| Pan troglodytes chromosome 22 clone RP43-054L10 ... 40 5.9
57gb|AC069405.6| Drosophila melanogaster 3L BAC RP98-17J20 (Roswel... 40 5.9
58gb|AF043945.2|AF043945 Homo sapiens chromosome 21 clone PAC 39C1... 40 5.9
59emb|BX831693.1|CNS0A12M Arabidopsis thaliana Full-length cDNA Co... 40 5.9
60gb|AF130813.1|AF130813 Buchnera aphidicola natural-host Schlecht... 40 5.9
61gb|AE003537.3| Drosophila melanogaster chromosome 3L, section 48... 40 5.9
62dbj|AP006123.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 5.9
63gb|AC153547.3| Mus musculus 10 BAC RP23-429B12 (Roswell Park Can... 40 5.9
64emb|AL672033.12| Mouse DNA sequence from clone RP23-436F2 on chr... 40 5.9 
>gb|AC002990.1|HUAC002990 Human Chromosome 16 BAC clone CIT987SK-A-1000D7, complete sequence
          Length = 106760

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                            
Query: 156   aaaatttagtttgaaataaaggagaaaagaa 186
             |||||||||||| ||||||||||||||||||
Sbjct: 64180 aaaatttagtttaaaataaaggagaaaagaa 64150
to top
>gb|AC073636.4| Homo sapiens BAC clone RP11-279N12 from 2, complete sequence
          Length = 151018

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 118   gattacaacacaaatgaatgaaatgaat 145
             ||||||| ||||||||||||||||||||
Sbjct: 38760 gattacagcacaaatgaatgaaatgaat 38733
to top
>emb|AJ606075.1| Gossypium hirsutum mRNA for peroxidase (pox gene), strain Xuzhou
           142
          Length = 1205

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 318 atatttcccatcttcaccattgc 340
           |||||||||||||||||||||||
Sbjct: 939 atatttcccatcttcaccattgc 917
to top
>gb|AC005034.2| Homo sapiens BAC clone RP11-342K6 from 2, complete sequence
          Length = 198587

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 180   aaaagaagaccggaaggcacatt 202
             |||||||||||||||||||||||
Sbjct: 29448 aaaagaagaccggaaggcacatt 29426
to top
>gb|AC155819.2| Mus musculus BAC clone RP23-402F16 from chromosome 12, complete
             sequence
          Length = 201181

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 284   tctgatctcacctttggtgctg 305
             ||||||||||||||||||||||
Sbjct: 10908 tctgatctcacctttggtgctg 10887
to top
>ref|XM_306325.2| Anopheles gambiae str. PEST ENSANGP00000015437
           (ENSANGG00000012948), partial mRNA
          Length = 789

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 212 atgaactgaacaccctctgcca 233
           ||||||||||||||||||||||
Sbjct: 116 atgaactgaacaccctctgcca 137
to top
>gb|AC155808.2| Mus musculus BAC clone RP24-267H3 from 12, complete sequence
          Length = 184888

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 284   tctgatctcacctttggtgctg 305
             ||||||||||||||||||||||
Sbjct: 57826 tctgatctcacctttggtgctg 57847
to top
>gb|AC005510.3|AC005510 Homo sapiens chromosome 4 clone B368A9 map 4q25, complete sequence
          Length = 168468

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 62    attcatcaatctcagtataaagtatt 87
             |||| |||||||||||||||||||||
Sbjct: 29496 attcctcaatctcagtataaagtatt 29521
to top
>ref|NM_126037.3| Arabidopsis thaliana peroxidase AT5G66390 mRNA, complete cds
          Length = 1213

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 317  gatatttcccatcttcaccat 337
            |||||||||||||||||||||
Sbjct: 1000 gatatttcccatcttcaccat 980
to top
>ref|XM_479283.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1035

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 407 cttcgtctgcagcgacgtcatgagcgccgcgtc 439
           |||||||| |||||||||||  |||||||||||
Sbjct: 897 cttcgtctccagcgacgtcagcagcgccgcgtc 865
to top
>gb|AY616754.1| Homo sapiens biliverdin reductase A (BLVRA) gene, complete cds
          Length = 52622

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 120   ttacaacacaaatgaatgaaatgaa 144
             |||||||| ||||||||||||||||
Sbjct: 43566 ttacaacagaaatgaatgaaatgaa 43542
to top
>gb|AC122161.26| Medicago truncatula clone mth2-11l3, complete sequence
          Length = 118625

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 159   atttagtttgaaataaaggagaaaa 183
             |||||| ||||||||||||||||||
Sbjct: 37250 atttagattgaaataaaggagaaaa 37274
to top
>gb|AC158209.13| Medicago truncatula clone mth2-154h5, complete sequence
          Length = 93864

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 121  tacaacacaaatgaatgaaatgaat 145
            ||||||||||| |||||||||||||
Sbjct: 1581 tacaacacaaaggaatgaaatgaat 1557
to top
>gb|AC122171.21| Medicago truncatula clone mth2-23b18, complete sequence
          Length = 125865

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 159   atttagtttgaaataaaggagaaaa 183
             |||||| ||||||||||||||||||
Sbjct: 80829 atttagattgaaataaaggagaaaa 80805
to top
>emb|Z70050.1|HSU83C4 Human DNA sequence from clone LL0XNC01-83C4 on chromosome X, complete
             sequence
          Length = 39876

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 276   cacatctttctgatctcacct 296
             |||||||||||||||||||||
Sbjct: 19463 cacatctttctgatctcacct 19443
to top
>emb|AL392083.17| Human DNA sequence from clone RP11-29A19 on chromosome 10 Contains the
             3' end of the gene for double-stranded RNA specific
             adenosine deaminase (ADAR3) (FLJ30545 FLJ25034 FLJ36975)
             and three CpG islands, complete sequence
          Length = 164741

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 128   caaatgaatgaaatgaatcaa 148
             |||||||||||||||||||||
Sbjct: 56078 caaatgaatgaaatgaatcaa 56058
to top
>emb|AL121996.15|HSG118G19 Human DNA sequence from clone GS1-118G19 on chromosome 1q25.1-31.1
             Contains the 5' end of the gene for hemicentin, complete
             sequence
          Length = 87461

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 128   caaatgaatgaaatgaatcaa 148
             |||||||||||||||||||||
Sbjct: 86755 caaatgaatgaaatgaatcaa 86735
to top
>gb|BT008314.1| Arabidopsis thaliana At5g66390 gene, complete cds
          Length = 1011

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 317 gatatttcccatcttcaccat 337
           |||||||||||||||||||||
Sbjct: 945 gatatttcccatcttcaccat 925
to top
>dbj|AB005745.1| Loligo bleekeri mitochondrial genomic DNA, 9kb fragment from ND2 to
            tRNA-Leu region
          Length = 9240

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 25   tatattcccaatacaaaataa 45
            |||||||||||||||||||||
Sbjct: 5832 tatattcccaatacaaaataa 5852
to top
>dbj|AB240154.1| Sepioteuthis lessoniana mitochondrial DNA, complete genome
          Length = 16631

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    tatattcccaatacaaaataa 45
             |||||||||||||||||||||
Sbjct: 10717 tatattcccaatacaaaataa 10737
to top
>dbj|AB029616.1| Loligo bleekeri mitochondrial DNA, complete sequence
          Length = 17211

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    tatattcccaatacaaaataa 45
             |||||||||||||||||||||
Sbjct: 13809 tatattcccaatacaaaataa 13829
to top
>gb|AY965679.1| Eptatretus burgeri variable lymphocyte receptor B (VLRB) gene, complete
             cds
          Length = 91972

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 128   caaatgaatgaaatgaatcaa 148
             |||||||||||||||||||||
Sbjct: 56981 caaatgaatgaaatgaatcaa 57001
to top
>gb|AC103798.2| Homo sapiens chromosome 11, clone RP11-159D8, complete sequence
          Length = 163680

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 98    gagtacagtggcacaataagg 118
             |||||||||||||||||||||
Sbjct: 28320 gagtacagtggcacaataagg 28340
to top
>gb|AC090538.6| Homo sapiens chromosome 11, clone RP5-1079I11, complete sequence
          Length = 158201

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 98     gagtacagtggcacaataagg 118
              |||||||||||||||||||||
Sbjct: 140569 gagtacagtggcacaataagg 140589
to top
>gb|AC023275.3|AC023275 Homo sapiens BAC clone RP11-375L10 from 1, complete sequence
          Length = 180248

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 128   caaatgaatgaaatgaatcaa 148
             |||||||||||||||||||||
Sbjct: 72223 caaatgaatgaaatgaatcaa 72243
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 407      cttcgtctgcagcgacgtcatgagcgccgcgtc 439
                |||||||| |||||||||||  |||||||||||
Sbjct: 26562881 cttcgtctccagcgacgtcagcagcgccgcgtc 26562849
to top
>emb|BX832751.1|CNS0A130 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH95ZG01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1192

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 317 gatatttcccatcttcaccat 337
           |||||||||||||||||||||
Sbjct: 991 gatatttcccatcttcaccat 971
to top
>emb|BX832014.1|CNS0A146 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH46ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1203

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 317 gatatttcccatcttcaccat 337
           |||||||||||||||||||||
Sbjct: 991 gatatttcccatcttcaccat 971
to top
>dbj|AP005292.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1340_C08
          Length = 192167

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 407    cttcgtctgcagcgacgtcatgagcgccgcgtc 439
              |||||||| |||||||||||  |||||||||||
Sbjct: 108152 cttcgtctccagcgacgtcagcagcgccgcgtc 108120
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 407     cttcgtctgcagcgacgtcatgagcgccg 435
               ||||||||||| ||| |||||||||||||
Sbjct: 6854982 cttcgtctgcatcgaggtcatgagcgccg 6854954
to top
>dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13
          Length = 83511

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 317  gatatttcccatcttcaccat 337
            |||||||||||||||||||||
Sbjct: 5045 gatatttcccatcttcaccat 5065
to top
>dbj|AB075953.1| Carios capensis mitochondrial DNA, complete sequence
          Length = 14418

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 151   agcaaaaaatttagtttgaaataaa 175
             ||||||||||| |||||||||||||
Sbjct: 13445 agcaaaaaattaagtttgaaataaa 13421
to top
>dbj|AK110555.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-168-C06, full
           insert sequence
          Length = 1304

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 407 cttcgtctgcagcgacgtcatgagcgccgcgtc 439
           |||||||| |||||||||||  |||||||||||
Sbjct: 970 cttcgtctccagcgacgtcagcagcgccgcgtc 938
to top
>gb|AC004939.1|AC004939 Homo sapiens PAC clone RP5-974M14 from 7p22, complete sequence
          Length = 8717

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 120  ttacaacacaaatgaatgaaatgaa 144
            |||||||| ||||||||||||||||
Sbjct: 5813 ttacaacagaaatgaatgaaatgaa 5837
to top
>tpe|BN000637.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-group) prx108 gene
           for class III peroxidase 108 precursor, exon 1
          Length = 1035

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 407 cttcgtctgcagcgacgtcatgagcgccgcgtc 439
           |||||||| |||||||||||  |||||||||||
Sbjct: 897 cttcgtctccagcgacgtcagcagcgccgcgtc 865
to top
>emb|AL845442.7| Mouse DNA sequence from clone RP23-392D9 on chromosome 2, complete
              sequence
          Length = 192013

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 159    atttagtttgaaataaaggagaaaa 183
              ||||||| |||||||||||||||||
Sbjct: 162099 atttagtatgaaataaaggagaaaa 162123
to top
>gb|AC154046.1| Drosophila melanogaster clone BACR29O22, complete sequence
          Length = 177480

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 157    aaatttagtttgaaataaag 176
              ||||||||||||||||||||
Sbjct: 151962 aaatttagtttgaaataaag 151981
to top
>gb|AC158357.4| Mus musculus BAC clone RP23-434L22 from chromosome 8, complete sequence
          Length = 217671

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 118    gattacaacacaaatgaatgaaat 141
              ||||| ||||||||||||||||||
Sbjct: 119415 gattaaaacacaaatgaatgaaat 119392
to top
>gb|AC124364.4| Mus musculus BAC clone RP24-538E16 from chromosome 12, complete sequence
          Length = 177697

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 279    atctttctgatctcaccttt 298
              ||||||||||||||||||||
Sbjct: 110999 atctttctgatctcaccttt 111018
to top
>gb|AC116999.2| Mus musculus BAC clone RP23-28L10 from 19, complete sequence
          Length = 209671

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    caatacaaaataacaataaa 52
             ||||||||||||||||||||
Sbjct: 88511 caatacaaaataacaataaa 88492
to top
>gb|AC121988.2| Mus musculus BAC clone RP24-295B16 from 10, complete sequence
          Length = 154373

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 129   aaatgaatgaaatgaatcaa 148
             ||||||||||||||||||||
Sbjct: 89056 aaatgaatgaaatgaatcaa 89075
to top
>emb|CR729961.2|CNS0GQ6N Tetraodon nigroviridis full-length cDNA
          Length = 1129

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 159  atttagtttgaaataaagga 178
            ||||||||||||||||||||
Sbjct: 1095 atttagtttgaaataaagga 1114
to top
>gb|AC146122.2| Pan troglodytes BAC clone RP43-23C4 from 7, complete sequence
          Length = 143388

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tagtataaagtatattccca 34
             ||||||||||||||||||||
Sbjct: 45902 tagtataaagtatattccca 45883
to top
>gb|AC004917.2| Homo sapiens PAC clone RP5-892G19 from 7, complete sequence
          Length = 110233

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tagtataaagtatattccca 34
             ||||||||||||||||||||
Sbjct: 97601 tagtataaagtatattccca 97582
to top
>gb|AC149067.3| Mus musculus BAC clone RP23-56C20 from chromosome 7, complete sequence
          Length = 267610

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    aatacaaaataacaataaac 53
             ||||||||||||||||||||
Sbjct: 32321 aatacaaaataacaataaac 32302
to top
>emb|AL163283.2|HS21C083 Homo sapiens chromosome 21 segment HS21C083
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 278    catctttctgatctcacctt 297
              ||||||||||||||||||||
Sbjct: 336967 catctttctgatctcacctt 336986
to top
>gb|AY321476.1| Tribolium castaneum Achaete-Scute complex gene cluster, partial sequence
          Length = 128073

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 152    gcaaaaaatttagtttgaaataaa 175
              |||||||||||| |||||||||||
Sbjct: 102995 gcaaaaaatttaatttgaaataaa 102972
to top
>emb|AL589791.4| Human DNA sequence from clone RP11-505P2 on chromosome 13, complete
             sequence
          Length = 161474

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 95    attgagtacagtggcacaat 114
             ||||||||||||||||||||
Sbjct: 68974 attgagtacagtggcacaat 68993
to top
>emb|AL449266.17| Human DNA sequence from clone RP11-475E11 on chromosome 1 Contains
            the 3' end of the STXBP3 gene for syntaxin binding
            protein 3, a novel gene (MGC26989), a novel gene, the
            gene for LGN protein, the gene for Mid-1-related chloride
            channel 1 (MCLC) and the 3' end of novel gene (KIAA0893),
            complete sequence
          Length = 182553

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 291  tcacctttggtgctgtccttcact 314
            |||||||||||||| |||||||||
Sbjct: 2153 tcacctttggtgctttccttcact 2176
to top
>emb|AL359390.14| Human DNA sequence from clone RP11-139E24 on chromosome 1, complete
             sequence
          Length = 83750

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 169   aaataaaggagaaaagaaga 188
             ||||||||||||||||||||
Sbjct: 21054 aaataaaggagaaaagaaga 21073
to top
>emb|AL139185.9| Human DNA sequence from clone RP11-75E6 on chromosome 13q31.1-31.3,
             complete sequence
          Length = 123500

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 95    attgagtacagtggcacaat 114
             ||||||||||||||||||||
Sbjct: 70096 attgagtacagtggcacaat 70115
to top
>emb|AL050315.11|HS1173K17 Human DNA sequence from clone RP5-1173K17 on chromosome 20 Contains
           part of the PLCB1 gene for phospholipase C beta 1
           (phosphoinositide-specific), complete sequence
          Length = 64810

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 167 tgaaataaaggagaaaagaa 186
           ||||||||||||||||||||
Sbjct: 664 tgaaataaaggagaaaagaa 645
to top
>emb|AL035251.11|HS705O1 Human DNA sequence from clone RP4-705O1 on chromosome 20q11.2 Contains a
              novel gene, complete sequence
          Length = 161888

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 130    aatgaatgaaatgaatcaac 149
              ||||||||||||||||||||
Sbjct: 151081 aatgaatgaaatgaatcaac 151100
to top
>emb|CR385039.8| Zebrafish DNA sequence from clone DKEYP-31D1 in linkage group 24,
             complete sequence
          Length = 166302

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   gtttgaaataaaggagaaaa 183
             ||||||||||||||||||||
Sbjct: 61422 gtttgaaataaaggagaaaa 61403
to top
>emb|AL669928.8| Mouse DNA sequence from clone RP23-76F22 on chromosome 11 Contains a
             pseudogene similar to part of a member of the tropomyosin
             gene family, complete sequence
          Length = 100326

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   aaaaaatttagtttgaaata 173
             ||||||||||||||||||||
Sbjct: 43168 aaaaaatttagtttgaaata 43187
to top
>emb|AL954236.1| Pan troglodytes chromosome 22 clone RP43-054L10 map 22q22.2-q22.3,
              complete sequence
          Length = 195913

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 278    catctttctgatctcacctt 297
              ||||||||||||||||||||
Sbjct: 142308 catctttctgatctcacctt 142327
to top
>gb|AC069405.6| Drosophila melanogaster 3L BAC RP98-17J20 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 167638

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 157   aaatttagtttgaaataaag 176
             ||||||||||||||||||||
Sbjct: 79794 aaatttagtttgaaataaag 79775
to top
>gb|AF043945.2|AF043945 Homo sapiens chromosome 21 clone PAC 39C17 map 21q22.3, complete
             sequence
          Length = 109865

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 278   catctttctgatctcacctt 297
             ||||||||||||||||||||
Sbjct: 59296 catctttctgatctcacctt 59315
to top
>emb|BX831693.1|CNS0A12M Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH24ZD02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1117

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 318 atatttcccatcttcaccat 337
           ||||||||||||||||||||
Sbjct: 977 atatttcccatcttcaccat 958
to top
>gb|AF130813.1|AF130813 Buchnera aphidicola natural-host Schlechtendalia chinensis NifS
           protein homolog (nifS) gene, partial cds; tRNA-Trp gene,
           complete sequence; dihydroxy acid dehydratase (ilvD) and
           acetohydroxy acid isomeroreductase (ilvC) genes,
           complete cds; and ATP-dependent DNA helicase (rep) gene,
           partial cds
          Length = 4432

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 34  aatacaaaataacaataaac 53
           ||||||||||||||||||||
Sbjct: 260 aatacaaaataacaataaac 241
to top
>gb|AE003537.3| Drosophila melanogaster chromosome 3L, section 48 of 83 of the complete
              sequence
          Length = 282116

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 157    aaatttagtttgaaataaag 176
              ||||||||||||||||||||
Sbjct: 275506 aaatttagtttgaaataaag 275487
to top
>dbj|AP006123.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT41E18, TM0207,
             complete sequence
          Length = 115290

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 324   cccatcttcaccattgcatc 343
             ||||||||||||||||||||
Sbjct: 20028 cccatcttcaccattgcatc 20047
to top
>gb|AC153547.3| Mus musculus 10 BAC RP23-429B12 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 206024

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     caatacaaaataacaataaa 52
              ||||||||||||||||||||
Sbjct: 147122 caatacaaaataacaataaa 147141
to top
>emb|AL672033.12| Mouse DNA sequence from clone RP23-436F2 on chromosome X, complete
             sequence
          Length = 181933

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    tatattcccaatacaaaata 44
             ||||||||||||||||||||
Sbjct: 50855 tatattcccaatacaaaata 50874


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,941,054
Number of Sequences: 3902068
Number of extensions: 4941054
Number of successful extensions: 129967
Number of sequences better than 10.0: 64
Number of HSP's better than 10.0 without gapping: 64
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 129777
Number of HSP's gapped (non-prelim): 190
length of query: 440
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 418
effective length of database: 17,147,199,772
effective search space: 7167529504696
effective search space used: 7167529504696
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top